ID: 977466905

View in Genome Browser
Species Human (GRCh38)
Location 4:97393812-97393834
Sequence TCCTGAGTAGCTGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659312
Summary {0: 4909, 1: 66666, 2: 155807, 3: 234511, 4: 197419}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977466898_977466905 11 Left 977466898 4:97393778-97393800 CCTCCTGGATTCACGTGATTCTC 0: 4
1: 1541
2: 27797
3: 85860
4: 172531
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
977466897_977466905 14 Left 977466897 4:97393775-97393797 CCGCCTCCTGGATTCACGTGATT 0: 3
1: 992
2: 17508
3: 54335
4: 113307
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
977466899_977466905 8 Left 977466899 4:97393781-97393803 CCTGGATTCACGTGATTCTCCTG 0: 10
1: 2391
2: 44337
3: 154560
4: 208118
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
977466896_977466905 17 Left 977466896 4:97393772-97393794 CCTCCGCCTCCTGGATTCACGTG 0: 2
1: 457
2: 9102
3: 41244
4: 92152
Right 977466905 4:97393812-97393834 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977466905 Original CRISPR TCCTGAGTAGCTGGGATTAT AGG Intronic
Too many off-targets to display for this crispr