ID: 977466897

View in Genome Browser
Species Human (GRCh38)
Location 4:97393775-97393797
Sequence AATCACGTGAATCCAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186145
Summary {0: 3, 1: 992, 2: 17508, 3: 54335, 4: 113307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977466897_977466905 14 Left 977466897 4:97393775-97393797 CCGCCTCCTGGATTCACGTGATT 0: 3
1: 992
2: 17508
3: 54335
4: 113307
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
977466897_977466903 6 Left 977466897 4:97393775-97393797 CCGCCTCCTGGATTCACGTGATT 0: 3
1: 992
2: 17508
3: 54335
4: 113307
Right 977466903 4:97393804-97393826 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
977466897_977466901 5 Left 977466897 4:97393775-97393797 CCGCCTCCTGGATTCACGTGATT 0: 3
1: 992
2: 17508
3: 54335
4: 113307
Right 977466901 4:97393803-97393825 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977466897 Original CRISPR AATCACGTGAATCCAGGAGG CGG (reversed) Intronic
Too many off-targets to display for this crispr