ID: 977464553

View in Genome Browser
Species Human (GRCh38)
Location 4:97367546-97367568
Sequence ATGTCAGAGAGCCACCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977464553 Original CRISPR ATGTCAGAGAGCCACCTGAA AGG Intronic
902792997 1:18781802-18781824 ATGGCACAGAGCCACCTCACAGG - Intergenic
903993807 1:27292354-27292376 ATGTCATAGAGCCTCACGAAGGG - Exonic
904124015 1:28223381-28223403 AAGCCAGAGAGCCACATGGAAGG + Intronic
907906144 1:58784668-58784690 ACTTCACAGAGCCACCTTAAGGG - Intergenic
912622960 1:111183700-111183722 ATGTCAGAAATCCACATAAATGG + Intronic
912719140 1:112005040-112005062 ATGTCAAAGAGCTGCCTGAGGGG + Intergenic
920364111 1:205439100-205439122 AGGCCAGAGAGCCTCCTGGAGGG - Intronic
921424564 1:214986342-214986364 GTGTCAGTGAGACTCCTGAATGG - Intergenic
921784264 1:219209135-219209157 ATGGACAAGAGCCACCTGAAAGG - Intronic
921892033 1:220363440-220363462 ATGTCTGATCTCCACCTGAAAGG - Intergenic
1063238397 10:4142952-4142974 ATCTGAGAGATTCACCTGAAGGG - Intergenic
1065651158 10:27893475-27893497 ATAGCTGAGAGCCACATGAAAGG - Intronic
1069133026 10:64729793-64729815 ATGTGAGAGAGGCAGCAGAAAGG + Intergenic
1069639999 10:69948628-69948650 ATGTCAGAAAGACATTTGAAAGG - Intronic
1072141208 10:92590813-92590835 ATGCCAGCGAGCCACCTAAGAGG + Intergenic
1072260319 10:93663960-93663982 ATGCAATAGAGCCACCTAAAAGG - Intronic
1076304475 10:129454856-129454878 ATGCCAGAGGGGCACCTGCAGGG - Intergenic
1076402362 10:130192504-130192526 AGGCCACAGGGCCACCTGAAGGG - Intergenic
1079002730 11:16771492-16771514 ATAGAAAAGAGCCACCTGAAGGG + Intergenic
1079495699 11:21041416-21041438 AAGTCAGAGAGTCACGTGAAAGG + Intronic
1081528722 11:43943828-43943850 ATGTCTGTGAGGCTCCTGAAAGG + Intronic
1081668141 11:44928436-44928458 AGGTCACAGAGCCACCAGCAGGG - Intronic
1084727965 11:70954219-70954241 AACTCAGAAAGCCACCTGGAGGG + Intronic
1085298426 11:75444178-75444200 CTGCCACAGAGCCACTTGAAGGG - Intronic
1087439221 11:98161550-98161572 ATGTCAAAGAGGCAGCTGAATGG + Intergenic
1088001825 11:104891307-104891329 ATGTCACATAGCATCCTGAATGG - Intergenic
1088777604 11:113100619-113100641 ATGTCAAAGAGGCAGCTGAACGG - Intronic
1091777709 12:3195474-3195496 TGCTCAGAGAGCCCCCTGAAGGG + Intronic
1092663906 12:10772688-10772710 ATGTCAGAGAGCCACTGCTAAGG + Intergenic
1097037283 12:56132201-56132223 GTGTCAGAGAGTGAGCTGAATGG - Exonic
1099930008 12:89062979-89063001 CTTTCACAGAGCCACCTTAATGG - Intergenic
1101775305 12:107788124-107788146 ATGTCCAACAGCCACCTGGATGG + Intergenic
1103727090 12:123003402-123003424 GGGTCAGAGAGCCACCTGGGAGG + Intronic
1106081359 13:26502924-26502946 ATGTCAGAGAGCTGCCTGCCAGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107853878 13:44595899-44595921 ATGACAGAGAGCCAACAGAATGG + Intergenic
1108171733 13:47748894-47748916 ATGTCAGAGTGACACCTTAGCGG - Intergenic
1114183775 14:20385076-20385098 CTGTCACAGAGCGCCCTGAAGGG + Exonic
1114822289 14:26035397-26035419 ATGTCAGAAAGGCATTTGAAAGG - Intergenic
1117442402 14:55772285-55772307 ATGCCAGAGGGGGACCTGAAAGG + Intergenic
1117717527 14:58596198-58596220 TTGTAAGAAAGCCACTTGAACGG - Intergenic
1119806138 14:77483888-77483910 ATGGGGGACAGCCACCTGAAGGG - Intronic
1123220976 14:106854903-106854925 ATGTCAGGAAGCCCCCTGAGGGG - Intergenic
1125409780 15:39393848-39393870 CTGTCAGAGACCCACCAAAATGG + Intergenic
1134692119 16:16197825-16197847 GTGTCAGAGAGGCACATGAAAGG - Intronic
1135336931 16:21609629-21609651 ATGTGAGACAGCCACGGGAAAGG + Intronic
1139638612 16:68274806-68274828 ATGTCAGCTCGCCACCTCAAAGG + Exonic
1141744999 16:85919726-85919748 ATCTCTGACAGCCAACTGAAAGG - Intronic
1142800728 17:2343861-2343883 ATGTATCAGAGTCACCTGAAGGG + Intronic
1143684850 17:8505363-8505385 ATGGAAGAGAGGCACCTGGAGGG - Intronic
1145933589 17:28702442-28702464 AGGTAAGAAAGCCAGCTGAAAGG - Exonic
1151016775 17:70563424-70563446 ATGGCAGAGAGCCAACAGCATGG - Intergenic
1153477388 18:5511850-5511872 AATTCAGAGAACCACCTGGATGG + Intronic
1153908324 18:9683944-9683966 AAGGGAGAGAGCCACTTGAAAGG - Intergenic
1155236022 18:23820057-23820079 GTCTCAGGGAGCCCCCTGAAAGG + Intronic
1156365324 18:36420785-36420807 TGGTCAGAAAGCCACCAGAATGG - Intronic
1157083363 18:44552433-44552455 ATGTCCTAGAGCCACCAGGAAGG - Intergenic
1158204850 18:54981313-54981335 ATTTCAGAGAGCCAGTTAAATGG + Intergenic
1159828341 18:73242470-73242492 ATGTCTAAGAGACACCTCAAAGG + Intronic
1163201804 19:15775052-15775074 ATGTCAGAGAAGAACCAGAAAGG + Intergenic
926146649 2:10400514-10400536 ATCTCAGAGAGCCATCTGAGCGG + Intronic
927336141 2:21926748-21926770 ATGTAAGACAGCATCCTGAAAGG - Intergenic
929584892 2:43107349-43107371 AGGTCAGAGAGTCATGTGAATGG + Intergenic
932174627 2:69588310-69588332 ATGTCAGGTACCCACCTGATGGG - Intronic
932232761 2:70095998-70096020 ATGTCAGCTAGCCACTCGAATGG + Intergenic
935235282 2:101133347-101133369 ATCTCAGAGAGAGACTTGAATGG - Intronic
936775344 2:115965756-115965778 AAGTCTGAGATCCACCTGCAAGG - Intergenic
939817605 2:146915532-146915554 TGTTCAGAGGGCCACCTGAAAGG - Intergenic
942442921 2:176054727-176054749 ATGTCAGAGAGTTATCTGAAAGG - Intergenic
948669708 2:239559958-239559980 ATCTCAGATAGCCACATGGAAGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170298206 20:14852584-14852606 CTGTCACAGAGCCACCTAAGGGG - Intronic
1176385382 21:6136420-6136442 CTGTCACAGAGACACCTGACAGG + Intergenic
1177049648 21:16216678-16216700 ATGTAAGAATGCCACCAGAATGG - Intergenic
1178674346 21:34618099-34618121 ACATCAGAGAGCCAGCTGCAAGG - Intergenic
1179278111 21:39910180-39910202 ATGTCAGAGAGACACTTTAGTGG + Intronic
1179538562 21:42068413-42068435 CTGTCAGAGAGCCACCTGGATGG + Intronic
1179738091 21:43401832-43401854 CTGTCACAGAGACACCTGACAGG - Intergenic
1181498769 22:23303444-23303466 ACATCAGAGACCCCCCTGAATGG - Intronic
1185366833 22:50440723-50440745 ATGTGAGAGGGCCACATGTATGG + Intronic
950284556 3:11734341-11734363 CTGTCTGAGAGACATCTGAAAGG + Intergenic
950723741 3:14902426-14902448 AGTTCAGAGAGCCACCTGCTAGG + Intronic
953520587 3:43638979-43639001 ATGTGAGGGAGCCACCTTAGAGG - Intronic
955599441 3:60629258-60629280 ATCTCACAGAGCTACATGAAAGG + Intronic
959085556 3:101848483-101848505 AGTTCAGTGAGCCACCTAAAAGG - Intronic
959762428 3:109982300-109982322 ATGCCTGAGAACCACCTGGAAGG + Intergenic
960430550 3:117563352-117563374 AGGTCAGAGAGCTAACAGAACGG + Intergenic
962750795 3:138433804-138433826 ATTTCAGACGGCCACATGAAAGG - Intergenic
966156571 3:176922908-176922930 ATGTGGGAGAGCTTCCTGAAGGG - Intergenic
967879674 3:194292512-194292534 GTGTCAGAGAGTGACCTGAGGGG - Intergenic
968009867 3:195267233-195267255 AGGTCCCAGAGCCAACTGAAGGG + Intronic
971742934 4:30543063-30543085 ATGTTCAAGAGCCACATGAAAGG - Intergenic
975448055 4:74490677-74490699 ATGTAACAGAGACACCTGACAGG - Intergenic
977464553 4:97367546-97367568 ATGTCAGAGAGCCACCTGAAAGG + Intronic
979217470 4:118182633-118182655 GTGTCAGGCAGCCAGCTGAATGG - Intronic
980197893 4:129614729-129614751 ATATGAGAGAACCTCCTGAAAGG - Intergenic
985974464 5:3405177-3405199 AGGTCAGAAGGCCACCTTAAGGG + Intergenic
986507837 5:8470992-8471014 ATGTCAGAGAGAGACCTTCATGG - Intergenic
986533335 5:8761426-8761448 AAGTCAGAGAGCCAAGTGAAAGG - Intergenic
987204286 5:15609270-15609292 ATGAATCAGAGCCACCTGAAGGG + Intronic
988080780 5:26411610-26411632 ATGTCATTGAGAGACCTGAAGGG + Intergenic
989619626 5:43371587-43371609 ATGTGAGTGAGCCATCTGAGAGG + Intergenic
992164500 5:74035928-74035950 ATGTCAAAGACCAACCAGAAAGG - Intergenic
992474278 5:77087173-77087195 ATGTCAGCGAGGCGCCTGGAGGG - Exonic
999390601 5:151186783-151186805 AAGCCAGTGAGCCACCTTAAGGG - Intronic
1000253571 5:159517484-159517506 ATGACAAAAAGTCACCTGAAGGG + Intergenic
1001357492 5:171043415-171043437 ATGCCAGAGAGACACCCCAAGGG - Intronic
1003335481 6:5167970-5167992 ATGTCAGAGGGACACAGGAACGG + Intronic
1003575727 6:7292721-7292743 AGGTCAAAGAGCCACTTTAAAGG - Intronic
1005087193 6:22019240-22019262 ATGGCAGAGAGATACCTGAGTGG - Intergenic
1005195640 6:23280699-23280721 ATGGGAGAGAGCCTCGTGAAAGG + Intergenic
1006355810 6:33557085-33557107 ATGTGAGAGAGACACATGGAGGG + Intergenic
1006739952 6:36301020-36301042 GTGTGAAAGAGCCAACTGAAAGG - Intronic
1010179189 6:73065461-73065483 ATGTCAGAGAGGAAGCTGGAAGG - Intronic
1010897826 6:81387281-81387303 ATGTGAGGGACCTACCTGAAAGG + Intergenic
1012081745 6:94766910-94766932 ATGTCAGAAAGCCACATTCAGGG + Intergenic
1014375870 6:120672101-120672123 ATGTCACATAGCCACCTGCCTGG - Intergenic
1014744310 6:125182095-125182117 ATGACCAAGAGCCACTTGAAAGG + Intronic
1016807613 6:148227843-148227865 ATGTCACAGAACCACCTTAATGG - Intergenic
1019381120 7:724219-724241 ATGTCACATAGCCAGGTGAAAGG - Intronic
1023001756 7:35815094-35815116 ATGAACAAGAGCCACCTGAAAGG - Intronic
1023411562 7:39893608-39893630 AGGTCCGCGAACCACCTGAATGG + Intergenic
1030002042 7:105075115-105075137 ATGTCAGACAGACAAGTGAAAGG - Intronic
1031269033 7:119621348-119621370 ATTTCAGAGGACCATCTGAAAGG + Intergenic
1034077859 7:148249920-148249942 ATGTCAGAGACGCTCCTGCAAGG - Intronic
1035641886 8:1190309-1190331 ATTTCACCGAGCCACGTGAAAGG - Intergenic
1039146523 8:34453062-34453084 ATTTCAGAGAGGCACTGGAATGG + Intergenic
1047781419 8:128114473-128114495 ATGTCATATGGCCTCCTGAAAGG + Intergenic
1049051535 8:140200729-140200751 ATGTCATCGAGCGTCCTGAATGG + Intronic
1049197743 8:141324819-141324841 GTGTCCTGGAGCCACCTGAATGG - Intergenic
1050743552 9:8850315-8850337 AGTACAGATAGCCACCTGAAAGG + Intronic
1056852956 9:90099552-90099574 ATGTGAGAGAGCCAGTTCAAAGG + Intergenic
1060477496 9:123997412-123997434 AGCTCAGAGAGCCACAAGAAAGG - Intergenic
1189526332 X:41826225-41826247 AAGTCACAGAGCCACCTGGTTGG - Intronic
1195275745 X:103278390-103278412 AAGTCTGTGGGCCACCTGAAAGG + Intergenic
1195311557 X:103636518-103636540 ATGTCTGAGGGCCACATGTATGG + Intergenic
1197471851 X:126873107-126873129 ATGTCATGGAGGGACCTGAAGGG - Intergenic
1199062860 X:143379512-143379534 TTAGAAGAGAGCCACCTGAATGG - Intergenic
1199148605 X:144401632-144401654 ATGACAAAGATCCACATGAAAGG + Intergenic
1199341080 X:146678090-146678112 TTGTGAAAGAGCCACTTGAAAGG + Intergenic