ID: 977481638

View in Genome Browser
Species Human (GRCh38)
Location 4:97585385-97585407
Sequence GCCACCTTGGTGTTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977481638 Original CRISPR GCCACCTTGGTGTTTCTCAC TGG (reversed) Intronic
900821376 1:4891823-4891845 GCAACCTAGATGATTCTCACAGG + Intergenic
901635954 1:10670228-10670250 GCCACCTTGGTGATGCCCCCAGG + Intronic
902837875 1:19058420-19058442 GACACCTTGGTGTTCATCAAGGG - Intergenic
903816133 1:26065925-26065947 ACAACCTGGCTGTTTCTCACCGG + Intronic
905353470 1:37363966-37363988 GCCACGCTGGCCTTTCTCACAGG - Intergenic
907950004 1:59173891-59173913 GCCACATTGCTGTGACTCACTGG + Intergenic
914748703 1:150517619-150517641 GCCAACTTCTTGTATCTCACAGG - Intergenic
917193407 1:172442588-172442610 ACCTCCTTGGTGTTAGTCACAGG + Exonic
918287657 1:183073612-183073634 GCCAGTTTGGTGTTACTCCCAGG + Intronic
918799945 1:188959393-188959415 GCTACCTTGGTGTTTCCTAGAGG + Intergenic
918863129 1:189859576-189859598 GGCACCTTGTTGTTGCTCACAGG - Intergenic
919906495 1:202082160-202082182 GCCCCCTTGGCTTTCCTCACAGG - Intergenic
923018543 1:230145538-230145560 GCCAACTTGGTGGTTCTCTGGGG + Intronic
923604954 1:235434809-235434831 GCCAACTTGCTGTTTCTAAATGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1064811855 10:19208761-19208783 GCTCCCTTGGTGATTCTAACAGG - Intronic
1066640107 10:37547304-37547326 GCCACCTTTATTTTTCTTACAGG - Intergenic
1067274919 10:44825607-44825629 GCCATCTTGCTGTGTCTCACTGG - Intergenic
1067726758 10:48776431-48776453 GCCCCATTGGAGTTACTCACTGG - Intronic
1073047719 10:100650638-100650660 GCCACCTGGCTGGTCCTCACAGG - Intergenic
1074706896 10:116141194-116141216 TCCACCTTGGTGTCTGTCCCTGG - Intronic
1075729583 10:124628297-124628319 GCCAGCTTTGTCTTTGTCACCGG - Intronic
1076322369 10:129593017-129593039 GCCACCATGGTGTTTGTCTGGGG - Intronic
1077894474 11:6443418-6443440 GCCACCCTGGTGTTGGTCACAGG + Intergenic
1080522102 11:33076426-33076448 ACCTCCTTGGTGTTTGTTACAGG + Intronic
1081915633 11:46728501-46728523 GCCCCCTGGGTGTTTCTTCCTGG - Intronic
1082776612 11:57249905-57249927 GCCACCTTGTGGCTTCTCGCAGG + Intergenic
1084509754 11:69596295-69596317 GCCACCTTGGTGTCTCACCTTGG + Intergenic
1085690656 11:78661342-78661364 ACCACATTGGTGTCTATCACTGG + Intronic
1086461737 11:87012738-87012760 TCTACCTTGGTGTTTCTGACTGG + Intergenic
1088159838 11:106855519-106855541 GCCACCTTGATCTTTCTCCCAGG + Intronic
1088622183 11:111697069-111697091 ACCACCTTTATGTCTCTCACTGG - Intronic
1090101455 11:123801584-123801606 CCCACCCTGGTGCTTCTCACAGG - Intergenic
1090956592 11:131518333-131518355 GTCTCCTTGCTGTTTCTCAGAGG + Intronic
1093431056 12:19085328-19085350 GCCAACTTGGTGTATCTGCCCGG + Intergenic
1097627304 12:62016276-62016298 GCATCCTTGAGGTTTCTCACTGG - Intronic
1098597569 12:72292473-72292495 GCCACCTGGCTTCTTCTCACTGG - Intronic
1104260124 12:127174573-127174595 GCCACCCTGGTGTCCATCACTGG + Intergenic
1106542891 13:30705691-30705713 GCCACCTTGGTGTGTTTGAGGGG + Intergenic
1112803054 13:103133373-103133395 GCCAGCTTGATGCTTCTCAATGG + Intergenic
1113282483 13:108804345-108804367 ACCACCTCTGTGTTTCTCACAGG + Intronic
1117154442 14:52924175-52924197 GCCACCTTGGTCTCCCTCAATGG - Intronic
1119605727 14:76014766-76014788 GCCATCTTGGTGGTTTTCACTGG - Intronic
1120602323 14:86526792-86526814 TCCAACTTGGTGTATCTCATTGG + Intergenic
1125205147 15:37145812-37145834 GCCACCTTAGTGCTCCTCGCTGG + Intergenic
1127082764 15:55396849-55396871 GCCTCCTTGCTGTTTCTCAGAGG - Intronic
1127599252 15:60518739-60518761 GCCTCCATGGTGTTTTCCACAGG - Intronic
1127910644 15:63413313-63413335 TCGACATTGGAGTTTCTCACTGG - Intergenic
1129111107 15:73337821-73337843 GGCACCTTGGTTCTTCCCACAGG - Intronic
1129452083 15:75656808-75656830 GCCACCTGGGTGTCTCTGCCAGG - Intronic
1134246952 16:12547281-12547303 GCTTCCTTGCTGTTTCTCCCAGG - Intronic
1138222021 16:55259986-55260008 GCCACCTTGCAGTTAGTCACTGG - Intergenic
1139642000 16:68298509-68298531 GCCACCTTGGTGTGGGTCACCGG + Exonic
1143242573 17:5456142-5456164 GACATCCTGGTGTTCCTCACTGG - Exonic
1149801702 17:59574233-59574255 GACATCTTGGTTTTTCTGACTGG + Exonic
1149844785 17:60001229-60001251 GACATCTTGGTTTTTCTGACTGG - Intergenic
1151494203 17:74449775-74449797 GCCATCTTGGTGTCTGGCACTGG + Intronic
1152028025 17:77824369-77824391 TCCCCCTTGGTGTTTTCCACCGG - Intergenic
1158520451 18:58168319-58168341 GCCATCTTGGTGTCTCACTCTGG + Intronic
1160429447 18:78801375-78801397 GCCATCTGGGTGCTTCTCTCTGG + Intergenic
1161669943 19:5601260-5601282 GCCACCCTGGTGGTTGTCGCAGG - Intronic
1163410770 19:17152911-17152933 GCCACCTTTGTGTGCCTCCCTGG + Intronic
929288234 2:40160431-40160453 GCCACCTTTGTGCTGCTTACAGG + Intronic
931937263 2:67213478-67213500 CTCACCTTGTTGCTTCTCACTGG - Intergenic
933756106 2:85639828-85639850 GACTCGTTGGTATTTCTCACTGG + Intronic
935190833 2:100777635-100777657 CCCACCTTGGTGTTGCTCACTGG - Intergenic
938480887 2:131660400-131660422 GCAACCTTGGAGTATCTCAGGGG - Intergenic
938555169 2:132417277-132417299 GACATCTTGGTGTTCCTCATCGG + Exonic
947457395 2:230267699-230267721 GCCTCTTTGCTGTTTGTCACGGG - Intronic
948639273 2:239364133-239364155 GCCACCGAGGGGTTTCCCACAGG - Intronic
1173896672 20:46556333-46556355 GCCACCTAGGTGATCATCACCGG - Intergenic
1173925966 20:46781518-46781540 GGCTCCTTGGGGTTTCCCACTGG + Intergenic
1174354809 20:49990566-49990588 GCCATCCTGGTCTTTCTCATGGG - Intergenic
1175074515 20:56361286-56361308 GCCCCATTGGTGTTTCTCTATGG + Intronic
1175770175 20:61618508-61618530 TCCACCTTGGTGTTGCTGCCTGG + Intronic
1177932881 21:27306436-27306458 GACAACTTAGTGTTTCTCTCTGG + Intergenic
1184508764 22:44919627-44919649 GCCATCTTGGTCTTTACCACTGG + Intronic
952380395 3:32799970-32799992 GCAACATTGCTGTTTCTCAAAGG + Intergenic
953450231 3:42999427-42999449 GCCTCCCTGCTGTTTCTCCCAGG + Intronic
960048426 3:113218918-113218940 GCCACCTTGTTGTTCCTCTTTGG - Intronic
962748191 3:138413177-138413199 GCCTCCTGGGTCTTACTCACTGG - Intergenic
963219238 3:142788690-142788712 GCCATCTTGGGATTTCTCAAGGG - Intronic
964995794 3:162878738-162878760 GCCACCTTTGTTTTCCTCATTGG + Intergenic
968668862 4:1837163-1837185 CCCTCCTTGGTGCTGCTCACAGG + Intronic
971813502 4:31458867-31458889 GCCCCCTTTGATTTTCTCACTGG + Intergenic
977481638 4:97585385-97585407 GCCACCTTGGTGTTTCTCACTGG - Intronic
980074261 4:128277485-128277507 GCTACCTTAGTGTTTCTAAAGGG + Intronic
981783022 4:148446167-148446189 GGCACCTCGGTGTTTAACACGGG - Intergenic
982066949 4:151662626-151662648 GCCAGCATGGGGTTCCTCACCGG - Exonic
982189509 4:152839945-152839967 ACCACCTTGCTGTTTCCCAGAGG + Intronic
982307422 4:153947505-153947527 TCCACCTTCTTGTTTGTCACAGG + Intergenic
982949255 4:161668669-161668691 GACACGTTGGTGTTTGTCTCAGG + Intronic
985186028 4:187316926-187316948 TTCACTTTGGTATTTCTCACTGG - Intergenic
986316812 5:6594777-6594799 TCCTCCATGGTGTTTCTCTCTGG + Intergenic
986702227 5:10421755-10421777 GCCTCCCTGCTTTTTCTCACAGG - Intronic
987787374 5:22519001-22519023 GCCACTTTGGTGTATTTCCCTGG - Intronic
989232415 5:39101523-39101545 GCCAATATGATGTTTCTCACAGG + Intergenic
992025655 5:72666486-72666508 GCAACCTTGAGTTTTCTCACAGG - Intergenic
994999874 5:107113967-107113989 ACTATCTTGATGTTTCTCACAGG + Intergenic
995598835 5:113774948-113774970 GCCCCCTTGTTGCTTCACACAGG + Intergenic
1001232498 5:170000880-170000902 GCCACCTTGGTCTTTATAATGGG + Intronic
1002069989 5:176673535-176673557 AGCTCCTTGGTTTTTCTCACTGG + Intergenic
1003332999 6:5145105-5145127 GCCAGGTTGGTGTTTTCCACAGG - Intronic
1006800340 6:36755912-36755934 CCCACGTTGGTGCTTTTCACAGG - Intronic
1009955682 6:70449659-70449681 GCAACCTTAGTGTTTATCAATGG - Intronic
1010533149 6:76991567-76991589 GCCACCTTGGTCTTTTACAATGG + Intergenic
1011859469 6:91737206-91737228 GACTCCATGGAGTTTCTCACTGG + Intergenic
1014774431 6:125492330-125492352 GCAAACTTGGTGTTTCACAGAGG - Intergenic
1016308896 6:142712606-142712628 GCCATCTTGATGTTTCTGATTGG - Intergenic
1019513201 7:1428778-1428800 TCCACCTAGGTGTTTCCCCCCGG - Intronic
1023795905 7:43791898-43791920 CCCACCATGCTGTTTCCCACGGG + Intronic
1026845977 7:73699463-73699485 ACCACCTTGGGGCTTCTCATGGG - Exonic
1027958582 7:84914784-84914806 GCCACCTAGTGGTTTTTCACAGG - Intergenic
1031219615 7:118948513-118948535 GCCACCTATGTGTCTCTCAGTGG - Intergenic
1032156260 7:129470940-129470962 TCCTCCTTAGTGTTTTTCACTGG - Intronic
1035889515 8:3328283-3328305 TCCACATTGGCGCTTCTCACTGG + Intronic
1038359703 8:26864953-26864975 GGGACCATGGTGTTTCTCTCGGG - Exonic
1038450723 8:27637328-27637350 CCCACCTTGGAGCTTCCCACTGG + Intronic
1042023145 8:64392563-64392585 GCCAACTTAGAGCTTCTCACTGG + Intergenic
1043289531 8:78579905-78579927 ACCAGCTTGGTATTTCTCAAAGG - Intronic
1043872436 8:85448914-85448936 GCCTCTGTTGTGTTTCTCACTGG + Exonic
1044860650 8:96520054-96520076 GCCTTCTTGGCCTTTCTCACGGG + Intronic
1048941739 8:139405898-139405920 TCCACCTTCATGGTTCTCACCGG + Intergenic
1048966948 8:139622119-139622141 CACACCATAGTGTTTCTCACTGG + Intronic
1050583143 9:7082029-7082051 GCCACCATGATGCTTTTCACAGG - Intergenic
1055286963 9:74739170-74739192 GATACCTTGGTGTTAATCACTGG - Intronic
1056873311 9:90304903-90304925 GCAGGCTTGGTGTTTCTCATTGG - Intergenic
1059528764 9:115016864-115016886 GCCTCCTGAGGGTTTCTCACAGG + Intergenic
1059933590 9:119285262-119285284 ACCACGATGGTCTTTCTCACTGG - Intronic
1186424730 X:9455053-9455075 CCAACCTTGGTGTCTCTCAAGGG - Intergenic
1187458042 X:19460090-19460112 CTCACCTTGGTATTTCTCTCTGG + Exonic
1188773488 X:34184532-34184554 GCCATCTTGGAGGTGCTCACTGG - Intergenic
1191925477 X:66304956-66304978 TCCTCTTTGGTGTTTCTCACAGG + Intergenic
1192169095 X:68843398-68843420 GCCAGATTGGTGTCGCTCACTGG + Intergenic
1192973038 X:76253599-76253621 GCCCCTCTGGTGTCTCTCACAGG + Intergenic
1193468357 X:81872664-81872686 GCCACCTTAGTGTTTTGCAGTGG - Intergenic
1194403558 X:93467447-93467469 GCCATCTTGGTGCTTCTGAAAGG - Intergenic
1194409790 X:93543676-93543698 GCCCCCTTGGTTGTTTTCACTGG + Intergenic
1194533594 X:95079181-95079203 GACACCTTGGTGTTATTCAAAGG - Intergenic
1199999230 X:153048853-153048875 GCCCCCTTGGTGTTTGTCCTGGG - Intergenic