ID: 977477977

View in Genome Browser
Species Human (GRCh38)
Location 4:97537426-97537448
Sequence AGCAACAAGGGAGGCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977477977_977477987 25 Left 977477977 4:97537426-97537448 CCCTCAGAGCCTCCCTTGTTGCT No data
Right 977477987 4:97537474-97537496 CAAGGCAGCAGCAAGGCTGGGGG 0: 140
1: 730
2: 1954
3: 1883
4: 1645
977477977_977477982 7 Left 977477977 4:97537426-97537448 CCCTCAGAGCCTCCCTTGTTGCT No data
Right 977477982 4:97537456-97537478 CAGTCTGAGATCGAACTGCAAGG 0: 262
1: 4095
2: 1445
3: 565
4: 429
977477977_977477985 23 Left 977477977 4:97537426-97537448 CCCTCAGAGCCTCCCTTGTTGCT No data
Right 977477985 4:97537472-97537494 TGCAAGGCAGCAGCAAGGCTGGG 0: 153
1: 777
2: 2018
3: 1861
4: 1289
977477977_977477983 18 Left 977477977 4:97537426-97537448 CCCTCAGAGCCTCCCTTGTTGCT No data
Right 977477983 4:97537467-97537489 CGAACTGCAAGGCAGCAGCAAGG No data
977477977_977477988 28 Left 977477977 4:97537426-97537448 CCCTCAGAGCCTCCCTTGTTGCT No data
Right 977477988 4:97537477-97537499 GGCAGCAGCAAGGCTGGGGGAGG 0: 125
1: 679
2: 1942
3: 2117
4: 2054
977477977_977477986 24 Left 977477977 4:97537426-97537448 CCCTCAGAGCCTCCCTTGTTGCT No data
Right 977477986 4:97537473-97537495 GCAAGGCAGCAGCAAGGCTGGGG 0: 147
1: 745
2: 2011
3: 1909
4: 1455
977477977_977477984 22 Left 977477977 4:97537426-97537448 CCCTCAGAGCCTCCCTTGTTGCT No data
Right 977477984 4:97537471-97537493 CTGCAAGGCAGCAGCAAGGCTGG 0: 148
1: 747
2: 1978
3: 1866
4: 1388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977477977 Original CRISPR AGCAACAAGGGAGGCTCTGA GGG (reversed) Intronic