ID: 977471355

View in Genome Browser
Species Human (GRCh38)
Location 4:97447558-97447580
Sequence GCTCCAGCCTTGGCTAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3234
Summary {0: 1, 1: 20, 2: 352, 3: 1047, 4: 1814}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977471351_977471355 -10 Left 977471351 4:97447545-97447567 CCCAGATGCTTCAGCTCCAGCCT 0: 1
1: 14
2: 112
3: 311
4: 662
Right 977471355 4:97447558-97447580 GCTCCAGCCTTGGCTAAAACGGG 0: 1
1: 20
2: 352
3: 1047
4: 1814
977471347_977471355 29 Left 977471347 4:97447506-97447528 CCACTGCTCTGTGCAGCCTCAGT 0: 2
1: 74
2: 176
3: 401
4: 1194
Right 977471355 4:97447558-97447580 GCTCCAGCCTTGGCTAAAACGGG 0: 1
1: 20
2: 352
3: 1047
4: 1814
977471349_977471355 13 Left 977471349 4:97447522-97447544 CCTCAGTATATGGTGTCCTATGA 0: 1
1: 0
2: 0
3: 11
4: 88
Right 977471355 4:97447558-97447580 GCTCCAGCCTTGGCTAAAACGGG 0: 1
1: 20
2: 352
3: 1047
4: 1814
977471350_977471355 -3 Left 977471350 4:97447538-97447560 CCTATGACCCAGATGCTTCAGCT 0: 1
1: 0
2: 10
3: 106
4: 469
Right 977471355 4:97447558-97447580 GCTCCAGCCTTGGCTAAAACGGG 0: 1
1: 20
2: 352
3: 1047
4: 1814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977471355 Original CRISPR GCTCCAGCCTTGGCTAAAAC GGG Intronic
Too many off-targets to display for this crispr