ID: 977474605

View in Genome Browser
Species Human (GRCh38)
Location 4:97489765-97489787
Sequence CTTCAGAAGGAGACCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977474605_977474613 21 Left 977474605 4:97489765-97489787 CCTTCAAAGGTCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 18
4: 294
Right 977474613 4:97489809-97489831 AAATGTAAGTGTTTTGCTCTGGG No data
977474605_977474612 20 Left 977474605 4:97489765-97489787 CCTTCAAAGGTCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 18
4: 294
Right 977474612 4:97489808-97489830 GAAATGTAAGTGTTTTGCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 264
977474605_977474614 30 Left 977474605 4:97489765-97489787 CCTTCAAAGGTCTCCTTCTGAAG 0: 1
1: 0
2: 1
3: 18
4: 294
Right 977474614 4:97489818-97489840 TGTTTTGCTCTGGGTAAATTAGG 0: 1
1: 1
2: 1
3: 22
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977474605 Original CRISPR CTTCAGAAGGAGACCTTTGA AGG (reversed) Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903293704 1:22330439-22330461 CTTCAGAAGGCATCCTTCGAAGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904909959 1:33927352-33927374 CCTCAGAAGGATACCTTAGGTGG - Intronic
905208780 1:36358949-36358971 CTCCACCAGGAGACCTTGGAGGG - Intronic
905352016 1:37353972-37353994 CTTCTCAAGGTGACCTTTAAAGG - Intergenic
905458107 1:38102475-38102497 CTCCAAAATGACACCTTTGAAGG + Intergenic
906050250 1:42865110-42865132 TTTCTGAAGGATACCTTTGGTGG - Intergenic
906137087 1:43507211-43507233 CTTCAGAAGCAAACCCTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906546182 1:46620935-46620957 CTTGGGAAGGAGACCTCTGGAGG + Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906835147 1:49074822-49074844 CAACAGAAGGATACCTTTCAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909554814 1:76941744-76941766 CTTCGGAAGGAGCCTTTGGATGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910116792 1:83740130-83740152 CGTCAGAAGGAGAGTTTTGAAGG - Intergenic
910820233 1:91337961-91337983 CTTCAGAAGGAAGTCATTGAGGG + Intronic
911150828 1:94595659-94595681 CTTCAGAAGCAGACCTGGGGCGG - Intergenic
912182515 1:107236299-107236321 CTTTTGAAGGATAACTTTGATGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913223889 1:116681536-116681558 CTTCAGTAGGATTCCTTTTAAGG - Intergenic
914384765 1:147157809-147157831 CTGCAGAAGGTGGCCTTGGATGG + Exonic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914975575 1:152357836-152357858 CCTCAGAAGAAGACATTTCAAGG + Intronic
915297481 1:154931368-154931390 CTTCAGAAAGGGAACTTGGAAGG - Intronic
918188563 1:182149341-182149363 CTTCAGGAAGAAGCCTTTGAGGG + Intergenic
918425321 1:184403972-184403994 ATTCAGCAGGAGATTTTTGAAGG + Intronic
920689278 1:208133463-208133485 ATTTAGAAGGAGACTTTTGCTGG + Intronic
921153224 1:212418107-212418129 CCTCAGAATGTGACCTTAGATGG + Intergenic
921557987 1:216622180-216622202 CCTCAGAAGGATAACTTTCATGG - Intronic
921845511 1:219875619-219875641 CCTCAGATGTTGACCTTTGAAGG + Intronic
921947009 1:220892987-220893009 TTTCAGCTGGAGACCCTTGACGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
1063031057 10:2235161-2235183 TTTCAGAAGGAAATCTTTGGAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063167847 10:3479958-3479980 CTTCACATGGAGGCCTGTGATGG - Intergenic
1063305226 10:4892462-4892484 CTTCAGAATATGACCTTTTATGG + Intergenic
1063866178 10:10367601-10367623 CTCTGAAAGGAGACCTTTGAGGG - Intergenic
1063913301 10:10854396-10854418 ATTCAGAAGGAGCCATTTGTAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG + Intergenic
1067983141 10:51110562-51110584 TGTCAGGAGGAAACCTTTGAGGG + Intronic
1068221753 10:54054066-54054088 ATTCAGAAGGAGCCCTTTCTGGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070396637 10:76017022-76017044 CCTCAGAAGGTGACCTTACATGG + Intronic
1072509047 10:96100067-96100089 CTTCAGAAGGGGACCTGGGGAGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073288242 10:102401023-102401045 CTTCAGAAGGAGGCGGGTGAGGG - Exonic
1073475768 10:103752112-103752134 TTTCAGCAGGAGCCCTTTGCAGG + Intronic
1074466484 10:113687154-113687176 CTTCTGAAGGACAGCTTTGCTGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079979449 11:27133605-27133627 TTTCTGAAGGACAGCTTTGATGG - Intergenic
1081760946 11:45576080-45576102 CATCAGAATGAGCACTTTGAGGG - Intergenic
1081846698 11:46245762-46245784 CCTCGGAAGGAGTCCTTAGAAGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085860523 11:80228186-80228208 TTTCAGAAGGATACTTTTGCTGG - Intergenic
1086726870 11:90197069-90197091 CTTTAGTAGGAAGCCTTTGAAGG + Intergenic
1087387273 11:97487782-97487804 GGTCAGAAGGAAACTTTTGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093177167 12:15925675-15925697 CTGAAGAAGTAGAACTTTGAAGG + Intronic
1093941661 12:25061606-25061628 CTTCAAAAGGAGTTCATTGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096551378 12:52375523-52375545 CTTCTGAAGGAGACTTTTGCTGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099880052 12:88456858-88456880 CTTTAAAAGGAGACCTTTCCTGG - Intergenic
1100023260 12:90097177-90097199 CCTTAGAAGGATACCTGTGATGG - Intergenic
1101751780 12:107587982-107588004 CTTTAGAGGGAGGCTTTTGAAGG - Intronic
1102382173 12:112476234-112476256 CATCTGAATGAGACCTTTAAGGG - Intronic
1104453904 12:128894232-128894254 CTTCAGTAGGGGACCTGTGATGG + Intronic
1105603840 13:21910585-21910607 CTTCTGAGGGAGACATTTGATGG + Intergenic
1105804483 13:23944815-23944837 CCTCACAAGCAGACATTTGAAGG - Intergenic
1106288481 13:28338855-28338877 CTCCAGACTGAGCCCTTTGAGGG + Intronic
1107803815 13:44135270-44135292 TTTCATAAGGACACTTTTGATGG - Intergenic
1110908386 13:80922126-80922148 ATTCAGAAGGACAGCTTTTATGG - Intergenic
1111393583 13:87632954-87632976 CTTTAGAAGGATTCATTTGAAGG + Intergenic
1111441719 13:88290421-88290443 GTTGAGAAGGATACCTTTGCTGG + Intergenic
1112585656 13:100716394-100716416 CTTCAGACACAGACCTTGGAGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114340045 14:21733730-21733752 CTTCAGAAGGTGACCTTATTTGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118517263 14:66544241-66544263 TTTGAGAAGGTGACATTTGAGGG - Intronic
1121795359 14:96730308-96730330 CTGCAGAAGAGGCCCTTTGAGGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122736349 14:103845543-103845565 CTTAAAAAGGAAACCTGTGAAGG + Intronic
1125744407 15:41988926-41988948 TTTCTGAAGAAGCCCTTTGACGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126797188 15:52269075-52269097 CATCATCAGGAGACCTATGAAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129432346 15:75508935-75508957 CTTCAGGAGGAGACTGATGATGG + Exonic
1131242677 15:90760588-90760610 CTTCAGAAGGAAACTTCTAACGG + Exonic
1132458184 16:35818-35840 CTTCACCAGGTGACCTTGGAGGG - Intergenic
1132959395 16:2613554-2613576 CCTCAGAAGGACACCTCTGATGG - Intergenic
1132972456 16:2695529-2695551 CCTCAGAAGGACACCTCTGATGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1134825187 16:17278818-17278840 CTTCAGAATCAGACCTAGGATGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137855104 16:51786529-51786551 TTTCAGAAGGAGAGCATTGGTGG + Intergenic
1137992646 16:53175186-53175208 CTTCAGAGGGTGCCCTTTAAAGG - Intronic
1138832449 16:60391384-60391406 CTTCAGAAGGCAACCATTAAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140452531 16:75082259-75082281 CTTCCTAAGCAGCCCTTTGAGGG + Intronic
1140871718 16:79112832-79112854 CTTCAGAATCTGACCTTGGACGG - Intronic
1141352293 16:83309322-83309344 CTTCAGCAGATGTCCTTTGAGGG + Intronic
1142394358 16:89823178-89823200 TATCAGACGGAGCCCTTTGAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143419828 17:6780054-6780076 CTTCAGCGGGAGACCTTCCAGGG + Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146462436 17:33056821-33056843 CTTCAGAAGGAAACCCTGGGTGG - Intronic
1148207369 17:45787573-45787595 CTTGAGAAGGGGACCTGTGGGGG - Intronic
1148601699 17:48899212-48899234 CTTCAGAAGTCGACCTGTGGCGG + Intergenic
1149316435 17:55443360-55443382 CTTCAGAAGGAGACTGATCAGGG - Intergenic
1149326079 17:55531062-55531084 CTTCAGAAGGATGGCTTGGAAGG - Intergenic
1150571316 17:66389450-66389472 CTGCATAAGGACACCTTTGCAGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152810215 17:82378222-82378244 ATGCAGAAGGAGAGCTTTGGGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1155343421 18:24835799-24835821 TTTCAGAAGGAGTCCTTGGAGGG + Intergenic
1158921731 18:62199651-62199673 CCTCAGAAACAGAGCTTTGATGG - Intronic
1159544533 18:69822624-69822646 CTTCAGAGGAAGACCTTTGCAGG + Intronic
1159826228 18:73214332-73214354 ATTAAGAAGGAGACATTTAAAGG - Intronic
1160265350 18:77337011-77337033 CTTCAGAAGGAAACCACTGGAGG - Intergenic
1160441549 18:78896540-78896562 CTTCAGAACCAGAGCTGTGATGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926311634 2:11679849-11679871 CTTCAGAAGCAGAGCCTTGCAGG - Intronic
927213410 2:20652268-20652290 GTTCTGAGGGAGACCCTTGAAGG + Intergenic
927327649 2:21824198-21824220 CATCAGAAGAAAACCTTTCATGG - Intergenic
927916808 2:26942410-26942432 CTTCAGCAGAAGAATTTTGAAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930397239 2:50838506-50838528 CTTCAGAATGTGACCTTATATGG + Intronic
930630648 2:53750902-53750924 ATTAAGATGAAGACCTTTGAAGG - Exonic
932504509 2:72215786-72215808 CTCCAGAAGGAGGCCTTTTCTGG - Intronic
932606776 2:73170575-73170597 CTGCAGAAGGGGACCGTTGCAGG - Intergenic
932732348 2:74230329-74230351 CTCCAGAAAGAGACCCTTGTGGG + Intronic
933925652 2:87089867-87089889 CTGCAGAAGGGGACCGTTGCAGG + Intergenic
934500017 2:94851742-94851764 ATTGAAAAGGAGAACTTTGAAGG + Intergenic
934689420 2:96346867-96346889 CTTAGGATGGAGACCATTGAAGG + Intronic
934906333 2:98207592-98207614 CTCCTGAAGGAGACCATTAAAGG + Intronic
935257954 2:101329140-101329162 CTGCAGAAGGAGATATTAGAAGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938477045 2:131626280-131626302 CATCAGAAGGAGTCCTATGTGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941190245 2:162372841-162372863 ATTCAAAAGGACCCCTTTGAGGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946197077 2:218039990-218040012 CTTCAGAAGGAGTCCTCTCTAGG - Intronic
946753254 2:222915170-222915192 CTTCAAAAGGAGCTCTGTGAGGG - Intronic
1168826718 20:819164-819186 CGTCAGAAGGCGACCTCTGCTGG - Intergenic
1168851389 20:979337-979359 CCCCACAAGGAGACATTTGAGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170230701 20:14043832-14043854 CTTCAGAAGTAGGCCTCAGAAGG - Intronic
1170552145 20:17487293-17487315 ATTCAGAGGGACATCTTTGAGGG - Intergenic
1172305139 20:33875326-33875348 CTGCAGGAGGAGACCTGTGGGGG + Intergenic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174468538 20:50737071-50737093 CTTCAGAATCAGAACTGTGAAGG + Intronic
1174718838 20:52789210-52789232 CTTCAGAATGTGTCCTTTCAGGG - Intergenic
1174770198 20:53292376-53292398 CTTCAGAAAGAGTTCTTGGAAGG - Intronic
1175281249 20:57805369-57805391 ATTGAGAAGGTGACATTTGATGG - Intergenic
1175326274 20:58130585-58130607 CTTCAGAAGAAGACGTATGGAGG - Intergenic
1179031773 21:37726902-37726924 CCTCAGAAGGTGACCTTATATGG + Intronic
1179289954 21:40009666-40009688 CTTGAGGAGGAGACTTGTGATGG - Intergenic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1181310684 22:21943113-21943135 CTCCAGAAGGATGCCTTTTACGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181666169 22:24399156-24399178 CTCCAGAGGGAGACGTTTCATGG - Intronic
1182437459 22:30339913-30339935 GTTTAGAAGGAGAGCATTGATGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184453681 22:44597402-44597424 CTTCAGAAGGAGCCCAGTGCTGG - Intergenic
951616488 3:24552001-24552023 CTTCATAAGGAGATCTTTGTTGG + Intergenic
953587109 3:44212211-44212233 CTTCAGAAGTAACCCCTTGAGGG - Intergenic
953958038 3:47246621-47246643 CTTCAGATGGAGCCCATTTATGG + Intronic
954144309 3:48626763-48626785 GTTTAGAAGGGGAGCTTTGAGGG + Intronic
954358392 3:50102577-50102599 CTTCAGGATGAGTCCTTTGGGGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954732979 3:52680904-52680926 CTTTAGAAAAAGGCCTTTGACGG - Intronic
954882961 3:53847894-53847916 CATCAAAAGGAGATCTTAGAAGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960954577 3:123022931-123022953 CTTCAGAAGGAGAGTATTGGAGG + Intronic
961224829 3:125233838-125233860 TGTCAGAAGGCCACCTTTGATGG + Exonic
961628953 3:128282307-128282329 GTTCACAGGGAGCCCTTTGAGGG + Intronic
962182411 3:133222161-133222183 TTTCAGAAGGACAGCTTTGCTGG + Intronic
962401066 3:135059226-135059248 CTACAGAAGGAGCCCTTTCTGGG + Intronic
963806210 3:149725665-149725687 TTTCAGAAGGAAAATTTTGAAGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963973363 3:151453719-151453741 CTTCAGAAAGATACTTTTTATGG - Exonic
964453573 3:156836608-156836630 ACTTAGGAGGAGACCTTTGAGGG - Intronic
964656831 3:159076471-159076493 CTTCAGAATGAGACATATAAGGG - Intronic
966097625 3:176224451-176224473 CTTCCGAAGCACAGCTTTGATGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969212870 4:5701189-5701211 GATCAGAAGGAGATGTTTGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971981206 4:33753559-33753581 TTTCAAAAGGTAACCTTTGAGGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973901916 4:55484155-55484177 CTGCAGAAGTAGAACTGTGAGGG + Intronic
975448586 4:74498521-74498543 TTTCTGAAGGACAGCTTTGATGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975691456 4:76968259-76968281 CTTTATAAGGTGACCTTTGAAGG - Intronic
976153390 4:82115816-82115838 CTTCAGAATGTGACCTTTTATGG + Intergenic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978758664 4:112331285-112331307 CTGCAGTGGGAGACCTTTGGTGG + Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983728476 4:170961868-170961890 CTTCTGAAAGACAGCTTTGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985009119 4:185564442-185564464 CTTCAGAAGGAAACTTTCAAGGG - Intergenic
986058413 5:4162494-4162516 CCTCAGACAGAGAACTTTGAGGG - Intergenic
987145548 5:14988309-14988331 CTTCAGAAGTCTCCCTTTGACGG + Intergenic
988007863 5:25441896-25441918 CTTCAGCATGAGACTTTTGATGG - Intergenic
988621886 5:32831626-32831648 GTTCAGAAGGACAGTTTTGAGGG + Intergenic
989118363 5:37978550-37978572 CTTCATAAGGTGACCTTTTCTGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990041231 5:51381061-51381083 CATTAAAAGGAGACGTTTGAGGG - Intergenic
990724083 5:58734185-58734207 CTGCAGAAGGGAACATTTGAAGG - Intronic
991264212 5:64697966-64697988 CTTCAGGAAGAGAACTTTCAAGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993114127 5:83699343-83699365 CTTCTTAAGGACACCTTTGCTGG - Intronic
996412141 5:123170106-123170128 GGTCAGAAGGAGACCTCAGAGGG - Intronic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
1000101009 5:158016224-158016246 CTTTAGAAGCAAAGCTTTGAAGG - Intergenic
1000525685 5:162354762-162354784 CTTCAAAAGGAGACGATTGTTGG - Intergenic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1007419162 6:41708925-41708947 CCTCAGAAGGAGAGCTGGGATGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008706617 6:54168274-54168296 GTTGAGAAGGTGACATTTGAAGG - Intronic
1009306570 6:62098378-62098400 CTTCTGAAGGATAACTTTGCTGG + Intronic
1011420841 6:87170859-87170881 CTTCAAATGGGGACCTTTTATGG + Intronic
1011719991 6:90145601-90145623 CTGCAGAAAGAGACCCTCGAGGG - Intronic
1013079501 6:106800218-106800240 CTTCACGAGGAGGTCTTTGAGGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020125608 7:5531060-5531082 CTGCAGAAGGAGCTCTTGGAGGG + Intronic
1020706029 7:11545508-11545530 CTTCAGAAGGATGGCATTGAAGG + Intronic
1021070259 7:16229880-16229902 TTTCTGAAGGACACCTTTGCTGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023905218 7:44517003-44517025 CTTCAGAAGGAGAATGCTGAGGG + Intronic
1024999809 7:55306348-55306370 CTTCAGGAGGAAAGGTTTGAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026535214 7:71233443-71233465 CAACAGAAGTAGACCTTAGAAGG + Intronic
1027594057 7:80150950-80150972 CTCCAGAATGACAGCTTTGATGG + Intronic
1028667381 7:93362507-93362529 CTTCAGATGGAAGCATTTGAGGG + Intergenic
1031847005 7:126817696-126817718 TTTCAGAAGCAGACATTTGAGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034957169 7:155342133-155342155 CCTCAGAAGGTGACCTTATAGGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1037555044 8:20013987-20014009 CTCCAGAAGGTGACCTTTCTTGG + Intergenic
1037685604 8:21137059-21137081 CCTCAGAAAGAGACCTTAGTTGG - Intergenic
1038153667 8:24966311-24966333 CAGCAGAATGAGACTTTTGAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041143440 8:54846339-54846361 CTTCATAATGATAACTTTGAGGG + Intergenic
1042881922 8:73502641-73502663 ATGCAGAAGGTGACCTTTGAAGG - Intronic
1044534023 8:93339199-93339221 CTTCAGAATGAGACCTTGTTTGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045189197 8:99866426-99866448 GCTCAGCAGCAGACCTTTGAGGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046661753 8:116955197-116955219 CTTCAGAATGAGACCTTATTTGG + Intronic
1050079094 9:1896150-1896172 CTCTAGAAAGAGACTTTTGAAGG - Intergenic
1050205436 9:3191522-3191544 TTTCAGAAGGGGACACTTGAGGG - Intergenic
1050219393 9:3369610-3369632 CTTCAGAAGCAGTCCTTTTATGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052060583 9:23955819-23955841 CTTCAGTATGAGTCCTTTCATGG - Intergenic
1053206993 9:36194728-36194750 CTTCAGAAGGAAACTTTCTAGGG - Intronic
1053657156 9:40228784-40228806 ATTGAAAAGGAGAACTTTGAAGG - Intronic
1053907519 9:42858078-42858100 ATTGAAAAGGAGAACTTTGAAGG - Intergenic
1054527440 9:66147442-66147464 ATTGAAAAGGAGAACTTTGAAGG + Intronic
1056311192 9:85342541-85342563 CTTCAGAAAGAGAGCTTTCATGG + Intergenic
1059019612 9:110560928-110560950 TTTCAGAAAGATAACTTTGATGG - Intronic
1059199498 9:112400959-112400981 CTTCAGAAGGTGACCTCAGTTGG - Intronic
1059410027 9:114125917-114125939 CTGCAGAAGGAGCTCATTGAGGG - Intergenic
1059868474 9:118544863-118544885 CTTCAGAAGGAAGGCATTGAAGG + Intergenic
1060081053 9:120645747-120645769 CTTTATAAGGAGGCCTTTGAGGG - Intronic
1060224078 9:121780854-121780876 CATCAGTAGGAGACATCTGAAGG - Intronic
1203548804 Un_KI270743v1:151842-151864 CTTCAGCGGGAGTCCGTTGAAGG - Intergenic
1185758572 X:2672117-2672139 CTTCAGAATGAGACCTTATGTGG + Intergenic
1187393014 X:18897883-18897905 CTGCAGTGGGAGAGCTTTGAGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189948562 X:46204856-46204878 CTTAAGAAGGCTACCTCTGAAGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191702287 X:64055538-64055560 TAGTAGAAGGAGACCTTTGAAGG - Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192447701 X:71223164-71223186 CTGCACAATGAGACCTTTGTGGG - Intronic
1195900508 X:109792705-109792727 CTTCAGAATGTGACCTTATATGG - Intergenic
1197013449 X:121594494-121594516 CTTCCTAAGGTGACTTTTGATGG + Intergenic
1199218431 X:145288949-145288971 TTTCTGAAGGACACCTTTGTTGG + Intergenic
1200943229 Y:8806552-8806574 CTTCAGGAGGAAACTTTTGCAGG - Intergenic