ID: 977465172

View in Genome Browser
Species Human (GRCh38)
Location 4:97374798-97374820
Sequence CATTCCAGGCAAACAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977465170_977465172 7 Left 977465170 4:97374768-97374790 CCAAAGTTAATGAGAAAGAAGGT 0: 1
1: 0
2: 2
3: 32
4: 346
Right 977465172 4:97374798-97374820 CATTCCAGGCAAACAATGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977465172 Original CRISPR CATTCCAGGCAAACAATGCA AGG Intronic
900233195 1:1572895-1572917 CATTTAAGCAAAACAATGCAAGG - Intronic
902069608 1:13723124-13723146 CAGTCCAGGCAAACATGCCAAGG - Intronic
906715267 1:47964120-47964142 CATTCCAGGGAAACTTTCCATGG - Intronic
907878688 1:58522155-58522177 CAATACAGGCAGAAAATGCAGGG + Intronic
908134898 1:61121472-61121494 AATTCCAGGGCAAAAATGCAAGG - Intronic
909751408 1:79165829-79165851 TTTTCCAGGCACACAGTGCAAGG - Intergenic
915315205 1:155024639-155024661 CATTCCAGGCAGACAAAACAGGG - Intronic
915679423 1:157566036-157566058 CATTCCATTCAAAGAATGAAAGG + Intergenic
916204020 1:162298084-162298106 TCTTCCAGCCAAACAATTCACGG + Intronic
919320613 1:196032247-196032269 TCTTCCAGGCAAAAAATGAATGG + Intergenic
921531304 1:216285644-216285666 TTTTCCAGGCACACGATGCAAGG - Intronic
922239148 1:223744181-223744203 GCTTCCAGGAAAACTATGCAGGG + Exonic
923392167 1:233523262-233523284 CATTCCAGGGAGACAAAGGAGGG + Intergenic
1063599180 10:7464466-7464488 CTTTTAAGGCAAACAATGCAAGG - Intergenic
1064793502 10:18986512-18986534 CTTTCCTGTCAATCAATGCATGG - Intergenic
1066432610 10:35366933-35366955 CATTCCAGGTAGACCATTCAAGG - Intronic
1067278868 10:44856483-44856505 CATTACAGGCAATCAGTGAAAGG - Intergenic
1068307771 10:55235939-55235961 CATTCCAGTCAGAAAATGGAAGG - Intronic
1068329782 10:55547859-55547881 AAGCCCAGGCTAACAATGCAGGG + Intronic
1069404621 10:68085728-68085750 CATTCTAGGCATTCAAAGCACGG - Intergenic
1070692660 10:78539138-78539160 CATTCCAGGTACAGAAAGCATGG - Intergenic
1071369346 10:84935354-84935376 CATTCCTGGAAAACAATGAGAGG + Intergenic
1071981787 10:91010672-91010694 CATTCCAGGCACTCCTTGCAGGG + Intergenic
1074912797 10:117926959-117926981 AATTACAGGAAAACAATACAGGG - Intergenic
1075332532 10:121584253-121584275 CACTACAGGCAAACATGGCAAGG + Intronic
1077887213 11:6395025-6395047 CTTTCCAGGCAAGCAGGGCAAGG + Intergenic
1078400410 11:11021291-11021313 CTTTCCAGGCAAACTCCGCAGGG + Intergenic
1078442259 11:11377849-11377871 CATTCCAGGGCAACATCGCATGG - Intronic
1080261921 11:30358788-30358810 GATTCCAGGCAAAGAAGGCAGGG - Intergenic
1080756577 11:35206123-35206145 CATACCAGCCATCCAATGCAAGG + Exonic
1082715079 11:56602461-56602483 AACTCCAGGTGAACAATGCAAGG - Intergenic
1085647968 11:78240241-78240263 CATTCCAGGGAAAGGATGCCTGG + Intronic
1087265176 11:96052848-96052870 CATTCTAGGCAAAGAAGCCAGGG - Intronic
1087277198 11:96172578-96172600 CATTTCAGGACAAAAATGCATGG - Intronic
1089611106 11:119669721-119669743 CACTCCTGGCACACACTGCACGG + Intronic
1092985149 12:13837983-13838005 AATTGCAGTCAAAGAATGCATGG - Intronic
1094662636 12:32485291-32485313 CATTCCTGGAAAAAAATGGAAGG + Intronic
1099265608 12:80442987-80443009 GATTCCAGGCAAACAATATAGGG - Intronic
1099648630 12:85395054-85395076 AATTCAAGGCAAAGGATGCAAGG + Intergenic
1101068827 12:101051381-101051403 CATTCCAGGCAAGACATGCCTGG + Intronic
1110208593 13:72946903-72946925 CTTTTCAGGCAGACAGTGCAAGG + Intronic
1110761138 13:79231436-79231458 CATTTGAGGAAAAAAATGCAGGG - Intergenic
1112841181 13:103580150-103580172 CTTTCCAGGAAAACAAAACAAGG + Intergenic
1114082921 14:19217401-19217423 AATTCCAAGTATACAATGCATGG + Intergenic
1116500007 14:45608969-45608991 CATTCAGTGCAAACAAAGCATGG - Intergenic
1117233693 14:53749239-53749261 CATTCCAGGAAAACTTAGCATGG + Intergenic
1117844539 14:59897094-59897116 CATTCCAGACAAAAAAAGTAAGG - Intergenic
1120075538 14:80153525-80153547 CCGTCCAGGTAAACAATGCAGGG - Intergenic
1122394811 14:101416935-101416957 GAATCCAGCAAAACAATGCAGGG + Intergenic
1123912300 15:24979960-24979982 CATACCAGCAAACCAATGCAAGG - Intergenic
1124707250 15:31976226-31976248 CATGCCAGGCACAAAATGCCAGG - Intergenic
1128148813 15:65348461-65348483 TATTTCTGGCAAACAATGGAAGG + Intronic
1128646064 15:69379783-69379805 CGTTCCAGGCACACAGAGCACGG + Intronic
1138320982 16:56111601-56111623 CATTCCAGGCCAATAGGGCAAGG - Intergenic
1139690852 16:68641166-68641188 CATTCCAGGCAGAGAAAACAGGG - Intronic
1139993011 16:70954898-70954920 CATTCCAGACCAAAAAAGCAGGG - Intronic
1140600517 16:76470218-76470240 CATGGCAGGCAAACATTTCAGGG - Intronic
1140976703 16:80066831-80066853 AATTCCAGCCACACAATCCAGGG + Intergenic
1141390011 16:83656605-83656627 CATTCAAGGGTAACAATGCCTGG - Intronic
1143097906 17:4488271-4488293 CAGTCCAGGCCAAGGATGCAGGG + Intergenic
1145827439 17:27887602-27887624 CATAACAGGCAAACACAGCATGG - Intronic
1147135314 17:38430686-38430708 CATCCCAGGCTAGCCATGCAGGG + Intronic
1151255548 17:72873698-72873720 TATTCCAAGGAAACAATCCAAGG - Intronic
1157750174 18:50171459-50171481 CATTCCAGGCAGATACAGCATGG + Intronic
1158584771 18:58722174-58722196 CATTCCAGGCTATCAAAGAAAGG + Intronic
1159513327 18:69425103-69425125 GATGCCAGGCAAAAAGTGCAAGG + Intronic
1160239206 18:77111106-77111128 CCTCCCAGGCAAACATTGCCAGG - Intronic
1165069072 19:33245157-33245179 CACCTCAGGCAAACACTGCAAGG + Intergenic
1166033589 19:40151261-40151283 AATTCCAGGCAATGAAAGCAAGG + Intergenic
1167864597 19:52314358-52314380 AATGTCAGTCAAACAATGCAGGG - Intronic
1168551773 19:57302279-57302301 CATTCCAGGGAAACAAAGCAGGG - Intergenic
926221633 2:10939858-10939880 CATTGCAGGCACCCAATGAAGGG - Intergenic
927595929 2:24397392-24397414 AATGCAAGGCACACAATGCATGG + Intergenic
927689066 2:25194668-25194690 CATCCCGGGAAAACAAGGCAAGG + Intergenic
928190186 2:29158147-29158169 TATTCCAGGCAAACAATTTCAGG - Intronic
928762843 2:34604914-34604936 CATCTCAGGAAAGCAATGCATGG + Intergenic
931025572 2:58110580-58110602 CATTCTTGGCAAACAAGGTAAGG - Intronic
931949790 2:67349885-67349907 TTTTCCAGGCACACAACGCAAGG + Intergenic
932317974 2:70798824-70798846 TTTTCCAGGCACACAGTGCAAGG + Intergenic
933429867 2:82162026-82162048 GATTCCAGGCAAAAAAAGAATGG + Intergenic
943905496 2:193495222-193495244 CATTCCAGTCAGACAATCCAGGG - Intergenic
944104950 2:196069546-196069568 AATGCCAGGCAAAGAATGCCGGG + Intergenic
946146409 2:217734490-217734512 CATCTCAGGCAAATAATGCATGG + Intronic
947585728 2:231355479-231355501 CATTTCAAGCAAACAACGTAAGG - Intronic
1169845792 20:9990070-9990092 CATTCTCAGCAAACTATGCAAGG + Intronic
1172288673 20:33759179-33759201 CACTCCAGACTAACCATGCAGGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173243151 20:41316089-41316111 CATGACAGGCAAACATTGCATGG - Intronic
1174282920 20:49452399-49452421 CATTCCTGGCAAACAAGGTGGGG + Intronic
1174885731 20:54331518-54331540 AATTCCACGAAAACAATGCTAGG - Intergenic
1178056973 21:28810617-28810639 CATTCCAGCCCTACAATGTAGGG + Intergenic
1179040718 21:37800162-37800184 CATTCCAGGGAAATAGGGCACGG - Intronic
1180497858 22:15905280-15905302 AATTCCAAGTATACAATGCATGG - Intergenic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1181809684 22:25395783-25395805 CATCCCAGGCAAGAAATGAAAGG + Intronic
1185126343 22:49012838-49012860 CCTTCCAGGCAGGCAATCCAGGG + Intergenic
952944524 3:38468916-38468938 CATTCCTGGAAAACACTGGAAGG - Intronic
955966380 3:64393285-64393307 CATTCCAGGGAAAGAATGAGAGG - Intronic
956994028 3:74802776-74802798 CAGTCCTGGCAAACAATTAATGG - Intergenic
958598977 3:96268696-96268718 GATTCCAGGAACACAATGAAAGG + Intergenic
959123308 3:102258879-102258901 CATTCCAAGGAAATAATGAAAGG + Intronic
959721769 3:109498831-109498853 CATTCCAAGAAAACATTACAAGG + Intergenic
961024920 3:123546514-123546536 CATTCCAGGCAGAAAGTGCAAGG - Intronic
961613103 3:128156273-128156295 CTTACCAGGCAAACCCTGCAAGG + Intronic
964156321 3:153588589-153588611 CATTCTCAGCAAACTATGCAAGG + Intergenic
964238097 3:154558012-154558034 ATTTCCAGGTAAACAATACATGG - Intergenic
968684943 4:1951719-1951741 CATGCCAGGCAGTCGATGCATGG + Intronic
970359894 4:15298447-15298469 CAATCCAGGGAAACAAGCCATGG + Intergenic
970845218 4:20529725-20529747 CAGTAAAGGCAAACCATGCATGG - Intronic
971069025 4:23069527-23069549 CCTGCCTGGAAAACAATGCAAGG - Intergenic
977465172 4:97374798-97374820 CATTCCAGGCAAACAATGCAAGG + Intronic
978161012 4:105548295-105548317 CAGTCCAGGCAAGAAATGCTTGG - Intergenic
978271369 4:106893937-106893959 CAGTCAAAGCAATCAATGCAGGG - Intergenic
978430035 4:108623958-108623980 CATTCCAGGCAAGGAAAGTACGG + Intronic
978605444 4:110474759-110474781 CTTGCCAAGCAAACAATGCTGGG - Intronic
978686731 4:111454325-111454347 CATTCCAGCCAAACCCTGAAGGG - Intergenic
979380647 4:120002531-120002553 CTTTCTAGGAAAACCATGCATGG + Intergenic
986486259 5:8241517-8241539 CATTCCATGCAACATATGCATGG + Intergenic
989009992 5:36859182-36859204 CATTTCAGGCAAAAAGAGCAAGG - Intergenic
989221328 5:38968869-38968891 CATTCCAGACATACAAGGTATGG + Intronic
990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG + Intergenic
992106690 5:73453850-73453872 CAGTCCAGGTTAACAATGTAAGG - Intergenic
994433794 5:99702710-99702732 CATACCAGGAAAAGCATGCACGG - Intergenic
994986574 5:106941121-106941143 CTTTCCAGGCAAAGAATGGTAGG - Intergenic
995470018 5:112491376-112491398 CATGCCAGGCCAATAATACAAGG - Intergenic
995486801 5:112647697-112647719 CATTCTAGGCAAACACCACAGGG - Intergenic
996319494 5:122198587-122198609 CATTCCAGGCAAACATTCTGGGG - Intergenic
997715527 5:136039873-136039895 CATCCCAGGCAAGCAGTCCATGG + Intronic
1000966408 5:167662321-167662343 CATGCCAGGCAAACGAGGAAGGG - Intronic
1002656679 5:180754005-180754027 CATTCCATGAAAACAGAGCAGGG + Intergenic
1003208517 6:4037204-4037226 TATTGCAGGCAAACAATGAAAGG - Intronic
1003344322 6:5252504-5252526 CATTCCAGGCAAAGACAGTAAGG - Intronic
1003751365 6:9061559-9061581 CATTGCAGGAAAAAATTGCAGGG - Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004336941 6:14772313-14772335 CATGCTATGCAAACTATGCAAGG + Intergenic
1005062859 6:21793412-21793434 CATTCCAGCCAAGCAAAGTAAGG + Intergenic
1007295696 6:40819052-40819074 CACACCAGGCAAACAAAGCAGGG + Intergenic
1008721303 6:54356995-54357017 GATTCCAGGCAAATCTTGCAAGG - Intronic
1011793371 6:90924889-90924911 CATTGCAAGCAAATAATGCATGG - Intergenic
1014016847 6:116541042-116541064 CATTCCAGGGAAACAAACTATGG + Intronic
1015871578 6:137781152-137781174 CATTCCAGGAAAACAACAAATGG + Intergenic
1016349528 6:143152587-143152609 CACTCCAAACAAACAAAGCAAGG - Intronic
1016913908 6:149226823-149226845 CATTCCAAACAGACAATGCTGGG + Intronic
1020765933 7:12321088-12321110 CAATCCAGGAAAATATTGCAAGG - Intergenic
1021448982 7:20763995-20764017 CATCACAGTAAAACAATGCATGG + Intronic
1021586664 7:22215907-22215929 AACTGCAGGCAAACAAAGCAAGG + Intronic
1024261821 7:47579239-47579261 CATTCCAGGCACAGCTTGCAGGG + Intronic
1028134518 7:87211403-87211425 CAGTCCAGGTAAACAATGGTAGG - Intronic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1031026738 7:116687188-116687210 AATTCAAGGAAAACAATTCAGGG - Intronic
1032876636 7:136045352-136045374 CATTCCAGGCAGAGAACACAAGG + Intergenic
1033149891 7:138904885-138904907 CATTCTTGGCAAAGAATGAATGG - Intronic
1035920093 8:3667464-3667486 CAGCCCTGGCAAACAATGCAGGG + Intronic
1036000369 8:4595863-4595885 CATTCCATGCAAAGAAGGAATGG - Intronic
1038517278 8:28197751-28197773 AATCCCAGGCAAAAAATTCAAGG - Intergenic
1038742148 8:30225346-30225368 CATTGATGGCAAACAATGCCAGG - Intergenic
1044432880 8:92129299-92129321 CTTGCCAGGCATACAATGCGGGG + Intergenic
1047023910 8:120806975-120806997 CATCTCAGGCAAACATTCCAGGG + Intronic
1048413714 8:134203022-134203044 AATACCAGGAAAACCATGCAAGG + Intergenic
1048698704 8:137059241-137059263 CATTCCATGCCATCTATGCATGG + Intergenic
1050979856 9:11996630-11996652 CATACCAGGGAAACAGTGCCTGG + Intergenic
1055842439 9:80520897-80520919 CATTCTATGCAAACAATGTGTGG - Intergenic
1058704675 9:107628459-107628481 CGTATCAGGCAAAGAATGCATGG + Intergenic
1058904259 9:109468804-109468826 CATACCAGGCACTCAATGAAAGG + Intronic
1059850342 9:118331047-118331069 CATTCCAGGCTAGAAATACAGGG - Intergenic
1060014911 9:120078751-120078773 CATTCCATGAAAACCATCCATGG + Intergenic
1060046424 9:120344984-120345006 CCTTCCTGGCTAACAAGGCAGGG - Intergenic
1186113501 X:6280065-6280087 CATTTCATGTCAACAATGCACGG - Intergenic
1186685808 X:11923120-11923142 CATGCCAGCAAAGCAATGCAGGG - Intergenic
1188260542 X:28017680-28017702 CATTACTGGCAGACTATGCATGG - Intergenic
1191823621 X:65339867-65339889 CATGCCAGAAAAGCAATGCAGGG - Intergenic
1193286564 X:79721805-79721827 CACTCCAGCCAAAGAAGGCAAGG - Intergenic
1195487632 X:105427190-105427212 TAATCCAGGCAAAGAAAGCATGG - Intronic
1195799226 X:108688348-108688370 AATTCCAGGAAAAGAATTCATGG - Intronic
1198077611 X:133209333-133209355 CATTCCACTAAAACAATGAATGG + Intergenic
1198169515 X:134091908-134091930 TATGCCAAGCAAACAATGCTGGG - Intergenic
1198432429 X:136580937-136580959 CATTCCAGGCAGAGAAGACAGGG - Intergenic
1199178164 X:144817237-144817259 CATTCTAGGGAATAAATGCAAGG + Intergenic