ID: 977466896

View in Genome Browser
Species Human (GRCh38)
Location 4:97393772-97393794
Sequence CACGTGAATCCAGGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142957
Summary {0: 2, 1: 457, 2: 9102, 3: 41244, 4: 92152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977466896_977466903 9 Left 977466896 4:97393772-97393794 CCTCCGCCTCCTGGATTCACGTG 0: 2
1: 457
2: 9102
3: 41244
4: 92152
Right 977466903 4:97393804-97393826 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
977466896_977466901 8 Left 977466896 4:97393772-97393794 CCTCCGCCTCCTGGATTCACGTG 0: 2
1: 457
2: 9102
3: 41244
4: 92152
Right 977466901 4:97393803-97393825 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
977466896_977466905 17 Left 977466896 4:97393772-97393794 CCTCCGCCTCCTGGATTCACGTG 0: 2
1: 457
2: 9102
3: 41244
4: 92152
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977466896 Original CRISPR CACGTGAATCCAGGAGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr