ID: 977480955

View in Genome Browser
Species Human (GRCh38)
Location 4:97574736-97574758
Sequence AAAAATCCACAGAAGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 1, 2: 7, 3: 72, 4: 713}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977480955_977480956 -10 Left 977480955 4:97574736-97574758 CCTTTCTGCTTCTGTGGATTTTT 0: 1
1: 1
2: 7
3: 72
4: 713
Right 977480956 4:97574749-97574771 GTGGATTTTTAACTTTCTTTCGG 0: 1
1: 0
2: 3
3: 67
4: 692
977480955_977480957 -9 Left 977480955 4:97574736-97574758 CCTTTCTGCTTCTGTGGATTTTT 0: 1
1: 1
2: 7
3: 72
4: 713
Right 977480957 4:97574750-97574772 TGGATTTTTAACTTTCTTTCGGG No data
977480955_977480958 27 Left 977480955 4:97574736-97574758 CCTTTCTGCTTCTGTGGATTTTT 0: 1
1: 1
2: 7
3: 72
4: 713
Right 977480958 4:97574786-97574808 TATGCTAAGATGCCATATTTTGG No data
977480955_977480959 28 Left 977480955 4:97574736-97574758 CCTTTCTGCTTCTGTGGATTTTT 0: 1
1: 1
2: 7
3: 72
4: 713
Right 977480959 4:97574787-97574809 ATGCTAAGATGCCATATTTTGGG 0: 1
1: 12
2: 101
3: 290
4: 621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977480955 Original CRISPR AAAAATCCACAGAAGCAGAA AGG (reversed) Intronic
901987556 1:13088126-13088148 AAAAACCAAAAGAAACAGAAAGG + Intergenic
901994256 1:13138641-13138663 AAAAACCAAAAGAAACAGAAAGG - Intergenic
902309355 1:15568987-15569009 TAAAATCGACAGAGGCAGAAAGG - Exonic
902326997 1:15707591-15707613 CAAAATCCACATGAACAGAAAGG + Intronic
902345840 1:15816796-15816818 ATAAATCCCCGGAGGCAGAATGG + Intergenic
902541622 1:17159582-17159604 GAACACCCACAGAGGCAGAATGG + Intergenic
902741153 1:18439262-18439284 AAAAATCAAAAGATTCAGAAAGG - Intergenic
903166556 1:21524519-21524541 AAAAATGAATAGAAGCACAAAGG + Intronic
904596038 1:31646031-31646053 AGAAATACAGAGTAGCAGAAGGG - Intergenic
904919048 1:33992365-33992387 AAAAATACAAAGAAGTAGAAGGG - Intronic
904971788 1:34424845-34424867 GTAAATCCACAGAATCATAAAGG + Intergenic
905277387 1:36827309-36827331 AAATATCCACAGAAGCCCCAGGG - Intronic
905595665 1:39204531-39204553 AAAAAGTCACAGAAGCATTAGGG - Intronic
906357972 1:45124524-45124546 AACAACCCACAGAAAAAGAAAGG + Intronic
906862623 1:49378146-49378168 AAAAATCCTCACACTCAGAAGGG - Intronic
907007186 1:50927050-50927072 TCAAACTCACAGAAGCAGAAAGG + Intronic
907029392 1:51155794-51155816 CAAATTCCAAAGAAGCTGAAAGG + Intergenic
908427405 1:64020747-64020769 AAAGACCCACAAAAGAAGAAAGG + Intronic
908681518 1:66667026-66667048 AAAAATCCAGACAAGGAAAAGGG + Intronic
908909632 1:69058312-69058334 AGAAATCCACAGCAGCAGCAAGG - Intergenic
909146804 1:71944705-71944727 AAAGATCAACATAAGCAGATGGG - Intronic
910166490 1:84333684-84333706 AAGAATCCAAATAAGAAGAAAGG - Intronic
910527397 1:88196764-88196786 AAAAATACAAAGAAGCTGAAAGG - Intergenic
910797964 1:91117575-91117597 AGAAAACAGCAGAAGCAGAAGGG + Intergenic
910812295 1:91251138-91251160 AATATGCCAAAGAAGCAGAAGGG + Intergenic
911627861 1:100146411-100146433 ACAAAGCCACATATGCAGAAAGG - Intronic
911960150 1:104291668-104291690 AAAAATCCATAGCACCAGCATGG - Intergenic
911975458 1:104489046-104489068 AAGAATCAAAAGAAGCAAAATGG - Intergenic
912100964 1:106204044-106204066 ATAAATAAATAGAAGCAGAATGG + Intergenic
912226970 1:107744993-107745015 AAAAATTCATAAAAGCACAATGG + Intronic
912360309 1:109089761-109089783 AAAAATTCACACAAGCAAACGGG + Intergenic
912602776 1:110954766-110954788 AAGAATGCACAGAAACAGAGTGG - Intronic
913383593 1:118235375-118235397 AAAAATGCAGAATAGCAGAATGG + Intergenic
913941224 1:125108860-125108882 AAAAATACACAGAAGACTAAGGG + Intergenic
913956111 1:143295617-143295639 AAAAATACACAGAAGAGTAAGGG - Intergenic
913981321 1:143519823-143519845 AAAAATACACAGAAGAGTAAGGG + Intergenic
914000906 1:143693422-143693444 AGTAAACCACAGAAGCAGGAAGG + Intergenic
914075693 1:144346478-144346500 AAAAATACACAGAAGAGTAAGGG + Intergenic
914103485 1:144620018-144620040 AAAAATACACAGAAGAGTAAGGG - Intergenic
914198233 1:145461634-145461656 AGTAAACCACAGAAGCAGGAAGG + Intergenic
914377153 1:147081381-147081403 AGAAAACAACAGAAGCAGGAAGG + Intergenic
914477336 1:148034763-148034785 AGTAAACCACAGAAGCAGGAAGG + Intergenic
916682186 1:167114741-167114763 AAAAATCCCCCAAAGCAGATGGG - Intronic
916755959 1:167770626-167770648 TAAGATACACAGAAGCACAAAGG - Intronic
916898220 1:169190204-169190226 AAAAATCAACAGTAGGGGAATGG + Intronic
916932547 1:169593891-169593913 ATAAATCCACTGCAACAGAATGG + Intronic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917316832 1:173734626-173734648 AATAATCCACATAATCAGGAAGG - Intronic
917341756 1:173986721-173986743 AAAAATACACAGAATCAGCCAGG - Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917670623 1:177270270-177270292 AAAAACCCACAGAGTGAGAAAGG - Intronic
917677341 1:177332457-177332479 AAAAATCCACAGCTGAATAATGG - Intergenic
918616652 1:186551558-186551580 AAAAAACAACAGAGGAAGAAAGG - Intergenic
918972311 1:191435112-191435134 AAAAATACAGAGTAGCAGAGTGG + Intergenic
919566153 1:199191389-199191411 AAAAATCCACACAAGGACTATGG + Intergenic
920724937 1:208426204-208426226 AAAAATTCACTGAAGCAAATGGG + Intergenic
920890966 1:209985443-209985465 AAAAAGCCACAGGGGCAGAGTGG - Intronic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
921523727 1:216190834-216190856 AAAAAGTCACAGAAGAAAAAGGG + Intronic
921704337 1:218304425-218304447 CAAACTGTACAGAAGCAGAAGGG - Intronic
921778434 1:219130886-219130908 AAGAATTCACTGAAGCAGTAGGG + Intergenic
922453265 1:225753760-225753782 AAAAATACAAAAAAGCAGCAGGG - Intergenic
923082494 1:230671885-230671907 AAAAGTGCAGAGAAGAAGAAAGG - Intronic
923120393 1:230984701-230984723 AAGAATCAAAAGAAGCAAAATGG + Intronic
923227858 1:231955962-231955984 AGAAAACAGCAGAAGCAGAAAGG + Intronic
923260947 1:232267534-232267556 AAAAATCGACTGAGGCAGACTGG + Intergenic
924133530 1:240938187-240938209 AAAAATCCACAGATGTGGGAGGG - Intronic
924142419 1:241039410-241039432 AATCAGACACAGAAGCAGAATGG + Intronic
924219753 1:241861794-241861816 CAAATGCCACAGAAGCCGAACGG - Intronic
924330824 1:242938757-242938779 AAAAAAACAAAGAAGAAGAAAGG + Intergenic
1063160648 10:3415853-3415875 AAAAGTCAAGAGAAGGAGAAGGG - Intergenic
1063164548 10:3448323-3448345 TTAAATTCATAGAAGCAGAAAGG - Intergenic
1063423323 10:5931709-5931731 ATAAAACCACAAAAGCAAAAAGG - Intronic
1064007596 10:11710886-11710908 TCAAATTCACAGAAACAGAAAGG + Intergenic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1066155687 10:32675044-32675066 AAAGATACAGAGAAGCTGAAAGG - Intronic
1066782030 10:38961410-38961432 AAAAATACACAGAAGTGTAAGGG + Intergenic
1067251624 10:44591607-44591629 ACAAGGCCACAGATGCAGAAAGG - Intergenic
1067896378 10:50184723-50184745 AAATAACCACTGAAGCACAAGGG - Exonic
1067952597 10:50757304-50757326 AAATAACCACTGAAGCACAAGGG + Intronic
1068191365 10:53656844-53656866 GAAAAACCACATAAGAAGAAAGG + Intergenic
1068525518 10:58125019-58125041 GAAAATCCATAGAAAAAGAAAGG + Intergenic
1068621953 10:59195642-59195664 AGAAAACAACAGAAGCAGGAAGG - Intronic
1068760293 10:60700082-60700104 AAAAGTCCCCAGAAGCTGACTGG - Intronic
1068824957 10:61426225-61426247 AAAAATCCACAGAGACATAAAGG + Intronic
1069031841 10:63604711-63604733 TAAAATCTAGGGAAGCAGAATGG + Intronic
1070028869 10:72657684-72657706 AAAAAATCACTGAATCAGAAAGG - Intergenic
1070053328 10:72910353-72910375 AAAAATACACAGATGTATAATGG + Intronic
1070183495 10:74037401-74037423 AAAGATCTACAGAAGCAGAAAGG - Intronic
1070949155 10:80417134-80417156 AAGAATCAAAAGAAGCAAAATGG + Intronic
1071130364 10:82385247-82385269 AACAACCTACAGAAACAGAACGG - Intronic
1071410945 10:85394765-85394787 AGAAATCCGAAGAAGCAGAGTGG - Intergenic
1071759702 10:88587371-88587393 TAAAATCAACAAAAGCAGAGAGG + Exonic
1073409307 10:103326554-103326576 AAAATTCCTCAGAAGAAAAATGG - Exonic
1073723102 10:106197612-106197634 AAAAAACAACAGAAGGAAAATGG - Intergenic
1074153336 10:110778073-110778095 CAAATTCAACAGCAGCAGAATGG - Intronic
1074256579 10:111808650-111808672 AAAAATACCTAGAAGCAGAATGG + Intergenic
1075169984 10:120104239-120104261 GAAAAGCCACAGGAACAGAAAGG - Intergenic
1075377430 10:121990101-121990123 AAAAATCCACAGAAGGTTGAAGG - Intronic
1075634089 10:124018634-124018656 AGAAAACAGCAGAAGCAGAAAGG - Intronic
1076019743 10:127062818-127062840 AAAGATCCACTGAAGCATGAAGG - Intronic
1076243774 10:128930375-128930397 AAAAATGCACAGTGGCAGATTGG - Intergenic
1076358727 10:129871375-129871397 AGACATCCACAGCAGCAGCAGGG + Intronic
1077386867 11:2273555-2273577 ATAAATTCACAGAGACAGAAAGG + Intergenic
1077547140 11:3178305-3178327 TAAAATGCCCAGGAGCAGAATGG - Intergenic
1078597870 11:12703958-12703980 TAAATTCCCTAGAAGCAGAATGG + Intronic
1079464540 11:20716343-20716365 AAAAATACACACAAGCACAAAGG + Intronic
1079779758 11:24586310-24586332 AAAACTAAACAGAAGCATAATGG - Intronic
1080058803 11:27934937-27934959 ACAAATCCACAGAAGCCGGAAGG + Intergenic
1080412649 11:32040397-32040419 AAAAATCAGCAGAAGCTGCATGG + Intronic
1081146634 11:39568906-39568928 TAAAATCAAGAGAAACAGAAAGG + Intergenic
1081199614 11:40200443-40200465 AGAAAACACCAGAAGCAGAAAGG + Intronic
1081244692 11:40750232-40750254 AAAAATCCACAGGACCAGATGGG + Intronic
1081301918 11:41463050-41463072 AGAAAATGACAGAAGCAGAAAGG + Intergenic
1081798495 11:45839830-45839852 AATAAGCCTCAGAACCAGAACGG - Intergenic
1082672801 11:56056288-56056310 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1082697967 11:56393920-56393942 AAAAATCCACAAAAGCCAGATGG - Intergenic
1083422458 11:62562163-62562185 AAGAATCAAAAGAAGCAAAATGG - Intronic
1084716558 11:70878006-70878028 AAGAATGCAGAGAAGCAGGAGGG + Intronic
1085603852 11:77879937-77879959 AAAAATCCCAAGAATCAGATAGG + Intronic
1085807634 11:79650890-79650912 ACTAATTCACAGAAGCAGAAAGG - Intergenic
1086513313 11:87584459-87584481 AGAAAATGACAGAAGCAGAAAGG + Intergenic
1086549485 11:88039610-88039632 AAAGATCCACTGACCCAGAAAGG + Intergenic
1086916467 11:92535106-92535128 AGAAAACTACAGAAGCATAAAGG - Intronic
1087257207 11:95969357-95969379 ACAAATCCATAGAGACAGAAAGG - Intergenic
1087303245 11:96459730-96459752 AAAAATCCATTGAAGGAGAATGG + Intronic
1087567286 11:99877561-99877583 AAAAATCCACTAAATCTGAATGG - Intronic
1088128593 11:106460106-106460128 GAAAAACCACAGAAGCATGAAGG + Intergenic
1088483094 11:110314663-110314685 AGAAATACATAGAAGCAAAAAGG - Intergenic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1089552080 11:119287357-119287379 AGAAATCCAAGGAGGCAGAATGG + Intronic
1089839321 11:121400719-121400741 AAAAATCTATAGAGACAGAAAGG - Intergenic
1089905890 11:122038152-122038174 AGAAAACCACAGAAGCAGAAAGG - Intergenic
1090123741 11:124062671-124062693 AAGAAACAACAGAAGCTGAAAGG - Intergenic
1090309154 11:125719584-125719606 AAGAATCAACTGAGGCAGAATGG + Intergenic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091448013 12:555281-555303 GAAAATCCACAGAGCTAGAAAGG - Intronic
1091787420 12:3251589-3251611 GAAATTCACCAGAAGCAGAACGG - Intronic
1091794431 12:3289506-3289528 AATATTCCACAGAAGCAAGAAGG + Intergenic
1092439396 12:8484866-8484888 TTTAATGCACAGAAGCAGAATGG + Intergenic
1092837113 12:12501040-12501062 AATAATTCACAGAAGCAGAATGG + Intronic
1094393921 12:29983739-29983761 AAAAAGTCAAAGAAGCAGAATGG + Intergenic
1094477407 12:30851883-30851905 AAAAACCCACAGACCCAGTAGGG + Intergenic
1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG + Intergenic
1095063233 12:37729618-37729640 AAAAATACACAGAAGCATTCTGG + Intergenic
1095582999 12:43821270-43821292 AAAAATACACATAAGCACATGGG + Intergenic
1095600578 12:44008643-44008665 GAAAAGCCACAGAAGAAGGAAGG - Intronic
1096327634 12:50678968-50678990 AAAAATCTACTGAAACATAATGG - Intronic
1098219438 12:68252971-68252993 AACAATGCACAGAGGCATAAAGG + Intronic
1098477499 12:70921659-70921681 ATAAAGACACAGAGGCAGAAAGG - Intergenic
1099526811 12:83726684-83726706 AAAAAGCCACAGACACACAATGG + Intergenic
1099881482 12:88472276-88472298 TAAAAATCACAGAAACAGAAAGG - Intergenic
1100716960 12:97316150-97316172 GAAAAACCACAAAAGCAGAAGGG - Intergenic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101186579 12:102287299-102287321 AAAAATACACTGAAGTACAAAGG - Intergenic
1101463846 12:104926669-104926691 AATAATTCACAGAAAAAGAATGG + Intronic
1101559386 12:105841492-105841514 AAAAGTCCATGGAAGAAGAAAGG - Intergenic
1102935908 12:116896878-116896900 AGAATTCCTCATAAGCAGAAAGG - Intergenic
1103464854 12:121133760-121133782 GCAAATCCATAGAGGCAGAAAGG - Intronic
1103602148 12:122061236-122061258 ACACATCCACAGAAACAGAGAGG + Exonic
1104563568 12:129860158-129860180 AAATGTCCACAGAGGCAGAGTGG - Intronic
1104930174 12:132334653-132334675 AAAAATACAGAAAAGCAGGAGGG - Intergenic
1105787034 13:23759775-23759797 GAAAACCCACAGGAGCAGCAGGG + Intronic
1106395869 13:29380345-29380367 CAAAATTCACAGTAGCACAAGGG - Intronic
1106839251 13:33669195-33669217 TATAATCCGCAGAAGCAGATGGG + Intergenic
1107115828 13:36744188-36744210 CAAAATCCAAAGAAGCTGAGTGG + Intergenic
1107670551 13:42742479-42742501 AGAAGTCCACAGAAGCAGCGTGG - Intergenic
1107731603 13:43354785-43354807 AAAAACCCACAGAAGCAGAAAGG - Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108363988 13:49691993-49692015 AAAAATCCAGAAAAGTAGAAGGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108834108 13:54519366-54519388 AAGAACCCTCAAAAGCAGAAAGG + Intergenic
1108983490 13:56551499-56551521 AGAAATACACAGAATAAGAAAGG - Intergenic
1109778223 13:67072182-67072204 AGAAAACCACAGAAGCAAAAAGG + Intronic
1109873123 13:68363656-68363678 AAAAATCCAGAGGAGGAGGAAGG + Intergenic
1110067439 13:71126548-71126570 AAAAAGACATAGAAGAAGAAAGG + Intergenic
1110393384 13:75001912-75001934 CAAAAATCACAGAAACAGAATGG - Intergenic
1110425083 13:75357863-75357885 AGAAATAAACAGAAGCAGGAGGG - Intronic
1110432210 13:75437281-75437303 AAAAATCCAACGAAGCATTAAGG + Intronic
1110441201 13:75527803-75527825 TCAAACTCACAGAAGCAGAAAGG + Exonic
1110593185 13:77287871-77287893 AAAAATGTACAAAAGCAGTAGGG - Intronic
1110769663 13:79326449-79326471 AAAAATCCACAAAATATGAAAGG + Intronic
1110804420 13:79737270-79737292 AAAGGTCCACAGAAGAAGTATGG + Intergenic
1110844585 13:80179795-80179817 AAAAAAGCACAGAAGCAGGAAGG + Intergenic
1110849030 13:80223305-80223327 AGAAAACTGCAGAAGCAGAAAGG + Intergenic
1110868949 13:80428305-80428327 ACAAAAACACAGAAGCAGGAAGG + Intergenic
1111116339 13:83782856-83782878 AAGAATCCACCAAAGAAGAAAGG + Intergenic
1111149910 13:84237679-84237701 AAAAATCCAGTCAAGCATAATGG + Intergenic
1111341168 13:86888393-86888415 AGAAAACAACAGAATCAGAAAGG + Intergenic
1111718237 13:91908729-91908751 AAACATCAATAGATGCAGAATGG - Intronic
1112016690 13:95337081-95337103 AAACTCCCACAAAAGCAGAATGG - Intergenic
1112280082 13:98055310-98055332 ATAAATCCTCAGGAACAGAAAGG + Intergenic
1112361129 13:98719572-98719594 GAAAATCCACAGAACCAAGAGGG - Intronic
1113308670 13:109107704-109107726 ATAATTCCAGAGAAGGAGAAAGG - Intronic
1114273097 14:21116374-21116396 AAAAATTCTTAGAAGCAGAATGG - Intergenic
1114338961 14:21723333-21723355 GAAAATGCACAGAAAAAGAAAGG - Intergenic
1114791343 14:25661917-25661939 AAAAATCACTAGAAGAAGAATGG - Intergenic
1115066089 14:29261988-29262010 AGAAATTCACAGCATCAGAAAGG - Intergenic
1115622978 14:35159031-35159053 AGAAATCCACAGAAGAACCACGG + Intronic
1116596319 14:46851364-46851386 ACAATTCCAAAGAAGCAAAATGG - Intronic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG + Intergenic
1117096822 14:52307073-52307095 AACAATGCACAGAAGAAAAATGG + Intergenic
1117909310 14:60621419-60621441 AAAAAGAAACAGAAGAAGAAAGG + Intergenic
1118546088 14:66890777-66890799 AATATACCACAGTAGCAGAATGG + Intronic
1118757455 14:68855291-68855313 AGAAAACCACAGAAGCAAGAAGG - Intergenic
1118857023 14:69631478-69631500 AACAAAAAACAGAAGCAGAAGGG - Intronic
1118924719 14:70181645-70181667 ACAAATGCACAAAAGCAGAAAGG + Intronic
1118940323 14:70329735-70329757 AAAAATCCATAGAGGTAAAAAGG + Intronic
1119034946 14:71221717-71221739 AAAAATCCAAGGAAGCTGAGAGG - Intergenic
1119566242 14:75631551-75631573 CAGAATCCACAGAAAAAGAAAGG - Intronic
1120074895 14:80145097-80145119 AAAAAACTAAAGAAGAAGAAGGG + Intergenic
1120243975 14:81983957-81983979 AAAAACCCAAGGAAGCTGAAAGG + Intergenic
1120470404 14:84916722-84916744 AAAAATGGAGAAAAGCAGAAGGG - Intergenic
1120531495 14:85637767-85637789 AGACATCCACAGAAGCGCAAAGG - Exonic
1120908219 14:89639910-89639932 AAAAATCCCCAGCACTAGAACGG - Intronic
1120967432 14:90180157-90180179 AAAAAACTACAGAAGCTGAGTGG - Intronic
1123153983 14:106207022-106207044 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1202938618 14_KI270725v1_random:119145-119167 AAAAATACACAGAAGAGTAAGGG - Intergenic
1123435727 15:20252882-20252904 TCAAATTCACAGAAACAGAAAGG + Intergenic
1123452997 15:20385011-20385033 AAAAATCATCAGATGAAGAACGG - Intergenic
1123823829 15:24060955-24060977 AAAAATCCACAGAATAGGTATGG - Intergenic
1123926738 15:25120602-25120624 ACAAATCCACAGAACAAAAATGG - Intergenic
1124867857 15:33511109-33511131 AAAAATCCACCCAAGAAAAATGG - Intronic
1125025455 15:35024931-35024953 AAAAACCCAAAGAAGCAGTGAGG - Intergenic
1125060694 15:35419489-35419511 AAAAATATAGAGAGGCAGAATGG + Intronic
1125183061 15:36899086-36899108 AAAAATCCAGAGAGGCTAAATGG - Intronic
1125333722 15:38606883-38606905 AGGAAGCCGCAGAAGCAGAAAGG - Intergenic
1125538104 15:40454360-40454382 TCATCTCCACAGAAGCAGAAAGG - Intronic
1125772703 15:42181352-42181374 TCAAATTCATAGAAGCAGAAAGG + Intronic
1126123820 15:45277611-45277633 ATAAATCCATAGAGACAGAAGGG + Exonic
1126608466 15:50504571-50504593 CAAAATCCACAGATGCTCAAGGG - Exonic
1126630564 15:50730325-50730347 ACAAATGGACAGAAGCAAAAAGG + Intronic
1127559593 15:60122710-60122732 AGAAAACTGCAGAAGCAGAAAGG + Intergenic
1127970149 15:63952264-63952286 AAAGAACAACGGAAGCAGAAAGG + Intronic
1128682526 15:69662231-69662253 CAAGTTCCTCAGAAGCAGAATGG + Intergenic
1129073592 15:72972597-72972619 ATAAATCCACAAGAGCAGAGGGG + Intergenic
1129094867 15:73195400-73195422 AAAAACACACAGACGCAGCATGG - Intronic
1129201826 15:74007253-74007275 GAAAACCAACAGACGCAGAAAGG - Intronic
1129409352 15:75340249-75340271 AAAAATAAACAGAAGTATAAAGG + Exonic
1130401719 15:83561946-83561968 AAAAATAGAGGGAAGCAGAATGG - Intronic
1131691719 15:94834558-94834580 GAAAACCCACAGAATCAGGAAGG + Intergenic
1133519564 16:6543852-6543874 AAAAACCAAAAGAAGAAGAAGGG + Intronic
1133724813 16:8527619-8527641 AAAAAGACACAGAACAAGAAAGG - Intergenic
1133810305 16:9156276-9156298 AAAAATCCCCAGGGGCAGAGTGG - Intergenic
1134117571 16:11560769-11560791 AGAAGGCCACAGAAGCAGGAGGG + Intronic
1134610258 16:15602591-15602613 AAAAAGACAAAGAAGAAGAAAGG + Intronic
1134630790 16:15754505-15754527 AAAAATCCACTGATGAAGTAGGG + Intronic
1136697231 16:32094252-32094274 AAAAATACACAGAAGACTAAGGG - Intergenic
1136700619 16:32136846-32136868 AAAAATACACAGAAGAGTAAGGG + Intergenic
1136767039 16:32790619-32790641 AAAAATACACAGAAGAGTAAGGG - Intergenic
1136797730 16:33037543-33037565 AAAAATACACAGAAGACTAAGGG - Intergenic
1136801110 16:33080082-33080104 AAAAATACACAGAAGAGTAAGGG + Intergenic
1136848871 16:33598098-33598120 TCAAATTCACAGAAACAGAAAGG - Intergenic
1136863299 16:33716009-33716031 AAAAATACACAGAAGACTAAGGG - Intergenic
1136947871 16:34677210-34677232 AAAAATACACAGAAGAGTAAGGG + Intergenic
1137085123 16:36110948-36110970 AAAAATACACAGAAGAGTAAGGG - Intergenic
1137221669 16:46458433-46458455 AAAAATACACAGAAGAGTAAGGG - Intergenic
1137407266 16:48199436-48199458 AAAAAGAAACAGAAGAAGAAGGG + Intronic
1138256571 16:55568982-55569004 TAAAAATCAGAGAAGCAGAATGG - Intronic
1138346186 16:56321686-56321708 AAAAAGCCACAAAGGCAGAGAGG + Intronic
1140100845 16:71915230-71915252 AAAAAGATAAAGAAGCAGAAGGG - Intronic
1140810354 16:78571145-78571167 GAAAATCCACTGAGGAAGAAAGG + Intronic
1141380948 16:83576200-83576222 ATAAATCCATAGAGACAGAAAGG - Intronic
1142244528 16:88963573-88963595 ACAAATCCACAGAGACAGAGTGG - Intronic
1203069434 16_KI270728v1_random:1052865-1052887 AAAAATACACAGAAGAGTAAGGG - Intergenic
1203110578 16_KI270728v1_random:1446748-1446770 TCAAATTCACAGAAACAGAAAGG - Intergenic
1203124789 16_KI270728v1_random:1564160-1564182 AAAAATACACAGAAGACTAAGGG - Intergenic
1142767659 17:2074811-2074833 AAAAAGCCAAAGAAGCAGGCAGG + Intronic
1143168066 17:4908636-4908658 AAAATTCCCCAGAACCTGAATGG + Intergenic
1143179745 17:4977121-4977143 CAAAGAGCACAGAAGCAGAAAGG + Exonic
1143674272 17:8419967-8419989 AAAAATCCAAAGACACAGACTGG + Intronic
1143721411 17:8813273-8813295 AAAAAACCTCAGGAGCAGATGGG + Intronic
1143859338 17:9876674-9876696 AGAAAATCACAGAAGCAGGAAGG - Intronic
1143929159 17:10402992-10403014 ACAAAAACACAAAAGCAGAAAGG - Intronic
1144861051 17:18302388-18302410 AAAAATCCTCTGAAGCCGCAGGG + Exonic
1144926933 17:18819467-18819489 AACAAACCAGAGAAGCATAAAGG + Intergenic
1145324142 17:21785231-21785253 AAAAATACACAGAAGAGTAAGGG - Intergenic
1145326465 17:21833562-21833584 AAAAATACACAGAAGAGTAAGGG + Intergenic
1145689455 17:26722728-26722750 AAAAATACACAGAAGACTAAGGG + Intergenic
1145834963 17:27947872-27947894 ACAAATTCACAGAAATAGAATGG + Intergenic
1146558958 17:33851511-33851533 AACAATCCACAACAGCAAAAGGG + Intronic
1146922238 17:36721441-36721463 AAAAATTTACAGAAATAGAAAGG - Intergenic
1147010019 17:37438140-37438162 AAAAATTCATAAAATCAGAAGGG - Intronic
1147116813 17:38306815-38306837 AGAAATTCCCAGAAGCAGAGAGG - Intronic
1148289257 17:46428981-46429003 ACAAAACTACAAAAGCAGAAAGG - Intergenic
1148311426 17:46646553-46646575 ACAAAACTACAAAAGCAGAAAGG - Intronic
1148329885 17:46807505-46807527 AAAAAGAAACAGAAGCAGACTGG + Intronic
1148412863 17:47482787-47482809 AGAAATTCCCAGAAGCAGAGAGG + Intergenic
1148682844 17:49484525-49484547 AAAGAACCAGAGAAGGAGAAAGG - Intergenic
1148841050 17:50497485-50497507 AAAAAAAAAAAGAAGCAGAAGGG + Intergenic
1149256149 17:54829000-54829022 ATAAAGTCACAGAAGGAGAATGG + Intergenic
1149554715 17:57565163-57565185 AAAAATCCTTAGATGCAGATGGG - Intronic
1149560540 17:57605061-57605083 AAATGGCAACAGAAGCAGAATGG - Intronic
1149709800 17:58730074-58730096 AAAAATTCACAGAAAAAGAGAGG - Intronic
1149999294 17:61423327-61423349 GAAAAGTCACAGAAACAGAAAGG + Intergenic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1150818575 17:68415962-68415984 AAAAATACAAAACAGCAGAATGG - Intronic
1151069240 17:71189479-71189501 AGAAATTTTCAGAAGCAGAAGGG - Intergenic
1151655124 17:75492265-75492287 AATAGTCCATAGAAGCAGACAGG + Intronic
1151924383 17:77183798-77183820 AAAGATAAACAGAAGCAGCAAGG - Intronic
1152063205 17:78094733-78094755 AAAGAACCACAGAAGCAGCCAGG - Intronic
1152762913 17:82118882-82118904 GAAAATACGCAGAAGTAGAATGG - Intronic
1203182717 17_KI270729v1_random:78692-78714 AAAAATACACAGAAGACTAAGGG + Intergenic
1153269802 18:3308799-3308821 AAATATTTACAAAAGCAGAAGGG - Intergenic
1153833133 18:8940675-8940697 GAATTTCCACAGAAGCAGGAAGG + Intergenic
1154000867 18:10481485-10481507 TCAAATCCACAGAGACAGAAAGG + Intronic
1154034330 18:10784867-10784889 TAAAATGCACACCAGCAGAAAGG + Exonic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1154516551 18:15173622-15173644 AAAAATACACAGAAGAGTAAGGG - Intergenic
1155816599 18:30318788-30318810 AAAAATTAAAAGAAACAGAAAGG + Intergenic
1156276518 18:35588692-35588714 AAAAAGACTCAGCAGCAGAAAGG - Intronic
1156276618 18:35589498-35589520 AAACATTAACAGAAGCAGAAGGG - Intronic
1156956425 18:42970527-42970549 AGAAAACCTCAAAAGCAGAAAGG + Intronic
1157013651 18:43682627-43682649 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1157823553 18:50791711-50791733 AGAAACACACAGAAGCAGAGAGG + Intergenic
1157838570 18:50932597-50932619 AAAAATGCAGAGGAACAGAATGG + Intronic
1158618870 18:59013060-59013082 AGAAATCCACAGTAGCAGCCAGG + Intergenic
1158730939 18:60021824-60021846 CAAAATCTACAGAAGTAAAATGG + Intergenic
1159305536 18:66637086-66637108 TAAAGTATACAGAAGCAGAAGGG - Intergenic
1159957319 18:74528828-74528850 ATAAATACACAGAAGCAACAAGG - Intergenic
1160079795 18:75714640-75714662 AAAAATACCCACAAGCAGATGGG + Intergenic
1161662524 19:5555731-5555753 CAAAAGCCACAGAAGCTGCAGGG - Intergenic
1162236383 19:9312901-9312923 AAAAACCCACAGACCCAGTAGGG + Intergenic
1162650838 19:12087782-12087804 AAAAATCAACAGAAAGAAAAGGG - Intergenic
1163519453 19:17783242-17783264 AAAAATCCCAGGAAGCAGAGAGG - Intronic
1164258007 19:23546153-23546175 AAGAATCCACAGAAGTACAAAGG - Intronic
1164341458 19:24405163-24405185 AAAAATACACAGAAGCATTCTGG + Intergenic
1164497616 19:28782560-28782582 AATAAACCAGACAAGCAGAAGGG - Intergenic
1164611152 19:29632523-29632545 AAAAAGCCACTGTCGCAGAAGGG - Intergenic
1165650971 19:37489714-37489736 AAATATCAACAGAAACAGGATGG + Intergenic
1166012282 19:39951336-39951358 AAGGATCCACAGTAGCAGAGAGG + Intergenic
1166382068 19:42360329-42360351 AAAAAACAGCAGAAGCAGAGAGG - Intronic
1166770822 19:45280982-45281004 GAAAAACCACACAAGCAGAGAGG - Intronic
1167017004 19:46847637-46847659 ACACATCCACAGAGACAGAAAGG - Intronic
1167124803 19:47542179-47542201 ACACATCCACAGAGACAGAAAGG + Intronic
1167282641 19:48579006-48579028 AAAAATCCATAGAAACAGAACGG - Intronic
1167980860 19:53273599-53273621 AGACATCCACAGAAGCAGGAAGG - Intergenic
1168249131 19:55131493-55131515 GCAAATCCACAGAAGTAGGAAGG - Intergenic
1168673119 19:58256501-58256523 AAGAATCAACAGAAGCAAAATGG + Intronic
1202683875 1_KI270712v1_random:31373-31395 AAAAAGCCACAGTGGCAGAGGGG - Intergenic
925165347 2:1712520-1712542 AAAATTCCAAACAGGCAGAAAGG + Intronic
925581184 2:5413287-5413309 AGAAAACCTCAGAAGCAGGAAGG + Intergenic
926347729 2:11963854-11963876 GAAAATGCACTGAAGAAGAAAGG + Intergenic
926374400 2:12212002-12212024 AAAAATCCATAGACACAGCAGGG + Intergenic
926490083 2:13514707-13514729 AAAAACCCAAAAAGGCAGAATGG - Intergenic
927505871 2:23614419-23614441 AAAAATTGACAGAACTAGAAGGG + Intronic
928620203 2:33081275-33081297 AAAAAACAGCAGAAGCAGGAAGG - Intronic
928698519 2:33875105-33875127 AAAAATCGACAAAATCAAAAAGG - Intergenic
929001078 2:37347396-37347418 AGAAAAGCACAGAAGAAGAAAGG - Intronic
929045920 2:37789609-37789631 AGAAATACACAGAATCATAAGGG - Intergenic
929634067 2:43498179-43498201 GCAAATCCACAGAGACAGAAAGG + Intronic
929894769 2:45949956-45949978 TAAAATTCACAGAAGAAAAATGG - Intronic
930917162 2:56706885-56706907 AAGAATCAACTAAAGCAGAAAGG - Intergenic
931032498 2:58194988-58195010 GAAAATACACAAAAGCAGAAAGG + Intronic
931182191 2:59914170-59914192 AAAAATCCACAGTGGAAGACAGG - Intergenic
931331629 2:61292008-61292030 GCAAATCCACAGAAACAGAAAGG + Intronic
931371269 2:61665350-61665372 AAAAATTAATAGAAGCAGGACGG + Intergenic
931547605 2:63406925-63406947 AGAAAACCACAGAAGCAGAAAGG - Intronic
931821909 2:65960757-65960779 AAGAAACCACAGAATCAGATTGG + Intergenic
932464676 2:71910262-71910284 ATAAACCCACAGACCCAGAAAGG + Intergenic
932867469 2:75359950-75359972 AAAAAGCCACTGTAGCAGAGCGG + Intergenic
933274929 2:80273587-80273609 ATAAACTCAGAGAAGCAGAATGG - Intronic
933284533 2:80371168-80371190 AGAAATCTGCAGAAGCAGAAAGG - Intronic
933766167 2:85711117-85711139 AAAACTCAACAGAGGCAGAGTGG - Intergenic
934064577 2:88329088-88329110 AAAAATCCCCAAAATAAGAAGGG + Intergenic
934252399 2:90369277-90369299 AAAAATACACAGAAGACTAAGGG - Intergenic
934257042 2:91433668-91433690 AAAAATACACAGAAGACTAAGGG + Intergenic
935345788 2:102106997-102107019 ATAAATCCCCAGAGGTAGAATGG + Intronic
935403387 2:102683552-102683574 AAGAATCCACAACAGCAGAAAGG - Intronic
936040200 2:109143935-109143957 AACAAGCCACAGACACAGAAAGG + Intronic
936082426 2:109442329-109442351 AAAAATCCACACTATTAGAAAGG + Intronic
936472149 2:112808732-112808754 AACAACCCAAAAAAGCAGAAAGG - Intergenic
936476002 2:112840387-112840409 AAATAATCCCAGAAGCAGAAGGG - Intergenic
936735708 2:115440683-115440705 AAGAATCAAAAGAAGCAAAATGG + Intronic
936801173 2:116268588-116268610 AAGAATCAAAAGAAGCAAAATGG - Intergenic
937295807 2:120809312-120809334 ACAAATCCATAGAGACAGAAGGG + Intronic
937613414 2:123891664-123891686 AAAAATCCTAAAAAGCAGCAAGG - Intergenic
937866451 2:126754733-126754755 TAAAATCATCACAAGCAGAAAGG - Intergenic
937889179 2:126923435-126923457 AAAAATACACAGAAAGAAAAGGG - Intergenic
938340217 2:130530975-130530997 AAAAATCAACAAAAGCATATAGG - Intergenic
938349619 2:130589773-130589795 AAAAATCAACAAAAGCATATAGG + Intergenic
939195968 2:138972646-138972668 AAAACTCCACAGAAGTCTAATGG - Intergenic
939279688 2:140046843-140046865 TAAAATTCACAGAAGAATAAAGG - Intergenic
940034115 2:149295366-149295388 AGAAAATCACAGAAGCAGGAAGG - Intergenic
940184519 2:150968710-150968732 AGAAAACAACAGAGGCAGAAAGG + Intergenic
940235513 2:151507375-151507397 AAAAAACAGCAGAAGCAGGAGGG + Intronic
940431394 2:153593859-153593881 AAGATTTCAAAGAAGCAGAAAGG - Intergenic
940515814 2:154682714-154682736 AGAAAACCACAGAAGCAGGAAGG - Intergenic
941073305 2:160979132-160979154 AAAAATCCCAAGAAGCAGTTAGG - Intergenic
941799683 2:169644662-169644684 CAAAATTCACAGAAACAGAATGG + Intergenic
941866534 2:170340811-170340833 AGAAAACCACAAAAACAGAAAGG - Intronic
943033226 2:182710545-182710567 TAAAACTCACAGAAGCAGAGAGG - Intergenic
943288532 2:186038008-186038030 AAAAATATACAGAATCATAATGG - Intergenic
943392022 2:187282075-187282097 AAAAAACCAAAGAAATAGAATGG - Intergenic
943432413 2:187820425-187820447 AAAAATCATCAGAATTAGAAGGG + Intergenic
943771957 2:191727651-191727673 GAAAAACCACAGAGGCAGGAAGG + Intergenic
944422248 2:199544002-199544024 AGAAAACCACAGAAGCAGGAAGG + Intergenic
945117671 2:206424958-206424980 AAAAATGCAGAAAAGTAGAAAGG + Intergenic
945216688 2:207441860-207441882 AGAAAACAACAGAAGCAGGAAGG + Intergenic
945777133 2:214119132-214119154 AAAGATTCACAGAAACAGATAGG + Intronic
945924920 2:215793522-215793544 AGAAAGCCACAGAAGCAAGAAGG - Intergenic
946380951 2:219348606-219348628 AAGCATCCACACAGGCAGAAAGG + Intergenic
946723661 2:222639432-222639454 AAAAATCTGCAGAGGAAGAAAGG + Intronic
947506997 2:230715072-230715094 AAAAATACACAGAAAAAGACTGG - Intronic
947592482 2:231393592-231393614 ACAAAGCCCCAGAAGCACAAGGG - Intergenic
1168774958 20:439728-439750 ACAAATCCACAGATGCTCAAGGG + Intronic
1169037530 20:2465792-2465814 AGAACTCCAAACAAGCAGAAAGG - Exonic
1169084544 20:2818582-2818604 AGAAATACAAAGAAACAGAAAGG - Intronic
1169684984 20:8261113-8261135 AAAGATCAAGAGAAGCAGAAGGG - Intronic
1169863711 20:10177498-10177520 AAAAGACCACAGAGGCAAAATGG + Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1170444472 20:16411732-16411754 AAAGATACACTGAAGCTGAAGGG + Intronic
1170487911 20:16838541-16838563 AAAATTCTACAGAAGCAGCAAGG - Intergenic
1170588924 20:17756408-17756430 TAACAGCCAGAGAAGCAGAAGGG + Intergenic
1170706961 20:18752678-18752700 AAAGATCCCCAGAATCAGACTGG - Intronic
1170882643 20:20310750-20310772 CAAAATCCACACCAGCAAAATGG + Intronic
1172352797 20:34256421-34256443 AAAAACCCACAGACCCAGTAGGG + Intronic
1172876367 20:38166721-38166743 AAATATCCACTGAAGCAACACGG - Intergenic
1172955827 20:38757904-38757926 AAAAACCAAGAGAAGCAAAATGG - Intronic
1173466805 20:43289766-43289788 AAAATGCCAAAGAAGGAGAAAGG - Intergenic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1173584032 20:44168305-44168327 AAAAATTCACACAAAAAGAATGG + Intronic
1173743265 20:45417429-45417451 AACAATCCATAGAAGCTGAGTGG - Intronic
1174312859 20:49672637-49672659 CCAAGTCCACAGAAACAGAAGGG + Intronic
1174426697 20:50436685-50436707 AAAAATCCCCAGAAACATACAGG - Intergenic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1174753612 20:53136801-53136823 AAAAATCTACTGAGGAAGAAGGG + Intronic
1174860758 20:54088920-54088942 AAAATTCCACATGAGCAGAGAGG - Intergenic
1175213940 20:57380163-57380185 AAACATCCACAAAAGTGGAAAGG + Intergenic
1175464074 20:59177903-59177925 CAGAAGCCACAGAAACAGAAAGG + Intergenic
1175698888 20:61123335-61123357 AAAAACACACAGAAGCATCAGGG + Intergenic
1176318279 21:5274345-5274367 AAAACTACACAGAAGCATTATGG - Intergenic
1176584697 21:8569988-8570010 AAAAATACACAGAAGAGTAAGGG + Intergenic
1176669779 21:9722441-9722463 AGAAAACCACAGACGCAGGAAGG + Intergenic
1177181195 21:17746265-17746287 AGAAAACCACAGAAGTAGAAAGG - Intergenic
1177452096 21:21282545-21282567 AAAAATACATACAAGCAGAGTGG - Intronic
1177489031 21:21797417-21797439 AGAAAACAACAGAAGCAGCATGG - Intergenic
1178082656 21:29080814-29080836 CAAAAACCACTCAAGCAGAAGGG - Intronic
1178233063 21:30809533-30809555 AGAAAGATACAGAAGCAGAAGGG + Intergenic
1178385347 21:32144452-32144474 AGAAAACAGCAGAAGCAGAAAGG + Intergenic
1179249801 21:39663389-39663411 AAGAACACACAGAAGCAGTAGGG - Exonic
1179434987 21:41355632-41355654 GAAAATCCACAGAGTCAGAAAGG + Intronic
1180028518 21:45184311-45184333 AAAAATGCACTGAAGCAAATAGG - Intronic
1180078713 21:45476223-45476245 AAAAATCCTCTGAAACAGGAGGG - Intronic
1180267508 22:10546890-10546912 AAAAATACACAGAAGAGTAAGGG + Intergenic
1181170949 22:21009685-21009707 AGAAATACACAGAAGAAAAACGG + Intergenic
1181507202 22:23367617-23367639 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1181640924 22:24198005-24198027 AGAAATTCACAGAAGTAGATTGG + Intergenic
1182021583 22:27086096-27086118 AAACATACACAAAAGTAGAAAGG + Intergenic
1182170875 22:28228160-28228182 ACAAATTCACAGAGACAGAAAGG + Intronic
1182440561 22:30361491-30361513 AAAAAACTGCAGAAGCAGGAAGG - Intronic
1182526707 22:30924984-30925006 TAACATCCACAGAAACAGACTGG - Intergenic
1182885012 22:33766086-33766108 AGAAATCAACACAAGAAGAACGG + Intronic
1183445939 22:37854989-37855011 AAAGAGCCAGAGAAGCAGGAGGG + Intronic
1185300218 22:50075720-50075742 AAAAAAAAAAAGAAGCAGAACGG + Intronic
1203325750 22_KI270738v1_random:14755-14777 AAAAATACACAGAAGACTAAGGG - Intergenic
950053190 3:10007483-10007505 AAGAAACCATCGAAGCAGAAAGG - Intronic
950380121 3:12606064-12606086 CAAGTTCCACAGAAGCAGCAAGG + Intronic
950415814 3:12868695-12868717 AAAAACCCACAGACCCAGTAGGG + Intronic
952056349 3:29451548-29451570 CAAAATCCTCATAAGTAGAAGGG - Intronic
952591249 3:34956837-34956859 AAAAATCATCAGAATCAAAATGG - Intergenic
952659999 3:35834008-35834030 AAAAGGCCACAGAAGGAAAAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953485497 3:43290720-43290742 AAAAATCCTGAGCAGGAGAATGG - Intronic
955702621 3:61697046-61697068 AGAAAACAGCAGAAGCAGAAAGG + Intronic
956014520 3:64867525-64867547 AAAAAGCCGCAGAAGCAGGAAGG - Intergenic
956138597 3:66123481-66123503 AGAAAACCACAGAAGCAAGAAGG + Intergenic
956150758 3:66239954-66239976 AAAGCTCCTAAGAAGCAGAAAGG - Intronic
956230832 3:67014456-67014478 TAAAATCCACAGAAGCGTAGGGG + Intergenic
956411989 3:68989138-68989160 TAAAATCCATACAAGCAAAATGG + Intronic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
957134731 3:76271700-76271722 AAAGAGCCAGAGAAGCAGGAGGG - Intronic
957177276 3:76827890-76827912 ACATAACCACTGAAGCAGAAAGG + Intronic
957261283 3:77905258-77905280 AGAAAACAGCAGAAGCAGAAAGG - Intergenic
957632499 3:82735331-82735353 AAAAATACACAAATGCATAAAGG - Intergenic
957990971 3:87627344-87627366 TAAAATCCACAGCAGCAGAAAGG + Intergenic
958559883 3:95733579-95733601 AGTAAACCACAGAAGCAAAAAGG - Intergenic
958656383 3:97008842-97008864 AGAAAACCAAACAAGCAGAAAGG - Intronic
958790629 3:98646866-98646888 AGAAAACCACAGGAGCAGGATGG + Intergenic
959008964 3:101051985-101052007 ATAAAACCAAAAAAGCAGAAAGG + Intergenic
959134571 3:102400788-102400810 AAAAATACAAAGAGGAAGAATGG + Intronic
959157495 3:102684644-102684666 AGAAAGCAGCAGAAGCAGAAAGG + Intergenic
959313529 3:104772703-104772725 AAGATCCCACAGAAGCAGAGAGG + Intergenic
959480721 3:106869048-106869070 AGAAAACTGCAGAAGCAGAAAGG + Intergenic
959564901 3:107824263-107824285 AGAAAACTGCAGAAGCAGAAAGG - Intergenic
959620310 3:108392842-108392864 GAAAATCCACACAGGTAGAAAGG - Intronic
959801114 3:110496091-110496113 AAAATTCCAAAAAAACAGAATGG + Intergenic
960931694 3:122857654-122857676 TAAAAGCTAAAGAAGCAGAAGGG + Intronic
961338552 3:126201021-126201043 TAAAATACACAGAAGTGGAATGG - Intergenic
961955959 3:130804470-130804492 AAATGCCCACAGAAGCAGACAGG - Intergenic
962218079 3:133540102-133540124 CAAAATCCCCAGAGGCAGAGGGG - Intergenic
962443467 3:135444361-135444383 AATAATCCACAGGTTCAGAAGGG - Intergenic
962614781 3:137114172-137114194 AGAAAACTGCAGAAGCAGAAAGG - Intergenic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963309808 3:143697357-143697379 AAAAATGCAGAAAAGCAAAAAGG - Intronic
964848712 3:161070771-161070793 AAAACTCTACAGCAGCAGGAGGG - Exonic
964936763 3:162098664-162098686 AAAAATCCAAACAAGAAGAAAGG - Intergenic
965434614 3:168633725-168633747 AAAATTCCATCTAAGCAGAAAGG + Intergenic
966026914 3:175295390-175295412 AAAAAAACACAGAAGTAGAAAGG - Intronic
966504518 3:180684627-180684649 AAAATTCCAAATAAACAGAAAGG + Intronic
967686617 3:192424382-192424404 AAAAATACATAGGAGCTGAAAGG + Intronic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968517583 4:1021331-1021353 TGAAACCCACAGGAGCAGAAAGG - Intronic
968643964 4:1729276-1729298 AAAAACCCACAGACCCAGTAGGG - Intronic
969359463 4:6653285-6653307 GTAAATCCACAGAGACAGAAAGG + Intergenic
969464487 4:7347661-7347683 ACAAATCCACAGGATCAGAATGG - Intronic
969617421 4:8261903-8261925 AAGAATCCACGGAAGTGGAAAGG + Intergenic
970011988 4:11469308-11469330 AAAAAACCACAGGCCCAGAAAGG - Intergenic
970547613 4:17145733-17145755 AGGAAACCACAGAAGCAGGAAGG - Intergenic
970697796 4:18697942-18697964 AAAAAAAAACAGAAGCAGAAAGG - Intergenic
971040114 4:22742563-22742585 CTAAATACCCAGAAGCAGAATGG + Intergenic
971052893 4:22881123-22881145 AAGAATCCACAAAAACAGCAGGG - Intergenic
971154939 4:24071701-24071723 AAAAATCCTGAGAAGCAGTACGG + Intergenic
971630225 4:28982236-28982258 ACAAACTCACAGAAGCAGAGAGG + Intergenic
972505343 4:39715465-39715487 AAAAATACAAAAAAGCAGACGGG - Intronic
972974433 4:44616338-44616360 AAATATTCACGGAAGCTGAAGGG - Intergenic
973140581 4:46763509-46763531 AGAAATGGTCAGAAGCAGAATGG - Intronic
974396436 4:61342155-61342177 AAAAACCCTCAGCAGCAGCAAGG - Intronic
974434952 4:61844843-61844865 ATAAATACACAGTAGCAGAAGGG - Intronic
974694822 4:65352770-65352792 AAAAATGCAGAGAAGTAGAAGGG - Intronic
975409152 4:74027917-74027939 AAAAATATACAGAATCATAATGG - Intergenic
975767096 4:77680488-77680510 GAAAAGCCACAGAAGTAGAAGGG - Intergenic
975899285 4:79131409-79131431 AAAAATTAACAGAAACACAAAGG + Intergenic
975914499 4:79308075-79308097 AAAAATTAAAAGAAGAAGAAGGG + Intronic
976575350 4:86663561-86663583 AGAAAACCACGGAAGCAGGAAGG - Intronic
977161183 4:93638173-93638195 ATAAAATGACAGAAGCAGAATGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977581895 4:98734712-98734734 TGAAAACCACAGAAGCAGAAAGG + Intergenic
978062940 4:104360571-104360593 AAAAATGCTCAGAAACAGAAAGG + Intergenic
978171397 4:105675059-105675081 ATAAATCCACAGGAACAGAATGG - Intronic
979584115 4:122394715-122394737 AAATGTACACAGAAGCTGAAAGG - Intronic
979815983 4:125104632-125104654 AAAAATAAACAGCTGCAGAAAGG + Intergenic
979964198 4:127057922-127057944 GAAAAACCACATAACCAGAAAGG + Intergenic
980164395 4:129207909-129207931 TAAGAGACACAGAAGCAGAAGGG + Intergenic
980198857 4:129627497-129627519 GAAAAAGTACAGAAGCAGAAAGG + Intergenic
980407786 4:132375994-132376016 AAAATCCCAAAGAAGCAGGAGGG + Intergenic
982860882 4:160447554-160447576 AAGAGTCCAAAGAAGCAGTATGG - Intergenic
983116107 4:163818403-163818425 AAAATTCCACAGAATCAACAAGG - Intronic
984738148 4:183130758-183130780 ACAAATCCAGAGAAGCAGACAGG - Intronic
984994649 4:185417746-185417768 AAAAATCAACAGAACCAGCCGGG + Intronic
985310135 4:188588724-188588746 AGAAAACAACAGAAGCAGGAAGG - Intergenic
985405003 4:189629079-189629101 AGAAAACCACAGAAGCAGGAAGG - Intergenic
985861622 5:2476024-2476046 AAAACTCAGCAGAAGCAGAGGGG + Intergenic
986547655 5:8916394-8916416 AACTATGCACAGAAGTAGAAAGG - Intergenic
986981602 5:13454146-13454168 AAAAATCCACTGAAGCCCAGGGG - Intergenic
987147606 5:15007620-15007642 AATCATCCACAGTTGCAGAAAGG - Intergenic
988161112 5:27519179-27519201 AAAAATCTAGAGAACCAGTATGG - Intergenic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
989250010 5:39302158-39302180 AAAATTCCACAGGAGGACAAAGG + Intronic
989822095 5:45805515-45805537 AAAAATCAACACAAGCAAGATGG - Intergenic
989989042 5:50739519-50739541 ATTAATCCAAATAAGCAGAAAGG + Intronic
990087085 5:51992466-51992488 AGAAATCCATAGAAACAGAAAGG + Intergenic
990563876 5:57009714-57009736 GCAAATCCACAGAGTCAGAAAGG - Intergenic
990567760 5:57046962-57046984 AGAAAACAACAGAAGCAGGAAGG + Intergenic
991294606 5:65067162-65067184 AAAAAGCCACAAAAGCACTAAGG + Intergenic
991300457 5:65124570-65124592 TAAAAAGCTCAGAAGCAGAAAGG + Intergenic
991449700 5:66738821-66738843 AAAAGTTCAAAGAAGAAGAAAGG - Intronic
991961349 5:72047615-72047637 GAAGATCCAAAGAAGCAGATAGG - Intergenic
993483975 5:88459481-88459503 TAAAATGCAGAGAAGCACAAAGG - Intergenic
993724548 5:91352920-91352942 AAAAGGCCTTAGAAGCAGAATGG - Intergenic
994505493 5:100638651-100638673 AGAAAACAACAGAAGCAGGAAGG + Intergenic
995023015 5:107387146-107387168 AAACATGCAGAGAAGAAGAAAGG + Intronic
995477876 5:112566015-112566037 AGAAAACAACAGAAGCAGGAAGG + Intergenic
995871106 5:116744185-116744207 AAAAATACAGAGAAGTAGACAGG + Intergenic
996020932 5:118589849-118589871 AAAAAACCAAAAAAGCAGGATGG + Intergenic
996208993 5:120781598-120781620 AGAAAACCACAGAAGCAGGAAGG - Intergenic
996442104 5:123502985-123503007 AGATATCCATAGAAGTAGAAAGG + Intergenic
997036086 5:130193658-130193680 ATAAAACCACAAAAGGAGAAAGG - Intergenic
998880000 5:146636009-146636031 AGAAATCCAAAGAAAGAGAAGGG - Intronic
999214844 5:149923932-149923954 TATCATCCAGAGAAGCAGAAGGG + Intronic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
1000302297 5:159967088-159967110 AATACTCCACTTAAGCAGAAGGG - Intronic
1001148085 5:169202539-169202561 AAAAAGTTAGAGAAGCAGAATGG - Intronic
1001287932 5:170437319-170437341 AGAAAACCACAGAAGAAGGAAGG - Intronic
1002856139 6:1039831-1039853 TGAAAACCACAGAAGCAGAGAGG - Intergenic
1003245986 6:4382645-4382667 GAAAATCTGCAGAAGCAGATTGG + Intergenic
1003910246 6:10737031-10737053 AAAAAAACAAACAAGCAGAAAGG - Intergenic
1003988444 6:11461499-11461521 AAAACTCCCCAGCAGCAGACAGG + Intergenic
1004294527 6:14398111-14398133 AAAAATCCACAGCAGTATCATGG - Intergenic
1004320761 6:14629910-14629932 AAAAAGCCACAGAAGCACAAGGG + Intergenic
1004628065 6:17394676-17394698 TGAAATCTACAGAAGCAGTAAGG - Intronic
1004672944 6:17814849-17814871 AAAAATCCACAGACCCAGTGGGG - Intronic
1004767980 6:18752929-18752951 AACCAGCCACAGAAGCAGAAGGG - Intergenic
1004964609 6:20834185-20834207 AAAAATTCCCAGGTGCAGAAAGG - Intronic
1005187796 6:23182521-23182543 AAGAACCCGAAGAAGCAGAAAGG + Intergenic
1005725886 6:28648283-28648305 AAGAAGCCACAGAATCAGCACGG - Intergenic
1006339543 6:33439128-33439150 AAAAAGCCACAGAGCCATAATGG + Intronic
1006508570 6:34507743-34507765 TCAAATCCACAGAAACAGGAAGG - Intronic
1006699901 6:35963641-35963663 CAAAAGTAACAGAAGCAGAAGGG - Intronic
1006869177 6:37235010-37235032 AAAAAGCCACACCAGCATAAGGG - Intronic
1007017583 6:38484159-38484181 AGACATGCACAGAAGCATAAAGG + Intronic
1007057539 6:38902602-38902624 AAGGATCCCCAGAAACAGAAGGG - Intronic
1007410798 6:41660225-41660247 AAAAGCCCCCAGAGGCAGAAGGG + Intergenic
1007519834 6:42443264-42443286 AAACATACACAAAAGCAGAGAGG - Intronic
1008475365 6:51930535-51930557 AAAAATCAGCTGGAGCAGAAGGG + Intronic
1008602976 6:53113519-53113541 CCACATTCACAGAAGCAGAAAGG - Intergenic
1008614643 6:53214690-53214712 AGAAAATAACAGAAGCAGAAAGG + Intergenic
1008721498 6:54359158-54359180 AAAAAGCCCCAGAAAAAGAATGG - Intronic
1008764417 6:54893897-54893919 CAAAATGGACAGAAGTAGAATGG - Intronic
1009750975 6:67879132-67879154 CAAAAACAGCAGAAGCAGAAAGG + Intergenic
1009773984 6:68180928-68180950 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1010021053 6:71160345-71160367 AAAAATTAACAAAAGAAGAATGG - Intergenic
1010494125 6:76513160-76513182 ACAAATCCTCAGATTCAGAAAGG + Intergenic
1010740165 6:79493034-79493056 AAAAAGCCACAGACCCAAAATGG - Intronic
1011097201 6:83679477-83679499 AAAAGTCGACAGCAGCAGAAAGG + Intronic
1012505351 6:99940352-99940374 AAAAATTCTCAACAGCAGAACGG - Intronic
1012742908 6:103042952-103042974 AAAAAACTGCAAAAGCAGAAAGG + Intergenic
1013664001 6:112328056-112328078 AAAAATCAGCAGACACAGAAAGG - Intergenic
1014307757 6:119763736-119763758 AAAAATTCAAGGAAGCAAAATGG + Intergenic
1014347197 6:120287388-120287410 ACAAATCCACAGAAGGAAAAGGG - Intergenic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1014714153 6:124844198-124844220 AAATATCTTCAGTAGCAGAATGG - Intergenic
1015037379 6:128672590-128672612 AATAATCCAAAGATACAGAATGG - Intergenic
1015096790 6:129424839-129424861 GTAAATACACAGAAGCAGAATGG - Intronic
1015203441 6:130608178-130608200 AAAAAAGAACAGAAGTAGAAAGG + Intergenic
1015550875 6:134411287-134411309 AACATGCCACAGAAGCAAAAGGG + Intergenic
1015568696 6:134600077-134600099 AAAAATCCAAAGAAAATGAATGG - Intergenic
1015918642 6:138244556-138244578 AAACTCCCACAGAAGCAGAGTGG - Intronic
1016558607 6:145368910-145368932 AGAAAACCGCAGAAGCAGGAAGG - Intergenic
1016644829 6:146394521-146394543 AAAAGCCTCCAGAAGCAGAAAGG - Intronic
1017596423 6:156033974-156033996 AAAAATCCACAGATCCAGGAAGG - Intergenic
1017826027 6:158082660-158082682 AAAAAACCAAACAAACAGAATGG + Intronic
1018007332 6:159634698-159634720 CTAAATCCACAGAAGAATAAGGG + Intergenic
1018341834 6:162858960-162858982 AAAACGCCGCAGAAGCAGGAGGG - Intronic
1019690542 7:2408536-2408558 TAAAATGAAAAGAAGCAGAAGGG + Intronic
1019887885 7:3921105-3921127 GAAAATACAGAGAAACAGAAAGG + Intronic
1020419040 7:7979477-7979499 AAAAATACACATAAACAGAGTGG - Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020525086 7:9249449-9249471 AAAAATACTGAGAAACAGAAAGG + Intergenic
1020529527 7:9314268-9314290 AATAAACAACAGAAGCAAAATGG + Intergenic
1020582511 7:10021853-10021875 TAAAAACCACTGAAGCATAATGG - Intergenic
1020864272 7:13537333-13537355 AAAAATATAAAGAAGTAGAAAGG + Intergenic
1020888186 7:13846107-13846129 AGAAAACAGCAGAAGCAGAAAGG + Intergenic
1021396294 7:20152624-20152646 ATAAACACTCAGAAGCAGAAAGG - Intronic
1021674164 7:23063876-23063898 CTAAATCCACCTAAGCAGAAAGG - Intergenic
1021903533 7:25311180-25311202 AAAAGTCCAGAGAGGTAGAATGG - Intergenic
1022148340 7:27570887-27570909 ATAAACCCACAGAAACAGGAAGG - Intronic
1022303801 7:29127607-29127629 AAAAAACAGCAGAAGCAGGAAGG + Intronic
1022735113 7:33069028-33069050 CAAAGTCCACAGAAGCTGAGAGG + Intergenic
1022991049 7:35707540-35707562 AAAAAGCCACAGAAGCATCATGG + Intergenic
1023097827 7:36680632-36680654 AACAAGACACAGAAACAGAATGG - Intronic
1023349046 7:39301039-39301061 AAAAATCCTGAGAAGAAGAAAGG - Intronic
1023372462 7:39525486-39525508 TCAAACTCACAGAAGCAGAAAGG + Intergenic
1023447221 7:40244338-40244360 ACAAATGCAGAGAAGCAGGAAGG + Intronic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1024018894 7:45347515-45347537 AAAATTCCAAACAAACAGAAGGG - Intergenic
1024099366 7:46014740-46014762 AAAAATCCAATTAAGGAGAAAGG + Intergenic
1024216121 7:47249641-47249663 ATAAATCCACAGAGATAGAAAGG - Intergenic
1024423107 7:49193128-49193150 AAAATTCCTCAGAACCAGCAAGG + Intergenic
1025319406 7:58078140-58078162 AAAAATACACAGAAGACTAAGGG + Intergenic
1025477824 7:60948610-60948632 AAAAATACACAGAAGACTAAGGG + Intergenic
1025483241 7:61012875-61012897 AAAAATACACAGAAGAGTAAGGG + Intergenic
1025489265 7:61091912-61091934 AAAAATACACAGAAGAGTAAGGG - Intergenic
1027328477 7:77066152-77066174 TACAATTCACAGAAGCAGAAAGG - Intergenic
1027382452 7:77625237-77625259 AAAAAACCAAAGAAGAAGATAGG - Intronic
1027882905 7:83865153-83865175 AAAAATCCACTCCAGTAGAAAGG + Intergenic
1028028259 7:85874648-85874670 AAAATTCCACAAAAGTGGAAAGG + Intergenic
1028512709 7:91642773-91642795 AAATTCCCACATAAGCAGAAAGG + Intergenic
1028963951 7:96780628-96780650 GAAAATCCAGACAGGCAGAAAGG + Intergenic
1029400827 7:100344770-100344792 AAAAACCCACAGACCCAGTAGGG - Intronic
1029746787 7:102520029-102520051 TACAATTCACAGAAGCAGAAAGG + Intergenic
1029764720 7:102618989-102619011 TACAATTCACAGAAGCAGAAAGG + Intronic
1029908188 7:104114355-104114377 AAAAATCAATAGAAGCCAAAGGG - Intergenic
1030108201 7:106004742-106004764 AATATACCAGAGAAGCAGAAGGG - Intronic
1030123967 7:106137292-106137314 AAAAAAACACATAAGCAGGAAGG + Intergenic
1030495756 7:110297853-110297875 AGAAAACTACAGAAGCAGGAAGG + Intergenic
1031723090 7:125201400-125201422 AGAAAAACACAGGAGCAGAAAGG - Intergenic
1031789366 7:126081253-126081275 AAAAACCCATAGAGACAGAAAGG - Intergenic
1032231729 7:130080245-130080267 AAAAATGCATAGAAAAAGAAAGG - Intronic
1032673218 7:134105104-134105126 AGAAAACCAAAGAAGCAGGAGGG + Intergenic
1032673989 7:134111245-134111267 AGAAAACTACAGAAGCAGAAAGG - Intergenic
1032921122 7:136549383-136549405 AAGAATCCTCAGAGGCAGATAGG - Intergenic
1033336677 7:140459605-140459627 AAAAAGGAATAGAAGCAGAAAGG + Intronic
1033684967 7:143630462-143630484 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033688140 7:143709681-143709703 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033699646 7:143827159-143827181 AAAAATGCACAGAAGGAAGAAGG + Intergenic
1034065685 7:148134808-148134830 AAAAATTCAGAGCAGCAAAAAGG + Intronic
1034908253 7:154970593-154970615 AAAAATCCAGAAAAGAAGATGGG + Intronic
1035754203 8:2018873-2018895 AAAAATACAAAGAAGCTAAATGG - Intergenic
1035844745 8:2850965-2850987 AATAATCGACAGAAGAATAAAGG + Intergenic
1037402642 8:18508331-18508353 AAAAATGCAAAGGAGAAGAAAGG + Intergenic
1037467809 8:19177043-19177065 TAAAATGCTCAGAAACAGAAGGG + Intergenic
1037657228 8:20895303-20895325 ATAAATGCCGAGAAGCAGAAGGG - Intergenic
1037658054 8:20904119-20904141 AATAATACACAGTATCAGAAGGG - Intergenic
1037714767 8:21387938-21387960 AGAAAACCACAGAAGCAAGAAGG - Intergenic
1037923477 8:22825983-22826005 TCAAACCCACAGAAGCAGAGAGG + Intronic
1038363125 8:26902756-26902778 AAAAATCCAGAGAAGTGGATGGG + Intergenic
1038712951 8:29965154-29965176 AACAAACCACAGAATCAGAATGG + Intergenic
1038979322 8:32739920-32739942 AAGAATTCAAAGAAGCAGGATGG + Intronic
1039337705 8:36611067-36611089 AGAAAACAACAGAAGCAGGAGGG + Intergenic
1039898656 8:41734740-41734762 AAAAGCCCACAGAAGTAGACAGG + Intronic
1040370389 8:46765298-46765320 AGAAAACTACAGAAGCAGGAAGG + Intergenic
1041452374 8:58019807-58019829 AAAAACCCACCTAAGCATAATGG - Intronic
1041682792 8:60609980-60610002 AAAAATCCAGACAAGCAAATTGG + Intronic
1041948842 8:63477263-63477285 AAACACCAGCAGAAGCAGAATGG - Intergenic
1042258401 8:66830563-66830585 AAAAACACACGGCAGCAGAAAGG - Intronic
1042357060 8:67839832-67839854 AGAAAACAGCAGAAGCAGAAAGG - Intergenic
1042890262 8:73602114-73602136 AAAAAACCATACAGGCAGAAAGG + Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043669280 8:82861621-82861643 AATAATCCACAGTATCAAAAGGG - Intergenic
1043715011 8:83471772-83471794 AAAAATACACAGAAGACCAAGGG + Intergenic
1043805637 8:84669334-84669356 AAAAATGCTCAGAAGCACATGGG - Intronic
1044146801 8:88725844-88725866 ACAAATTCATAGAAACAGAAGGG + Intergenic
1044458071 8:92412181-92412203 AAAAAGCAAGTGAAGCAGAAGGG + Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1046212882 8:111101360-111101382 AAAAACCCACGGAACCAGTAGGG + Intergenic
1046361017 8:113155920-113155942 AGAAAACCACAGCAGCTGAAAGG - Intronic
1047148018 8:122227559-122227581 AAATATACACAATAGCAGAATGG + Intergenic
1047354815 8:124110439-124110461 AAAGAGCCATAGAAACAGAAGGG + Intronic
1048778992 8:137980435-137980457 AAAAATACACAGAAGCCAAAAGG - Intergenic
1049011262 8:139889245-139889267 TCAAATCCACAGAGACAGAATGG + Intronic
1051004642 9:12328869-12328891 AAAAACCCACAGACCCAGTAGGG - Intergenic
1051029273 9:12655465-12655487 AAAAATAAACAGAAAAAGAAAGG - Intergenic
1051138831 9:13955255-13955277 AGAAAACCACAGAAGCAGGAAGG + Intergenic
1051294341 9:15579298-15579320 AATAATCAACAGAATCACAAAGG + Intronic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052313187 9:27090560-27090582 GAAAATCCATAGAAACAGAGAGG - Intergenic
1052767901 9:32660321-32660343 GAAAAGCCACAGGAGCAGAGTGG - Intergenic
1052921756 9:33976481-33976503 AAAAACCTACAGAAACAGAAAGG + Intronic
1054925745 9:70587265-70587287 AAATACTCAGAGAAGCAGAAAGG + Intronic
1055284146 9:74710487-74710509 AAAAATCCAAATAAGCAAGATGG - Intergenic
1055664884 9:78543387-78543409 AAAAAGTCACAGAAGGAAAAAGG - Intergenic
1055831881 9:80389263-80389285 AGAAAGCCACAGAAACAAAATGG + Intergenic
1056180635 9:84079081-84079103 AAAAATACAAAAAAACAGAACGG - Intergenic
1056467497 9:86872074-86872096 AAAAATTGACAGAACCATAATGG + Intergenic
1056566939 9:87781513-87781535 AGAAATCTATAGAAGCAGAGTGG - Intergenic
1057292632 9:93816631-93816653 GCAAATCCATAGAGGCAGAAAGG - Intergenic
1057770557 9:97963832-97963854 AGAAATCCAGAGAGGCAGAAGGG - Intergenic
1058231077 9:102426334-102426356 AAACATAAACAGAAGTAGAAAGG + Intergenic
1058397801 9:104575176-104575198 AAAAAGCCACAGAGGTTGAAAGG + Intergenic
1058825327 9:108770810-108770832 AAAAATACTCAGAAGAAAAATGG + Intergenic
1059052894 9:110947012-110947034 AATAATACACTAAAGCAGAATGG + Intronic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059400032 9:114063192-114063214 AAAAATCCAGAGAGAAAGAAGGG + Intronic
1059805900 9:117800103-117800125 AAATCTCCTTAGAAGCAGAATGG + Intergenic
1059988229 9:119840387-119840409 CAAATTCCACAGAAGCACAGAGG + Intergenic
1060004768 9:119990180-119990202 AGATAACCACAGAAGCAAAATGG + Intergenic
1060589405 9:124807584-124807606 AAACATTCAGAAAAGCAGAATGG - Intronic
1061622667 9:131821865-131821887 TCAAATCCATAGAGGCAGAATGG + Intergenic
1062134941 9:134921333-134921355 AAAAATCCACATCAGGAGAAGGG + Intergenic
1062652777 9:137586842-137586864 CAAAATACACAGAAGCATCAGGG + Intronic
1062704455 9:137928821-137928843 ACAAATCTACAGAGACAGAAAGG - Intronic
1062728624 9:138095897-138095919 ACAAAGCCATAGAAACAGAAAGG + Intronic
1203357188 Un_KI270442v1:166804-166826 AAAAATACACAGAAGCATTCTGG + Intergenic
1203614602 Un_KI270749v1:47510-47532 AAAAATACACAGAAGAGTAAGGG + Intergenic
1185844505 X:3425063-3425085 CAACATCCACGGAAGCAGTAGGG + Intergenic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187140509 X:16588643-16588665 AAAAAGCCACAGAAATAAAAAGG + Exonic
1187614247 X:20975924-20975946 AGAAAACCACAGAAGCAGGAAGG + Intergenic
1187754587 X:22508468-22508490 AAATGTGCACAGAAGTAGAATGG - Intergenic
1188013586 X:25083694-25083716 AAAAATCCAGGCAAGCGGAAAGG + Intergenic
1188484340 X:30666827-30666849 ATAAATACACAGAAGGAGACTGG + Intronic
1189095031 X:38129463-38129485 AAAAATACTCAGAAGTGGAATGG - Intronic
1189171712 X:38915915-38915937 AAATATCCAAAAAAGCAAAATGG - Intergenic
1189822805 X:44886648-44886670 AAAAATACACAAAATCAGCAGGG - Intronic
1190154202 X:47974285-47974307 GAAAAGCCACAGAAGCATGAGGG + Intronic
1190389927 X:49922092-49922114 AAAAATACACAGGCACAGAAAGG - Intergenic
1191123329 X:56927787-56927809 AAAAATCCATGGAAGAAGTATGG + Intergenic
1191227272 X:58056393-58056415 AAAAATACACAGAAAGACAAAGG - Intergenic
1191913774 X:66180025-66180047 AAAAATACAAAAATGCAGAATGG - Intronic
1192307043 X:69972345-69972367 AAAAATCTACAGAACCCCAAGGG - Intronic
1192431128 X:71112317-71112339 GAAACACCACAGAAGCAGAGTGG - Intergenic
1192563783 X:72145751-72145773 AAAAGTCCACAGAAGTAACAAGG - Intergenic
1192901614 X:75504578-75504600 ACAAATCCACAGGATTAGAAGGG + Intronic
1193154656 X:78159243-78159265 AGAAACCCACAGAACCAGCAAGG + Intergenic
1193672485 X:84405385-84405407 AAAAGTCCACCCAAACAGAAGGG + Intronic
1193712592 X:84896277-84896299 AAAGATCCATAGAAGAAGCATGG + Intergenic
1194267728 X:91776352-91776374 AAAAGTCCTCAAAAGCAAAAAGG - Intergenic
1194508145 X:94758885-94758907 AAAAAACAAAAGAATCAGAAAGG + Intergenic
1194601015 X:95921917-95921939 GAAATTCCACAGAAGCAAACTGG - Intergenic
1195273626 X:103256756-103256778 AAAAATCATCAGCAGCAAAATGG + Intergenic
1195346160 X:103953175-103953197 AAAAATCCATGGAAGAAGCATGG - Intronic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1196062802 X:111429687-111429709 GCAAATCCACAGAGACAGAAAGG + Intergenic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1196944941 X:120814457-120814479 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1197032637 X:121836160-121836182 AAAAGTCCATTGAAGTAGAAAGG + Intergenic
1197271315 X:124427477-124427499 AAAATGGCTCAGAAGCAGAAAGG - Intronic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1198311574 X:135429686-135429708 AAAGACCCAAAGAAGCAGGAAGG + Intergenic
1198601031 X:138284353-138284375 TAAAATCCCAAAAAGCAGAAAGG - Intergenic
1198792609 X:140362076-140362098 GAAAATCCGTAGAGGCAGAAAGG + Intergenic
1198804371 X:140479241-140479263 ACAAATCCACAGTAACAGTAGGG + Intergenic
1199483106 X:148319953-148319975 GAAACTCCACAGGAGCAAAATGG + Intergenic
1200410615 Y:2857279-2857301 TCAAATTCACAGAAGCAGAGTGG - Intronic
1200584939 Y:4997277-4997299 AAAAGTCCTCAAAAGCAAAAAGG - Intergenic
1200845794 Y:7831348-7831370 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1201388849 Y:13474375-13474397 AAAAATCCAATGAAACACAAAGG + Intronic
1201487753 Y:14510210-14510232 AAATACCAGCAGAAGCAGAATGG + Intergenic
1201591943 Y:15625346-15625368 GCAAACCCACAGAAACAGAAAGG + Intergenic
1201743830 Y:17350054-17350076 CAAACACCAGAGAAGCAGAATGG - Intergenic
1202049075 Y:20762350-20762372 AACAATCCACAAAAACAGAAGGG - Intronic