ID: 977466898

View in Genome Browser
Species Human (GRCh38)
Location 4:97393778-97393800
Sequence GAGAATCACGTGAATCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287733
Summary {0: 4, 1: 1541, 2: 27797, 3: 85860, 4: 172531}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977466898_977466907 30 Left 977466898 4:97393778-97393800 CCTCCTGGATTCACGTGATTCTC 0: 4
1: 1541
2: 27797
3: 85860
4: 172531
Right 977466907 4:97393831-97393853 TAGGCTCCTGCCATCACACCTGG No data
977466898_977466903 3 Left 977466898 4:97393778-97393800 CCTCCTGGATTCACGTGATTCTC 0: 4
1: 1541
2: 27797
3: 85860
4: 172531
Right 977466903 4:97393804-97393826 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
977466898_977466901 2 Left 977466898 4:97393778-97393800 CCTCCTGGATTCACGTGATTCTC 0: 4
1: 1541
2: 27797
3: 85860
4: 172531
Right 977466901 4:97393803-97393825 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
977466898_977466905 11 Left 977466898 4:97393778-97393800 CCTCCTGGATTCACGTGATTCTC 0: 4
1: 1541
2: 27797
3: 85860
4: 172531
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977466898 Original CRISPR GAGAATCACGTGAATCCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr