ID: 977466899

View in Genome Browser
Species Human (GRCh38)
Location 4:97393781-97393803
Sequence CAGGAGAATCACGTGAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409416
Summary {0: 10, 1: 2391, 2: 44337, 3: 154560, 4: 208118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977466899_977466905 8 Left 977466899 4:97393781-97393803 CCTGGATTCACGTGATTCTCCTG 0: 10
1: 2391
2: 44337
3: 154560
4: 208118
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
977466899_977466901 -1 Left 977466899 4:97393781-97393803 CCTGGATTCACGTGATTCTCCTG 0: 10
1: 2391
2: 44337
3: 154560
4: 208118
Right 977466901 4:97393803-97393825 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
977466899_977466907 27 Left 977466899 4:97393781-97393803 CCTGGATTCACGTGATTCTCCTG 0: 10
1: 2391
2: 44337
3: 154560
4: 208118
Right 977466907 4:97393831-97393853 TAGGCTCCTGCCATCACACCTGG No data
977466899_977466903 0 Left 977466899 4:97393781-97393803 CCTGGATTCACGTGATTCTCCTG 0: 10
1: 2391
2: 44337
3: 154560
4: 208118
Right 977466903 4:97393804-97393826 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977466899 Original CRISPR CAGGAGAATCACGTGAATCC AGG (reversed) Intronic
Too many off-targets to display for this crispr