ID: 977479020

View in Genome Browser
Species Human (GRCh38)
Location 4:97550437-97550459
Sequence GTGGAGTGAAAAAGGATACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977479020 Original CRISPR GTGGAGTGAAAAAGGATACG GGG Intronic
900958253 1:5901870-5901892 GAGGACTGAAAAAGGAAAGGTGG + Intronic
901401301 1:9016809-9016831 GTGGAGGGAAAGAGGATAAGAGG - Intronic
906443858 1:45876107-45876129 GTGGAGCCAAAAAAGATAGGTGG + Intronic
908572434 1:65423290-65423312 GTGGAGTGAAAAGAGAGATGGGG + Intronic
910758967 1:90717407-90717429 GTGGAAAGAAAAAAGATGCGGGG + Intergenic
910998716 1:93138799-93138821 GTGGAGTGAATAAGGATACACGG - Exonic
911413375 1:97539878-97539900 GTGGAGAGAAAAAGGCTATATGG - Intronic
913092015 1:115482673-115482695 GTGGAGTGAAGAGGTATATGAGG + Intergenic
915905207 1:159872291-159872313 GTGGAGTAAAATAGGATGGGGGG - Intronic
916437483 1:164790553-164790575 GTGAAGTAAAAAAGGATGAGAGG - Intronic
916695367 1:167230278-167230300 GTAGAGTGAAAAAAGGTACTGGG + Intronic
921488311 1:215742610-215742632 TTGGAGTGATAAAGGAAATGGGG + Intronic
923912023 1:238459545-238459567 GGGGAGTCAAAAATTATACGTGG - Intergenic
924128242 1:240878281-240878303 GTGGAGGGAAGAAGAATAGGGGG - Intronic
1065064365 10:21945346-21945368 GTTGAATGGAAAAAGATACGTGG + Intronic
1068390504 10:56390305-56390327 CTGGAGTGAATAAGGAGAGGAGG - Intergenic
1070927365 10:80234402-80234424 GTACTGTGAAAAAGTATACGTGG + Intergenic
1075373770 10:121961002-121961024 GTAGAGTGATAAAGTAAACGTGG - Intronic
1077956456 11:7025659-7025681 GGTGAGTAAAAAAAGATACGAGG + Intronic
1079122135 11:17693748-17693770 GTAGACTGAAGAAGGAGACGTGG + Intergenic
1079955454 11:26857543-26857565 GTAGAGTGAAAAAGGAAATAGGG + Intergenic
1080816560 11:35763366-35763388 GTGGAGGGAACAAGGATACAGGG + Intronic
1081620682 11:44617594-44617616 GAAAAGTGAAAAAGGAGACGGGG - Intronic
1082067781 11:47914890-47914912 ATGGAGTGAAAAAGGGGACTTGG + Intergenic
1085458150 11:76677441-76677463 CTGAAGTGAAAAAGGAAAGGAGG + Intergenic
1085937728 11:81169997-81170019 ATGGAGTGACAAAGAATATGTGG + Intergenic
1091144568 11:133266382-133266404 GGGGAGCTCAAAAGGATACGTGG - Intronic
1097227712 12:57488320-57488342 GTGGAGTGATCAAGGATAATAGG - Intronic
1101843078 12:108341867-108341889 GAGGAGGGAAAAAGGAGAGGAGG + Intergenic
1103190243 12:118994864-118994886 GTGGAGTGAGAAAAGACACTGGG + Intronic
1108253960 13:48593106-48593128 GGGGAGTCAAAAATGATACATGG - Intergenic
1110354629 13:74553011-74553033 GAGGAGTGAAAAAGGAGAACTGG - Intergenic
1110632324 13:77723430-77723452 GTAGAGGGAAAAAGGATATGTGG + Intronic
1112307820 13:98291079-98291101 GGGGAGTCAAAAGGTATACGTGG - Intronic
1112958078 13:105086106-105086128 TTGGAGTGAAAAAGTTTTCGAGG - Intergenic
1113748991 13:112765454-112765476 GTGGAGTGGACAAGGAAACGGGG - Intronic
1113866283 13:113527745-113527767 GTGGACTGAAAAAGGATGTGAGG - Intronic
1114953505 14:27787813-27787835 GTGGAGGTAAAAATGATACAGGG - Intergenic
1115069520 14:29303962-29303984 GTGGAGAGTAAAAGGATTCCAGG + Intergenic
1115568918 14:34648971-34648993 GTGGGGAGAAAAAGGAAAAGTGG + Intergenic
1117790642 14:59337619-59337641 TTGGAATGAAAAAGGGAACGAGG - Intronic
1117986561 14:61391900-61391922 GGGGATTGAAAAAGGGTACAGGG - Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124717308 15:32076677-32076699 GTGGGGTGACACAGGATATGTGG - Intronic
1134122785 16:11596664-11596686 GTGGAGGGAAAAAGGAGGGGAGG + Intronic
1139461392 16:67125372-67125394 GGAGAGAGAAAAAGGATAAGAGG + Intronic
1153886385 18:9471315-9471337 GGGCAGGGAAAAAGGATAGGAGG - Intergenic
1156056332 18:33009039-33009061 GAGGAGTGAAGAATGATACCAGG - Intronic
1158497523 18:57969984-57970006 GTGGAGTGATGAAGGAGAAGAGG - Intergenic
1158813457 18:61065731-61065753 GTGGAGTGAAAAATGACAACAGG - Intergenic
1164235039 19:23324240-23324262 GTGGAGAAAAAAAGGAGAGGGGG - Intronic
1166181989 19:41115263-41115285 ATGGAGAGAAAAAGGGTAAGAGG - Intronic
926231900 2:11010646-11010668 GTAGAATGAAGAAGGAGACGAGG + Intergenic
931314556 2:61115923-61115945 GTGGACTGGAAAAGTATATGGGG + Intronic
933562860 2:83910972-83910994 GAGGTGGGAAAAAGGATAGGTGG - Intergenic
933771705 2:85748819-85748841 GGGGAGGGAAAAAGGTCACGAGG - Intergenic
941975892 2:171404995-171405017 GTGCAGTGAAACAGGAGACAAGG + Intronic
942309703 2:174644411-174644433 GGGGAGTGAATATGGATACCTGG - Intronic
945670704 2:212799655-212799677 GTGGATTGAAAAGTGATAGGAGG - Intergenic
946406155 2:219493057-219493079 GTGGAGAGGAAAAGGAATCGAGG + Exonic
1169586977 20:7096337-7096359 GAGGAAAGAAAAAGGAAACGTGG + Intergenic
1177270669 21:18845332-18845354 GCTGAGTCAAAAATGATACGTGG - Intergenic
1178225612 21:30714449-30714471 CTGGACTGAAAAAGGATATAAGG + Intergenic
1183220494 22:36509256-36509278 GTGGAGAGAAAAAGTGTACTTGG - Intergenic
950932957 3:16809302-16809324 GTGGGGTGAATCAGGATAGGGGG - Intronic
952281125 3:31924305-31924327 CTGGAGTGGAAAAGAGTACGTGG + Intronic
953457490 3:43054537-43054559 GTGGGGTGAGAAAGGAGAAGAGG + Intronic
954488035 3:50873066-50873088 GTGGAGGGGAAAAGGAAACAAGG - Intronic
957792178 3:84956008-84956030 ATGAAGTGAAAGAGAATACGGGG + Intergenic
959685322 3:109139842-109139864 GTGGAGTGAAAAATAAGAGGTGG - Intergenic
961312471 3:126012248-126012270 GTGCAGTGAAAAAGAATTAGAGG - Intronic
962293258 3:134155138-134155160 GTGGGGTGAAGAAGGAAGCGGGG - Intronic
962500982 3:135992112-135992134 GTGGAATAAAAAAGGAGACCTGG - Intronic
964253039 3:154742387-154742409 GTGGACTGAAAAAAGAAATGTGG + Intergenic
968429382 4:546650-546672 GGGGTGTGAAACAGGATACCCGG - Intergenic
969288139 4:6221164-6221186 GTTGAGTAAAAAAGGAAACAAGG + Intergenic
972731685 4:41801160-41801182 CTGGAGTGGAAAAGGATAGGAGG - Intergenic
974456525 4:62135463-62135485 GTGGCGTGAAAAAAGAAAGGGGG - Intergenic
977479020 4:97550437-97550459 GTGGAGTGAAAAAGGATACGGGG + Intronic
977661687 4:99595291-99595313 AAGGACTGAAAAAGGATACCAGG + Intronic
981964628 4:150584445-150584467 GTGGAGAGAAAAAGGATAGGGGG - Exonic
982740928 4:159056075-159056097 TGGGAGTGAAAAAGGAAATGAGG - Intergenic
983499308 4:168480820-168480842 ATGGAGTAAAAAAGGATTAGGGG + Intronic
987413620 5:17639715-17639737 ATGTAGGGAAAGAGGATACGGGG - Intergenic
987937189 5:24481445-24481467 GAGGAATGAAAAATGAAACGCGG + Intergenic
988129532 5:27085000-27085022 CAGGAGTGAAAAAGGAAATGAGG - Intronic
989635945 5:43533923-43533945 GTGAAGTGAAAATGGCTACCAGG - Intronic
994525836 5:100903725-100903747 GTGGAGTGAAACGGGGTGCGGGG + Intergenic
997893459 5:137695304-137695326 GTGGACTCAAACAGGATAAGGGG - Intronic
998194792 5:140059048-140059070 GGGGAGTCAAAAATTATACGTGG + Intergenic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1003781145 6:9428558-9428580 GTGGATTGAAAAAGCATAAATGG - Intergenic
1006763150 6:36481487-36481509 CTGGAGTGAAAAAGACTATGAGG - Intronic
1007470569 6:42087652-42087674 GGGGAGTGAAAAAGAAAACCAGG - Intergenic
1008921744 6:56850128-56850150 GTGGAGTGAGAAAGGGGAGGTGG - Intronic
1011046205 6:83086150-83086172 GGGGAGTCAAAAATTATACGTGG - Intronic
1013562593 6:111320364-111320386 GTGGAGTGAAAAAGAGTTCCTGG - Intronic
1013831918 6:114282712-114282734 GGGGAGGGAGAAAGGATAGGAGG - Intronic
1013846146 6:114454152-114454174 GTCATGTGAAAAAGGATATGTGG + Intergenic
1015233199 6:130940052-130940074 GCAGACTGAAAAAGGATAGGAGG + Intronic
1015911526 6:138172349-138172371 GTGCGGTGGAAAAGGAGACGTGG - Intronic
1017078409 6:150641724-150641746 GGGGAGGGAAAAAGGAAACATGG - Intronic
1017661915 6:156683343-156683365 GTGGAGAGAAGAGGGATAAGTGG - Intergenic
1018862009 6:167717807-167717829 GTGGAGAGAAAGAGGAGACAAGG + Intergenic
1019436860 7:1026801-1026823 GTGGAGGGAACAAAGCTACGTGG + Intronic
1028530671 7:91834900-91834922 GAGGAGTGTAAAAAGAGACGGGG - Intronic
1031106966 7:117555902-117555924 GTGGAGTCAAAAATTATACGTGG + Intronic
1031452647 7:121940860-121940882 GAGGAATGAAACAGGATAGGTGG - Intronic
1031792361 7:126122647-126122669 GTTGACTGAAAAAAGATACTAGG + Intergenic
1031903826 7:127439480-127439502 GTGGAGTCAAAAAGATTAAGGGG - Intergenic
1032967872 7:137122174-137122196 GTAGAGTGAAAAAGGAATTGTGG + Intergenic
1033676816 7:143549608-143549630 GTGGAGGGAGAAAGGAAAAGAGG - Intergenic
1036153873 8:6324174-6324196 GAGGAGTGATAAAGAATATGTGG - Intergenic
1037709920 8:21347430-21347452 GTGGAGAGAAAAAGGGGACAAGG - Intergenic
1038418632 8:27417450-27417472 GTGGACTGAGAAGGGATATGGGG + Intronic
1038546804 8:28432043-28432065 GTTGTGTGAAAAAGGAAAGGGGG - Intronic
1038936775 8:32260518-32260540 GTGCATTAAAAAAGGATAAGTGG - Intronic
1039473847 8:37829140-37829162 GTGGGATGAAAAAGGAGATGAGG - Intronic
1042145472 8:65724270-65724292 GTGGAGTGAAAAAGTAACGGAGG - Exonic
1046201568 8:110934536-110934558 GTGGAGTGAAAAAGGTAAAATGG + Intergenic
1047324271 8:123821282-123821304 GTGTAGTGAAAAAGGAGGCATGG + Intergenic
1047553468 8:125902331-125902353 GAGGATTCAAAAAGGATAGGTGG - Intergenic
1047595874 8:126377458-126377480 ATGCAGTGAAAAAAGATAAGAGG - Intergenic
1048167348 8:132075204-132075226 GTGACATGAAAAAGGAGACGGGG + Intronic
1053673979 9:40402948-40402970 GTGGAGGTAAAAATGATACAGGG - Intergenic
1053923779 9:43029314-43029336 GTGGAGGTAAAAATGATACAGGG - Intergenic
1054385081 9:64543014-64543036 GTGGAGGTAAAAATGATACAGGG - Intergenic
1054510648 9:65973342-65973364 GTGGAGGTAAAAATGATACAGGG + Intergenic
1055423537 9:76169340-76169362 TAGGAGTGCAAAATGATACGAGG - Intronic
1059279993 9:113124751-113124773 CTGGAGTGAAAAAAAAGACGTGG - Intergenic
1060181917 9:121540388-121540410 GTGGTGTGAAAAGGGAAATGTGG + Intergenic
1061574862 9:131499838-131499860 GTGTAGTAAAAAAGGATTTGGGG + Exonic
1061643126 9:131975798-131975820 GTTGAGTAAAAAAGGATGTGGGG + Intronic
1062604325 9:137338091-137338113 ATGGACTGTAAAAGGATACATGG - Intronic
1188369540 X:29351887-29351909 CTGGAGTAAAGAAGGATACTGGG + Intronic
1188489675 X:30723880-30723902 TTGGAGTGAAACAGGACACAGGG - Intronic
1189811658 X:44786292-44786314 GTGGAGTGAAAAAGCAAAGAGGG + Intergenic
1190886463 X:54534780-54534802 GGGGAGGGAAAAAGGAGAAGGGG - Intronic
1191252688 X:58267036-58267058 GGGGACTGGAACAGGATACGAGG - Intergenic
1192292600 X:69813750-69813772 GTTGAGAGAAAAAGGAAACTGGG - Intronic
1195165326 X:102214410-102214432 GTGGAGTGACAAAGTAGACTAGG + Intergenic
1195193532 X:102472681-102472703 GTGGAGTGACAAAGTAGACTAGG - Intergenic
1196634322 X:117983552-117983574 GTGGAGTGCAAAAAGAAACCTGG + Intronic
1197222545 X:123927658-123927680 GTGGAATGAAAAAGTAAACTGGG - Intergenic
1199930752 X:152518182-152518204 GTGGAATAAAAAAAGATACAGGG + Intergenic