ID: 977470181

View in Genome Browser
Species Human (GRCh38)
Location 4:97433612-97433634
Sequence TACCATGGGCTGCAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977470181 Original CRISPR TACCATGGGCTGCAAGAGAG AGG Intronic
900553236 1:3267176-3267198 TGCCTAGGGCTGGAAGAGAGGGG - Intronic
903595244 1:24489136-24489158 TACCAGGGGCTGGGGGAGAGGGG + Intergenic
905352355 1:37356489-37356511 CTGCAAGGGCTGCAAGAGAGAGG + Intergenic
905383785 1:37584636-37584658 TACCAGGGGCTGGGGGAGAGGGG + Intronic
912162195 1:106998769-106998791 TTCCATGGACTGCAAGTGGGAGG + Intergenic
912426696 1:109599402-109599424 TACCAGGGGCTGAAAGAAGGTGG - Exonic
912963977 1:114221064-114221086 GACCATGGGCTGAAAGTGAGAGG - Intergenic
913174635 1:116262725-116262747 TTCCCTGGGCTGCAAGACAGAGG - Intergenic
913367181 1:118052383-118052405 TACCAGGGGCTGCAGGAAAGGGG + Intronic
915618020 1:157056500-157056522 TACCAGGGGCTACAAGAAAGGGG - Intergenic
915776364 1:158492057-158492079 TACCATGGGGTTCAAGACTGGGG - Intergenic
920034319 1:203056106-203056128 GTCACTGGGCTGCAAGAGAGAGG - Exonic
920820205 1:209373521-209373543 TTCCATGACCAGCAAGAGAGGGG + Intergenic
921544324 1:216455970-216455992 TACCAGGGGCTGTGTGAGAGAGG + Intergenic
923385071 1:233458062-233458084 TAGCATGGGGTGCAGGGGAGAGG - Intergenic
923427864 1:233890262-233890284 TTCCATGGGCTCCAAGAGGCTGG + Intergenic
923517623 1:234710518-234710540 AACAAGGGGCTGCAGGAGAGAGG + Intergenic
1063265797 10:4449060-4449082 TACCCTGGGCAACAAGAGTGAGG + Intergenic
1063407409 10:5809763-5809785 TACCATGGGAGGGAAGACAGAGG + Intronic
1068944553 10:62716491-62716513 TACCAGGGGCTGCAGGATAGAGG + Intergenic
1070353313 10:75614378-75614400 GACAATGGGCTGGAGGAGAGTGG - Intronic
1070516433 10:77212432-77212454 TACTATGGACTACTAGAGAGGGG + Intronic
1071939641 10:90574832-90574854 TAACCTGGGCTGGAAGAGATGGG + Intergenic
1072319282 10:94233068-94233090 CTGCATGGGCTGAAAGAGAGTGG + Intronic
1072715294 10:97748136-97748158 CACCATGTGCTTAAAGAGAGAGG - Intronic
1073073108 10:100807290-100807312 TACCATGGGCTGTGGGTGAGGGG - Intronic
1073316256 10:102582942-102582964 TACCTTGGGGAGCAAGAGAGAGG + Intronic
1074116567 10:110460954-110460976 TTCCAGGGGCTGCAAGAAGGTGG - Intergenic
1075481612 10:122787182-122787204 TACTATGGGCTGGATGAGAATGG + Intergenic
1075559112 10:123455777-123455799 GATCATGGGCAGCCAGAGAGTGG + Intergenic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1080284955 11:30600006-30600028 TACCAGGGGCTGCAAGTAGGAGG - Intergenic
1081453540 11:43197549-43197571 CACCATGGGCAGCGAAAGAGGGG + Intergenic
1088443605 11:109899940-109899962 TACCAGAGGCTGCAAGGTAGGGG + Intergenic
1092943475 12:13432061-13432083 TACCATGGGCTAGAAAAGAAAGG - Intergenic
1092967666 12:13660089-13660111 GAGCAAGGGATGCAAGAGAGAGG + Intronic
1101926137 12:108972849-108972871 TACCAAGGGCTGCAAGGTAGAGG + Intronic
1102080647 12:110095217-110095239 TACCAGGGGCTGCAGGAAGGGGG - Intergenic
1102906250 12:116677531-116677553 TACCAGGGGGTGGAAGAAAGGGG - Intergenic
1103685787 12:122730932-122730954 TCCCATGCGGTGCCAGAGAGGGG + Intergenic
1107168673 13:37314222-37314244 GACCCCGGGCTGAAAGAGAGAGG + Intergenic
1108210655 13:48136812-48136834 TACCAGGGGCTGAGAGAGGGAGG + Intergenic
1108248326 13:48539800-48539822 TGGCATGGGCTTAAAGAGAGAGG + Intergenic
1108487519 13:50941925-50941947 AACCATAGGCTGAAACAGAGAGG + Intronic
1110971814 13:81772619-81772641 TATCATGGGATGCAACAGAGAGG + Intergenic
1111675386 13:91380871-91380893 TACCAGGGGCTGAAAGATAGAGG - Intergenic
1113416672 13:110133681-110133703 TCCCAAGAGCAGCAAGAGAGAGG - Intergenic
1115123264 14:29962416-29962438 TGCCATGGGTTGAGAGAGAGGGG + Intronic
1117248751 14:53914313-53914335 CACCATGGGCTGTTAGAGAGTGG - Intergenic
1120269896 14:82298015-82298037 TGTTATGGGTTGCAAGAGAGTGG + Intergenic
1123630073 15:22255052-22255074 TACCAGAGGCTGCAAGAGACAGG - Intergenic
1124644673 15:31429417-31429439 TGCCAGGGGCTGGAAGAGGGGGG + Intronic
1128648338 15:69393148-69393170 TACCTTTGGGTGCAAGAGTGTGG - Intronic
1129034205 15:72639920-72639942 GGCCAAGGGCTGCTAGAGAGTGG + Intergenic
1129215677 15:74097296-74097318 GGCCAAGGGCTGCTAGAGAGTGG - Intergenic
1129732810 15:77941624-77941646 GGCCAAGGGCTGCTAGAGAGGGG - Intergenic
1129977250 15:79832628-79832650 TACCATGGTCTGGAAGACACAGG + Intergenic
1131581971 15:93652172-93652194 TGCCAGGGGCTGCAGGTGAGAGG - Intergenic
1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG + Intronic
1137750171 16:50855536-50855558 TGCCAGGGGCTGGGAGAGAGGGG - Intergenic
1138991232 16:62392926-62392948 TGCCATGGGAGGCAAGACAGAGG - Intergenic
1139347569 16:66314015-66314037 CACCAGGGGATGGAAGAGAGAGG - Intergenic
1140899267 16:79353000-79353022 TGTCAAGGGCTGCGAGAGAGGGG + Intergenic
1141973018 16:87495605-87495627 TACCAGAGGCTGCAAGAGACAGG + Intergenic
1143626216 17:8111528-8111550 TACTCTGGGATACAAGAGAGGGG + Exonic
1143800271 17:9373583-9373605 TACCAAGGGCTGAAAGAGGGAGG + Intronic
1143847036 17:9780076-9780098 TCCCAAGGTCTGCAAGAGGGAGG - Intronic
1145981200 17:29012783-29012805 GACAATGGCCTGCAAGAGAAAGG + Intronic
1146291991 17:31614508-31614530 TACCTTGGACTTCAAAAGAGGGG - Intergenic
1152274994 17:79350923-79350945 TACCAGGGGATGCCAGGGAGGGG - Intronic
1152610936 17:81314743-81314765 TAAGATGGGCTGAGAGAGAGTGG - Intronic
1154050673 18:10953822-10953844 AAGCAGGGGCAGCAAGAGAGAGG + Intronic
1157567852 18:48691829-48691851 TACCTGGGGCAGCAAGTGAGGGG - Intronic
1157831174 18:50858308-50858330 TGCCAGGGGCTGGAAGAGAGGGG - Intergenic
1159039718 18:63312315-63312337 TCCCATGGCTTGGAAGAGAGAGG + Intronic
1159400059 18:67919499-67919521 TATCATTGGCTGCAGGACAGTGG + Intergenic
1160828326 19:1090980-1091002 GACCAGGGACTGGAAGAGAGCGG + Exonic
1161866061 19:6832957-6832979 TTCCAGGGGCTGCGAGAGCGGGG - Intronic
1163513601 19:17749889-17749911 TACACTGGGGTCCAAGAGAGAGG + Intronic
1164912961 19:32027166-32027188 CACCTTGGGGAGCAAGAGAGTGG - Intergenic
1165506045 19:36230671-36230693 GGCCGTGGGCTGGAAGAGAGAGG + Intronic
1166221813 19:41370013-41370035 TACCAGGAGCTGCAGAAGAGGGG - Intronic
1166328601 19:42066056-42066078 TAGGACAGGCTGCAAGAGAGAGG + Intronic
933569868 2:83997329-83997351 TGCCAAGGGCTGCAAGAGATGGG - Intergenic
939956514 2:148531932-148531954 TACCATGGGATGTCAGAGGGTGG - Intergenic
940890785 2:159033453-159033475 GCCCATGGGCTGCGGGAGAGGGG + Intronic
941308767 2:163904148-163904170 TAGAATTGGCTGGAAGAGAGAGG + Intergenic
942063977 2:172252924-172252946 TACCAGGGGCTGGGGGAGAGGGG + Intergenic
942714165 2:178871927-178871949 TACCAGGGACTGGGAGAGAGAGG - Intronic
942816767 2:180061338-180061360 TACCATGGGCTCCCAGAGCTCGG + Intergenic
944206624 2:197164305-197164327 GACCTTGTGCTGCCAGAGAGGGG - Intronic
944491286 2:200260274-200260296 TACCAGGGGCAGAAAGGGAGAGG + Intergenic
944581867 2:201138592-201138614 TACCATGGGCAGCAAGCTGGTGG - Intronic
947769715 2:232661314-232661336 TGCCAGGGGCTGGGAGAGAGGGG - Intronic
1168800987 20:643047-643069 TTCCCTGGGCTGAAAGAGGGTGG - Intergenic
1170929134 20:20753015-20753037 TTCCATGGGCTGCAGGAAATGGG + Intergenic
1171093323 20:22306686-22306708 TACCCTGAGCTGGAACAGAGGGG + Intergenic
1172889380 20:38253148-38253170 GACCTTGGGCTGCAGGGGAGGGG - Intronic
1176043115 20:63076527-63076549 GAGCATGGGGAGCAAGAGAGGGG + Intergenic
1177887483 21:26763543-26763565 TCCCATGGCCTGGAAGAGAGAGG + Intergenic
1180187586 21:46147119-46147141 CATCAGGGGCTGCCAGAGAGGGG - Intronic
1183068515 22:35380328-35380350 TACCAGGTGCTGCCAGAGTGTGG + Intergenic
1183253466 22:36745914-36745936 TCCCAGAGGCTGCAAGAGAAGGG + Intergenic
1183646458 22:39129905-39129927 CATCATGGGCTGCAGGACAGAGG - Intronic
1184401852 22:44279085-44279107 TACCATGGGCGGCAGGCGGGTGG - Intronic
1184902238 22:47453693-47453715 TACCATGGGGATCAATAGAGAGG + Intergenic
1185144443 22:49123355-49123377 TACCATGGGCAGCCAGATGGAGG - Intergenic
949500854 3:4678802-4678824 TACCATGGGATGCAGGTCAGTGG + Intronic
950521429 3:13500188-13500210 TCCCAGGGGCTGCAGGGGAGGGG + Intronic
951057110 3:18160280-18160302 TACCAAGGGCAGCAAAACAGGGG + Intronic
953907957 3:46877829-46877851 GCCCATGGGCTGCAGGTGAGTGG + Intronic
954831026 3:53421485-53421507 TACCATAGGGTGCAGGAGGGAGG + Intergenic
957483342 3:80827222-80827244 TACCATGGAATACAAGATAGAGG - Intergenic
959444537 3:106422307-106422329 TGCCAGGGGCTGCGAGAGGGGGG + Intergenic
960359897 3:116698419-116698441 TGGAATGGGATGCAAGAGAGAGG + Intronic
961685837 3:128630135-128630157 AAGGATGGTCTGCAAGAGAGTGG + Exonic
963087492 3:141451898-141451920 TACCAGGGGTTGAAAAAGAGAGG + Intergenic
964773117 3:160245340-160245362 TAGCATGGGCTCCCAGAGATCGG - Intronic
965300406 3:166999824-166999846 TACCAAGGCCTGGAAGATAGTGG + Intergenic
967223721 3:187271703-187271725 TACCATGGGGTGGAAGCTAGAGG - Intronic
968863225 4:3189606-3189628 TGCCAGGGGCTGCAGGGGAGGGG + Intronic
971800069 4:31277863-31277885 TACCATGGCCTGTCAGAGGGTGG + Intergenic
972065010 4:34931147-34931169 TACCAGGGGCTGGTAGATAGAGG + Intergenic
975739349 4:77413895-77413917 AACCCAGGGCTGCAAGAGTGAGG + Intronic
976918120 4:90404148-90404170 GACCGTGGGCTGCATGGGAGTGG + Intronic
977470181 4:97433612-97433634 TACCATGGGCTGCAAGAGAGAGG + Intronic
978870342 4:113568234-113568256 TACCAGGTGCTGGAGGAGAGGGG - Intronic
983159369 4:164392544-164392566 TCCAATGGGGTGCAAGTGAGAGG - Intergenic
984213586 4:176880298-176880320 AACCAGGAGCTGCAAGGGAGGGG - Intergenic
984856784 4:184202373-184202395 TATGATGGGCTGTAAGTGAGGGG - Intronic
986667350 5:10115087-10115109 TTCCATGGGCTGGAGGACAGAGG + Intergenic
986771062 5:10974106-10974128 TGCCATGGGCTGAGAGAGAGGGG - Intronic
986807493 5:11322190-11322212 TAGCATGGGCAGGAAGAGAGAGG - Intronic
987936870 5:24478368-24478390 TACCAAGGGTTGCAAGAGAAAGG + Intergenic
989212778 5:38873099-38873121 TGCCAGGGGCTGAGAGAGAGGGG - Intronic
990346257 5:54874668-54874690 TACTAGGGGCTGCAAAAGATAGG - Intergenic
992578376 5:78144619-78144641 TACAATGGGGTGCCAGAGAAAGG + Intronic
994022445 5:95043416-95043438 TCACATGGGCTTCAAGAAAGAGG - Intronic
995383038 5:111556403-111556425 TACCAGAGGCTGAAAGCGAGGGG - Intergenic
997661855 5:135595198-135595220 TGACAGGGGCTGCATGAGAGTGG - Intergenic
997794461 5:136794879-136794901 GCCCATGGGCTGAAAGAGAGTGG + Intergenic
998550886 5:143077208-143077230 TACCATGAACTGTAAAAGAGTGG + Intronic
999270075 5:150291710-150291732 TAACATGTCCTGCAAGTGAGAGG - Intergenic
999539397 5:152555274-152555296 TACCAAGGACTACTAGAGAGGGG + Intergenic
999747278 5:154601970-154601992 TACCAGGGGCTGTGAGAGGGAGG - Intergenic
1001119117 5:168964377-168964399 TACCATGGGAGATAAGAGAGAGG + Intronic
1003090878 6:3101951-3101973 TACCAGGGGCTGGGAGAGGGAGG - Intronic
1004158806 6:13195157-13195179 TCCCCTTGGCTGCAAGAAAGAGG - Intronic
1005978570 6:30818458-30818480 TACCCTGGGAGGCTAGAGAGAGG - Intergenic
1006869444 6:37237408-37237430 TACAGTGGGCTACCAGAGAGAGG - Intronic
1007105416 6:39280259-39280281 CATCAGGGGCTGCCAGAGAGCGG + Intergenic
1008537741 6:52519978-52520000 TACCAAGGGCTGGGAGTGAGAGG + Intronic
1010518494 6:76803392-76803414 GACTATGGGCTGCATGGGAGTGG - Intergenic
1014684947 6:124485444-124485466 TACCATGAGCTGCTAAAGAGAGG + Intronic
1015718468 6:136216061-136216083 CAGCATGAGCTGCAGGAGAGAGG + Intergenic
1016453945 6:144212118-144212140 TACAATGGGGTGTGAGAGAGTGG + Intergenic
1016764564 6:147777682-147777704 TACCAAGGGCTGGAAGAAGGAGG - Intergenic
1017732710 6:157331877-157331899 TACCATGAGCTGCAAGAGAGAGG - Intergenic
1018724067 6:166597156-166597178 CGCCATGGGAGGCAAGAGAGGGG + Intronic
1019165196 6:170093979-170094001 TGCAATGGGCTGCAGGGGAGTGG + Intergenic
1021545760 7:21811552-21811574 TACCAGGGGCTGGCAGAGGGAGG + Intronic
1022644593 7:32218472-32218494 TACCCTGGGCTGCACGAGCCAGG - Intronic
1022838831 7:34143299-34143321 TACCCGGGCCTGCCAGAGAGAGG + Exonic
1023653049 7:42390609-42390631 CAGCATGGGCCGGAAGAGAGAGG - Intergenic
1025014873 7:55431126-55431148 TACCAGGGGCTGCAAGCATGTGG - Intronic
1025921179 7:65914577-65914599 TACCATGGAGTCCAAGAGAGTGG + Intronic
1026378807 7:69778579-69778601 TACCATGGGCTGCAGCAGTGTGG + Intronic
1029539945 7:101176769-101176791 TATCATTGGCTGAAAGAGAGAGG - Intronic
1029884791 7:103857096-103857118 TAACATATGTTGCAAGAGAGGGG - Intronic
1030774004 7:113511354-113511376 TACCAGGGGCAGGAAGCGAGTGG - Intergenic
1031390065 7:121203030-121203052 TATCATGGGCTGCGAGTCAGTGG - Intronic
1032022469 7:128416581-128416603 TAACATGGGCTACAAGATTGAGG + Intergenic
1032026942 7:128450638-128450660 TGCCAAGGGCTGGAGGAGAGGGG - Intergenic
1032264765 7:130363159-130363181 TTCCCTGGGCAGCAAGAAAGAGG - Intronic
1034718154 7:153262728-153262750 AACCAAGGGCAGCAAGAGTGAGG - Intergenic
1035559531 8:594168-594190 CACCATGGCCTCCAAGAGAGCGG + Intergenic
1036191512 8:6674854-6674876 TTCCCTGGGGTGCCAGAGAGTGG - Intergenic
1037048567 8:14340945-14340967 TACCAGGGGCTGGGGGAGAGGGG - Intronic
1037171261 8:15895119-15895141 TAACCTGGGCTGAGAGAGAGAGG - Intergenic
1044742890 8:95345485-95345507 TGCCTTGGGCTCCCAGAGAGAGG - Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1047566836 8:126053716-126053738 TGCCAGGGGCTGCAGGGGAGGGG + Intergenic
1047711774 8:127559639-127559661 TTCCATGTGGTGAAAGAGAGAGG + Intergenic
1048024904 8:130577458-130577480 TACCATAGGCAGCCAGAGACGGG + Intergenic
1052496880 9:29238402-29238424 TACCAGGGGCAGGAAGAGGGAGG - Intergenic
1053437094 9:38083086-38083108 TCTCTTGGGCTGGAAGAGAGAGG + Intergenic
1056028316 9:82524431-82524453 GACAATGGGCTGAAAGAGAAGGG + Intergenic
1056883886 9:90421242-90421264 TACCATGCTCTGTAAGAGACAGG + Intergenic
1056902836 9:90616429-90616451 TAGCAAGTGCTGCAAAAGAGAGG + Intronic
1057031321 9:91777707-91777729 TACCAGGGGCTGAAGGAGACAGG - Intronic
1187257724 X:17657005-17657027 TAGGATGAGCTGGAAGAGAGGGG + Intronic
1187503994 X:19864063-19864085 TACCAGGGGCTGCTAGAGCCTGG - Intronic
1189077580 X:37933351-37933373 TACCATGGGGCTGAAGAGAGGGG - Intronic
1194934865 X:99937022-99937044 TACACAGGGCTGCAAGAGGGAGG + Intergenic
1194989013 X:100524919-100524941 TACCAGGGGCTGGAAGGGTGAGG - Intergenic
1195643295 X:107201359-107201381 TACCAGGGGCTGGAGGAGGGAGG - Intronic
1199010354 X:142750884-142750906 TACCAAGGACCGCAGGAGAGGGG - Intergenic
1199210265 X:145200202-145200224 TACCAAGGACTGGAGGAGAGGGG + Intergenic
1199449722 X:147965932-147965954 TAATGTGGGCTCCAAGAGAGAGG + Intergenic
1201215820 Y:11721845-11721867 TGCCATGGAATGCAACAGAGTGG + Intergenic
1201585090 Y:15551729-15551751 CACCATGGGCTTCAAGAGACCGG + Intergenic