ID: 977470747

View in Genome Browser
Species Human (GRCh38)
Location 4:97438475-97438497
Sequence CAGCTCCCTCAGCTTGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 3, 2: 4, 3: 27, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977470747_977470753 5 Left 977470747 4:97438475-97438497 CCTGCCGCAAGCTGAGGGAGCTG 0: 1
1: 3
2: 4
3: 27
4: 212
Right 977470753 4:97438503-97438525 AGACTTGGCCAGCCCAGAAAGGG 0: 5
1: 254
2: 810
3: 493
4: 518
977470747_977470758 23 Left 977470747 4:97438475-97438497 CCTGCCGCAAGCTGAGGGAGCTG 0: 1
1: 3
2: 4
3: 27
4: 212
Right 977470758 4:97438521-97438543 AAGGGGTTCCCACAGTGCAGCGG 0: 14
1: 952
2: 540
3: 275
4: 318
977470747_977470752 4 Left 977470747 4:97438475-97438497 CCTGCCGCAAGCTGAGGGAGCTG 0: 1
1: 3
2: 4
3: 27
4: 212
Right 977470752 4:97438502-97438524 CAGACTTGGCCAGCCCAGAAAGG 0: 5
1: 233
2: 536
3: 639
4: 565
977470747_977470750 -10 Left 977470747 4:97438475-97438497 CCTGCCGCAAGCTGAGGGAGCTG 0: 1
1: 3
2: 4
3: 27
4: 212
Right 977470750 4:97438488-97438510 GAGGGAGCTGGCTCCAGACTTGG 0: 1
1: 34
2: 223
3: 798
4: 1000
977470747_977470754 6 Left 977470747 4:97438475-97438497 CCTGCCGCAAGCTGAGGGAGCTG 0: 1
1: 3
2: 4
3: 27
4: 212
Right 977470754 4:97438504-97438526 GACTTGGCCAGCCCAGAAAGGGG 0: 5
1: 927
2: 490
3: 329
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977470747 Original CRISPR CAGCTCCCTCAGCTTGCGGC AGG (reversed) Intronic
900393945 1:2445490-2445512 CAGATCCCTGAGCATGAGGCTGG + Intronic
900507931 1:3038960-3038982 CAGATCCCGCAGCCTGGGGCTGG + Intergenic
901112468 1:6809498-6809520 CAGCCCCCTGGGCTTGGGGCAGG + Intronic
902702744 1:18183782-18183804 CAGCTCCCTCGGGTGGCGGGTGG + Intronic
902708663 1:18223868-18223890 CCACTCCCTCAGCTTCCTGCGGG + Intronic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
903695738 1:25205397-25205419 CAGCTGCCTCAGCTTGGATCGGG - Intergenic
904447802 1:30588785-30588807 CAGCTGCCTCAGGTTAGGGCAGG + Intergenic
905244708 1:36604550-36604572 CAGCACCCTCAGCCTGCCCCAGG - Intergenic
905282073 1:36855722-36855744 CAGCTCCCTTAGATTAGGGCTGG + Intronic
907824030 1:57998271-57998293 CAGCTCCCTCAGCTGTAAGCTGG + Intronic
912511582 1:110193621-110193643 CAGCTCCCTCAGCATTAGGATGG - Intronic
914250972 1:145920996-145921018 CACCTCCTTCAGATTGGGGCAGG + Intergenic
915519013 1:156430572-156430594 CACCTCCCTCAACTGGGGGCGGG + Intronic
915527851 1:156487184-156487206 CAGCTCCCCCAGCATGAGGCGGG - Intronic
920959919 1:210655106-210655128 CAGCTGCCGCAGCTTCTGGCTGG - Intronic
922925473 1:229343324-229343346 CAGCCCCCCCAGGCTGCGGCCGG + Intergenic
923242249 1:232097317-232097339 CAGCTCCCTTGCCTTGAGGCAGG - Intergenic
1063563471 10:7150564-7150586 CACCTCCCTCAGCACGCTGCAGG + Intergenic
1065554860 10:26905515-26905537 TGGCTCCCTCTGCTTGCGGGAGG + Intergenic
1065844646 10:29735275-29735297 CAGCTCCGGCCACTTGCGGCTGG + Intronic
1067071681 10:43137532-43137554 CACGGCCCTCAGCTAGCGGCGGG - Intergenic
1067162621 10:43840211-43840233 CAGCTCAATCAGGTTGGGGCTGG - Intergenic
1069949097 10:72007313-72007335 CCGCAACCTCAGCTTGCAGCTGG + Exonic
1070436037 10:76394591-76394613 CAGCTCACTCAGCTTTCTGGAGG + Intronic
1070839745 10:79475853-79475875 GAGCTCCCTCAGGTTGAGGTTGG - Intergenic
1070963280 10:80514223-80514245 CTGCTTCCTGAGCTGGCGGCAGG + Intronic
1071135554 10:82449456-82449478 CATTTGCCTTAGCTTGCGGCTGG + Intronic
1072209381 10:93232573-93232595 CAGCTCGGTCAGTTTGAGGCAGG + Intergenic
1072408966 10:95183496-95183518 CCGCTCCCTCAGCAGCCGGCGGG - Intergenic
1074275088 10:111993411-111993433 CTGCTCCCTCAGCCTGAGTCTGG + Intergenic
1075207111 10:120457295-120457317 CAGCTCCCGCATGGTGCGGCCGG - Exonic
1076178574 10:128387657-128387679 CAGCTCCCTCAACATGGGTCGGG - Intergenic
1076994113 11:289993-290015 CAGCCCCCTCAACGTCCGGCTGG + Exonic
1077490729 11:2859745-2859767 CAGCTGCCACAGCATGCGCCGGG - Intergenic
1078141919 11:8699225-8699247 CAGCTCCTTCAGTTTGGGGAGGG + Exonic
1078348550 11:10573476-10573498 CAGCTCCCACTGCTTCAGGCTGG + Exonic
1078988168 11:16614407-16614429 CAGCTCTCGCAGCAGGCGGCCGG - Intronic
1079186221 11:18239793-18239815 GAGCTCCCTCAGCATGTGGATGG - Intronic
1080106068 11:28512723-28512745 TGGCTCCCTCAGCTTGCAGGGGG - Intergenic
1083545275 11:63544912-63544934 CATCTCCCTCTGCTTGGGGCTGG + Intronic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084964913 11:72739441-72739463 GAGCTGCCTCAGCTTGCTGGTGG + Intronic
1085196191 11:74673213-74673235 CAGCTTCCCCAGCTTACTGCGGG - Intergenic
1085270142 11:75265327-75265349 CAGCTCACTCTGCTGGGGGCTGG + Exonic
1088527905 11:110776375-110776397 CAGCTCCCTCAGCCTCCAGTAGG - Intergenic
1089225858 11:116921015-116921037 CAGCTCACTCAGCATGGAGCCGG - Intronic
1090136917 11:124208990-124209012 CAGCTTCCTCAGCTGGCACCGGG + Intergenic
1090335060 11:125956522-125956544 CAGCTCCCCCAGCCTGGGGGCGG - Exonic
1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG + Intronic
1093751335 12:22803866-22803888 CATCTCACTCAGCCTGCTGCTGG + Intergenic
1094108742 12:26839147-26839169 CAGCTCCCTCTGCTTGCTGTGGG + Intergenic
1094175929 12:27541421-27541443 CAGCTCGCTCAGCAAGCCGCTGG - Intronic
1095350294 12:41202281-41202303 CAGCTCACTGAGCTTGATGCTGG + Intronic
1095976771 12:47945594-47945616 CAGTTCCCTCAGGGTGGGGCAGG + Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1101377987 12:104187580-104187602 CATTTCGCTCAGCCTGCGGCTGG + Intergenic
1101442617 12:104714932-104714954 CAGCTACCCCAGCTTGCTTCGGG - Intronic
1101695612 12:107122825-107122847 CACCTCCAGCAGCTTGCAGCCGG - Intergenic
1103064018 12:117882164-117882186 CAGCTCCCTCAGCACACTGCAGG + Intronic
1104734972 12:131131085-131131107 CAGCTCCCTCAGTAGGAGGCTGG - Intronic
1105441849 13:20421686-20421708 CAGCTCCCTCAGTTTGAAGTTGG - Intronic
1106567580 13:30899717-30899739 CAGCTCCCTGAGGGTGCAGCTGG - Intergenic
1106770561 13:32957480-32957502 CAGGTGGCTCAGCTTGCAGCTGG + Intergenic
1106848353 13:33761830-33761852 CAGCTGCCTGAGCCTGGGGCAGG + Intergenic
1107946082 13:45418565-45418587 CAGCTCCCTCAGGCAGCGGCAGG - Intergenic
1109132392 13:58603681-58603703 CAGCTCCCTCAGCCTTTTGCAGG - Intergenic
1110913977 13:80998819-80998841 CGGCTCCCTCAGCTTGCGGGAGG - Intergenic
1111232557 13:85363119-85363141 CGGCTCCCTCTGCTGGCGGGGGG + Intergenic
1113321131 13:109233412-109233434 CAGCTCCACCAGCTTCTGGCAGG - Intergenic
1113534258 13:111051812-111051834 CAGCCCCCTCAGCCCGCCGCAGG + Intergenic
1115753596 14:36513778-36513800 CAGCTCTCTCAGCTAGCGAGGGG - Exonic
1116096248 14:40373027-40373049 CAGCTTGCTCAGCCTGGGGCTGG + Intergenic
1116223234 14:42113856-42113878 CGGCTCCCTCGGCTTGCTGGGGG - Intergenic
1116452989 14:45084731-45084753 CAGCACCCACAGCTTTTGGCAGG + Intronic
1116774872 14:49167634-49167656 CAGCTCCCTCACCTTTCAGGTGG + Intergenic
1117827765 14:59721245-59721267 CAGCTACAGCAGCTTGAGGCTGG - Intronic
1119131183 14:72174451-72174473 GAGCTCCCCTACCTTGCGGCTGG - Intronic
1119880975 14:78099403-78099425 ATGCTCCCTCAGCTTGCAGAAGG - Intergenic
1121713474 14:96056203-96056225 CAGCTCACTCAGCATGCTGGTGG + Intronic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1122808764 14:104277271-104277293 CAGATCCCTCAGCACGTGGCTGG - Intergenic
1127372985 15:58357588-58357610 CAGCTCCCAAAACTTGCGTCAGG + Intronic
1128813355 15:70587557-70587579 CGGCTCCCTCAGCTTGCGCGAGG - Intergenic
1129256485 15:74336910-74336932 CAGATCCCACAGCTTCGGGCAGG + Intergenic
1131654849 15:94445212-94445234 CAGCACCCTCAACTTGGGACAGG - Intronic
1135557999 16:23453156-23453178 CAGCGCACTCAGTTTGCGGCTGG + Exonic
1135860232 16:26049694-26049716 CAGATTCCACAGCTTGAGGCTGG + Intronic
1137270738 16:46900850-46900872 CAGGACCCTCCGCTTGAGGCTGG - Intronic
1137616378 16:49850227-49850249 CAGCTCCCTCAGCCTACTGTGGG - Intronic
1137947915 16:52751868-52751890 CAGCTCCCTCTGCTTCTGACAGG + Intergenic
1138556655 16:57774947-57774969 CTGCTGCCTCAGCATGGGGCTGG + Intronic
1139326061 16:66153360-66153382 CAGCTTCCTCAGCCTGCCACAGG - Intergenic
1140197490 16:72867159-72867181 CAGCTTCCTCAGCTTCCTGTGGG - Intronic
1141842654 16:86584060-86584082 CTGCCCCCTCAGCCTGCAGCAGG + Intergenic
1142117886 16:88369579-88369601 CAGCTCCCTCAACTTCAGGCAGG + Intergenic
1142605292 17:1078045-1078067 CAGCTCCCGCAGCTGGCTGGGGG - Intronic
1143025757 17:3941246-3941268 CAGCCACCTCAGGTCGCGGCGGG + Exonic
1143053534 17:4145474-4145496 CAGCTCCCACAGCACGCAGCAGG - Intronic
1143089116 17:4438275-4438297 CAGCTCCCCCAGCTTCAGACGGG + Intronic
1143188048 17:5022405-5022427 CAGCTCCCGCATCTTGAGGGCGG - Exonic
1143730828 17:8881789-8881811 CAGCTCCTCCTGCTTCCGGCAGG + Exonic
1144215055 17:13048092-13048114 CAGCTCCATCAGCCTGCTGGAGG + Intergenic
1144677029 17:17168294-17168316 CAGCTGCCTCAGATTTGGGCTGG - Intronic
1145745973 17:27319964-27319986 CAGCTCCCTCAGACTGTGTCTGG + Intergenic
1148114870 17:45169682-45169704 CAGCTCCTCCACCTGGCGGCAGG - Exonic
1148743725 17:49907237-49907259 CTGCTCCCTCAGCTTCTGGAAGG - Intergenic
1148994556 17:51698238-51698260 CTGCTCCCTCACCTTCCGTCTGG + Intronic
1149997456 17:61412453-61412475 CAGCTCCCGCAGCTCCCCGCCGG + Exonic
1149998658 17:61418026-61418048 CAGCTCCCTCTGGGCGCGGCAGG - Intergenic
1150239901 17:63622812-63622834 CTCCTCCCTCAGCCTGGGGCGGG - Intronic
1150500978 17:65650495-65650517 CAGCTGCCTCTGCTTGCTGCTGG + Intronic
1151384712 17:73748000-73748022 CAGCTCCCCCAGTTTCTGGCTGG + Intergenic
1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1151909280 17:77071174-77071196 TAGCACCCTCAGCTTTCGGGAGG - Intergenic
1152795042 17:82302547-82302569 CAACTCCCTCTCCTTGTGGCGGG - Intergenic
1152803175 17:82341354-82341376 CAGCTTCCTCAGCCTGTAGCTGG + Intergenic
1157301580 18:46483534-46483556 CCACTCCCTCAGCATGGGGCAGG - Intronic
1158794239 18:60823150-60823172 CAATTCCCTGAGCTTGCGGTTGG + Intergenic
1159829054 18:73250388-73250410 CAGGTCCCTCACCTGGCCGCTGG - Intronic
1160719975 19:592767-592789 AAGCTCCCTAAGCAGGCGGCCGG + Intronic
1161349553 19:3784383-3784405 CAGCTCCCCTGGCTTGGGGCGGG + Exonic
1162364311 19:10238621-10238643 CAGCTCCCTCAGCTAGAGAAAGG + Intergenic
1162540292 19:11291588-11291610 CAGCTACCTTAGCTTCTGGCTGG - Intergenic
1164520230 19:28973353-28973375 CTGCTCCCTCAGCTCCCGGGGGG - Intergenic
1165409167 19:35648299-35648321 CACCTCTCTCAGCTTCCGGCTGG + Exonic
1166254377 19:41592043-41592065 CAGCTCCCAAAGCTGGGGGCAGG + Intronic
1166700367 19:44878584-44878606 CGGCTCCCTCATCTCACGGCGGG + Intronic
1167748703 19:51367588-51367610 CAGCTAGCTCATCTTGCGGCTGG - Intronic
1168150642 19:54446107-54446129 CAGATTCCTCATCTTGCAGCTGG - Intergenic
925172652 2:1759702-1759724 CGGCTCCCTCTGCTTGTGGGGGG - Intergenic
925385341 2:3458133-3458155 CAGGTCCCTCAGCCTGCCCCAGG - Intronic
925906896 2:8545077-8545099 CAGCCCCCTCTGCTGGCGCCCGG + Intergenic
926751291 2:16200607-16200629 CAGCTCACTCATCTTCTGGCAGG + Intergenic
927948547 2:27152215-27152237 CAGCTCCCTCAGCTCCCAGGTGG + Intronic
929592764 2:43157851-43157873 CAGCCCCCTCAGGTTGTGGGGGG - Intergenic
930338807 2:50084598-50084620 CGGTTCCCTCAGCCTGCGGGGGG - Intronic
933313186 2:80685939-80685961 CAGCTTCTTCAGCTTCCGGTTGG - Intergenic
934678202 2:96265126-96265148 CAGCACCCTCACCTTTCAGCAGG + Exonic
934819054 2:97356200-97356222 CAGCTCCCTCACCTTTCAGGTGG + Intergenic
935251721 2:101268034-101268056 CCACTCCCTCAGCTTCCAGCTGG - Intronic
938107554 2:128543721-128543743 CAGCTCCCTTACCTTAGGGCAGG - Intergenic
944264056 2:197705375-197705397 CCGCCTCCTCCGCTTGCGGCCGG + Exonic
945298298 2:208192622-208192644 CAGCAGCCTCAGCTGGGGGCAGG - Intergenic
946865572 2:224038988-224039010 CTGCTCCCTGACCTTGCGCCCGG - Intronic
948140899 2:235670978-235671000 CGGCTACTTCAGCCTGCGGCGGG + Intronic
948892606 2:240914741-240914763 CAGCTGCCTGAGCTGGGGGCGGG - Intergenic
1172805730 20:37610386-37610408 CAGCTGCCTCAGCTTCTTGCCGG - Intergenic
1174352431 20:49978296-49978318 CAGCTCCCTTAGTTTTCTGCAGG - Intergenic
1175387482 20:58606450-58606472 GAGCTCCCACAGCCTGTGGCAGG - Intergenic
1176013987 20:62919050-62919072 AAGCTCCACCAGCTTGCGGCAGG + Intronic
1176253778 20:64139939-64139961 CAGCTCCCTTAGTCTGGGGCAGG - Intergenic
1176904481 21:14483254-14483276 CAGCTCCCTCAACGTGGGGCAGG - Intergenic
1177192709 21:17869589-17869611 CTGGTCCCCCAGCTTGCGGATGG - Intergenic
1178441835 21:32604689-32604711 CAGCCCCCTCAGCATGGGGCAGG + Intronic
1179249935 21:39664206-39664228 CAGCTCCGTCAGCAGGTGGCTGG - Exonic
1179801753 21:43814544-43814566 CAGCTCCCTCGGCCTGGGTCAGG + Intergenic
1181029590 22:20143376-20143398 CAGCTCCTACAGCCTGCAGCAGG + Exonic
1181513664 22:23399942-23399964 CAGCTCCTACAGCCTGCAGCAGG - Intergenic
1181879490 22:25966653-25966675 CAGCTCTCTGAGCATGCGGGAGG - Intronic
1182620130 22:31614336-31614358 CAGCTTCATCAGCATGGGGCAGG - Intronic
1184521987 22:45000081-45000103 CGGCTCCTTCCGCTTGGGGCAGG - Intronic
1184724485 22:46335650-46335672 AAGCTGCCGCAGCTTCCGGCCGG + Exonic
952887972 3:38023109-38023131 CACCTCCCTCAGCTTCCCACTGG - Intronic
953606569 3:44416662-44416684 CAGCACCCTCAGCTTGGAACTGG - Intergenic
956195695 3:66651540-66651562 CGGCTCCCTCAGCTTGTGGGGGG + Intergenic
957287787 3:78239261-78239283 CATTTCACTCAGCTTGCCGCTGG - Intergenic
960294942 3:115931372-115931394 CAGGTCACTCAGCTGGGGGCAGG - Intronic
960560086 3:119073791-119073813 CAGCTCCCTCTGCTTGTGGGAGG - Intronic
964395455 3:156240986-156241008 CAGCTCCCTCACCTTTCAGGTGG - Intronic
964993544 3:162844990-162845012 CAGCTCCCTCTGCTTGCAGGGGG - Intergenic
965256743 3:166423946-166423968 CGGCTCTCTCAGCTTGCAGCGGG + Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
967315681 3:188150253-188150275 GAGCTTACTCAGCTTGGGGCCGG + Intergenic
967649788 3:191972883-191972905 CAGCTTCCTCAGCTGGCAGCAGG + Intergenic
968053301 3:195671413-195671435 CACCTCTCTCAGCTGCCGGCAGG + Intergenic
968102510 3:195976948-195976970 CACCTCTCTCAGCTGCCGGCAGG - Intergenic
969367807 4:6709450-6709472 CATCTCCCACAGCTTGCTCCTGG + Exonic
971906831 4:32736845-32736867 CTGCTCCCTAACCTTGAGGCAGG + Intergenic
976690651 4:87864055-87864077 CGGCTCCCTCAGCTTGCGGGAGG - Intergenic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
977507704 4:97923223-97923245 CAGCTCCCTCAGCCTGCGGGGGG + Intronic
977606977 4:98993874-98993896 CGGTTCCCTCAGCTTGTGGTAGG - Intergenic
983434005 4:167688539-167688561 CAGCTCCCTGAGGCTGAGGCAGG - Intergenic
985534081 5:453427-453449 CAGGTCCATCAGCTTCCGGTGGG - Exonic
985750346 5:1670011-1670033 CAGCACTCTCAGCTTGAGGAAGG + Intergenic
990042426 5:51390111-51390133 CCCCGCCCTCAGCTGGCGGCCGG - Intronic
990597373 5:57325022-57325044 CAGCTCCATTTGCTTGCGTCTGG + Intergenic
991492452 5:67196226-67196248 CAGCTCCCCTAGGTTGAGGCAGG + Intronic
993770234 5:91917244-91917266 CGGCTCCCTCATCTTGCTGTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997375861 5:133396943-133396965 CAGCTTCCTCAGCCTGCGGGCGG - Intronic
998019313 5:138756148-138756170 CAGCTCCTTGAGGTTGAGGCAGG - Intronic
998254468 5:140574009-140574031 TAGCTCCCTCAGTTTGCTCCAGG - Intronic
998374844 5:141683321-141683343 CAGCTGCCTCAGCTAGGGGAGGG + Intergenic
999175718 5:149630463-149630485 CAGCACTCACAGCCTGCGGCAGG - Intronic
1001255374 5:170179059-170179081 CACCTCCCTCTGCCTGGGGCTGG - Intergenic
1001708558 5:173759900-173759922 CAGCTCACTCACGTGGCGGCTGG + Intergenic
1002385360 5:178861670-178861692 AAGACCCCTCAGCTAGCGGCAGG + Intronic
1002650131 5:180685106-180685128 CAGCTCCATCAGCTTCCCCCAGG - Intergenic
1002790775 6:435930-435952 CGGCTCCCTCAGCTTGCGCGGGG - Intergenic
1003176830 6:3758134-3758156 CGGCTCCCTCGGCTTGCGGGGGG + Intergenic
1003279051 6:4676219-4676241 CAGCTCCCTCAACCTTCGGTCGG - Intergenic
1005830192 6:29664567-29664589 CAACTTCATCAGCTTGCGGAAGG - Intronic
1006354136 6:33543944-33543966 CAGCTCCCCGAGCTCGGGGCTGG - Intergenic
1016217145 6:141618182-141618204 CGGCTCCCTCAGCTTGCAGGGGG + Intergenic
1018099846 6:160427532-160427554 CAGTTCCCTCAGCTGGCGAGTGG + Intronic
1019000312 6:168744175-168744197 CCACTCCCTCAGCTTGCAGGGGG - Intergenic
1019451661 7:1101771-1101793 CATCTCCCTGGGCCTGCGGCCGG - Intronic
1021085938 7:16421175-16421197 CAGCTGCCACGGCTTGCGGGTGG + Exonic
1022649218 7:32259476-32259498 CAGCTCCCCCAGCTGGTGGGAGG - Intronic
1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1028779565 7:94720092-94720114 CACCTCCCTTAGCTGGGGGCGGG + Intergenic
1032073124 7:128821950-128821972 CACCACCCTCAGCTTTGGGCAGG + Exonic
1037887160 8:22601170-22601192 CACCTCCCCCAGCTTCTGGCTGG - Exonic
1042742727 8:72068939-72068961 CAGCTCTCTCTGCTTGCACCAGG - Intronic
1043182202 8:77099194-77099216 CAGCTCACTCAGCTCACTGCAGG - Intergenic
1043847565 8:85179305-85179327 CTTCTCCCTCAGCTTGCCTCAGG + Intronic
1044441598 8:92230759-92230781 CAGCTCCCTCAGCTTGCAGGGGG + Intergenic
1045225037 8:100235779-100235801 TGGCTCCCTCAGCATGGGGCGGG - Intronic
1046482906 8:114846665-114846687 CAGCTCCCTCACCTTTTGGCTGG - Intergenic
1048692548 8:136983846-136983868 CAGGTGTCTCAGCTGGCGGCAGG + Intergenic
1049365052 8:142233046-142233068 CCCCTCCCTCAGCTTGGGGAGGG - Intronic
1049473180 8:142785262-142785284 CAGTGCCCTCAGCCTGGGGCTGG - Exonic
1049585565 8:143431024-143431046 CAGCTCCCACACCCGGCGGCCGG + Intergenic
1051314237 9:15810793-15810815 CAGCTCCCTCTCCTTGTGGGAGG - Intronic
1052998289 9:34563384-34563406 CAGCTCCCTCACCCTCAGGCAGG + Intronic
1056261580 9:84854191-84854213 CAGCTTCCTCAGCTTTGGGATGG + Intronic
1056752236 9:89360710-89360732 CAGCTCCCTCAACGTGCAGATGG + Intergenic
1057896395 9:98912439-98912461 CAGCTCCCTCAGCCTCCCTCTGG - Intergenic
1059469201 9:114491663-114491685 CAAGTCCCTCTGCTTGCGGGTGG - Intronic
1061147666 9:128809186-128809208 CACCTCCCTCAGCCCGCAGCGGG - Exonic
1061732753 9:132629084-132629106 GAGCTCCCTCAGCTGGAGGCTGG - Intronic
1185726899 X:2429154-2429176 CAAGTCCCTCAGCTTGGGTCAGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1188207876 X:27381495-27381517 CAGCTCCCACAGCTGGCACCAGG - Intergenic
1192180812 X:68914556-68914578 CTTCTCCCTCAGCTGGGGGCAGG + Intergenic
1200124570 X:153807232-153807254 CGGCTCCCGCAGCTGGCTGCGGG + Intronic
1201989112 Y:20005400-20005422 CAGCTACTTCAGCGTGAGGCAGG + Intergenic
1202137149 Y:21677054-21677076 CGGCTCCCTCAGCTTGCAGGGGG - Intergenic
1202272716 Y:23086155-23086177 CGGCTCCCTCCGCTTGTGGGAGG - Intergenic
1202293310 Y:23334527-23334549 CGGCTCCCTCCGCTTGTGGGAGG + Intergenic
1202425713 Y:24719899-24719921 CGGCTCCCTCCGCTTGTGGGAGG - Intergenic
1202445076 Y:24950186-24950208 CGGCTCCCTCCGCTTGTGGGAGG + Intergenic