ID: 977483683

View in Genome Browser
Species Human (GRCh38)
Location 4:97613953-97613975
Sequence TTGTAGCTGTAGATGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977483683_977483685 4 Left 977483683 4:97613953-97613975 CCTAGCTTCATCTACAGCTACAA 0: 1
1: 0
2: 0
3: 15
4: 222
Right 977483685 4:97613980-97614002 TAATGGCTTATTGTTCATTATGG 0: 1
1: 0
2: 1
3: 17
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977483683 Original CRISPR TTGTAGCTGTAGATGAAGCT AGG (reversed) Intronic
900983508 1:6059897-6059919 TTGAAGCTGCAGGTGATGCTAGG - Intronic
902156064 1:14487499-14487521 TTGTATGTGGATATGAAGCTGGG - Intergenic
905272742 1:36797579-36797601 TTGTATCTGTCCATGAGGCTGGG + Exonic
905507899 1:38494622-38494644 TTGTGGCTGTTGAAGGAGCTGGG - Intergenic
907241376 1:53083106-53083128 TTGTAGCAGCAGGGGAAGCTGGG + Intronic
907567941 1:55454581-55454603 TTGTATCTGTAGATCAATTTGGG - Intergenic
908185385 1:61647878-61647900 TTTGATCTGTAGATGAAGTTAGG - Intergenic
909087818 1:71188229-71188251 ATGTAGCTGAAGAATAAGCTAGG - Intergenic
909098280 1:71317252-71317274 TTGAATCTATAGATCAAGCTGGG - Intergenic
909179261 1:72400342-72400364 TTGAATCTATAGATCAAGCTGGG + Intergenic
909645515 1:77912372-77912394 TTGAATCTGTAGATGGATCTAGG - Intronic
911403186 1:97402189-97402211 TTGCATCTATAGATCAAGCTGGG + Intronic
913028134 1:114867320-114867342 TTGAATCTGTAGATCAAGTTGGG + Intronic
913316260 1:117555642-117555664 TTGTAGCTATTCTTGAAGCTAGG + Intergenic
914360418 1:146931054-146931076 TTGTAGCTTGAGAAGGAGCTGGG + Intergenic
914493329 1:148168844-148168866 TTGTAGCTTGAGAAGGAGCTGGG - Intergenic
915703174 1:157817080-157817102 TTGAATCTGTAGATGATTCTGGG - Intronic
916161050 1:161915174-161915196 TTGTGGGTGTAGATGCAGCTGGG - Intronic
917111954 1:171557719-171557741 TTGGAGCTGAAGTTGATGCTAGG - Exonic
919161606 1:193837634-193837656 TTCTAGCTGTTGCTGAAGTTTGG + Intergenic
919717051 1:200789725-200789747 TTGAATCTGTAGATCAAGTTGGG + Intronic
921370331 1:214416458-214416480 TGGTAGCTGTAGATGAAAGTTGG - Intronic
923419178 1:233795831-233795853 TTCAGGCTGTACATGAAGCTTGG + Intergenic
923429043 1:233903278-233903300 TTGAATCTATAGATGAAGTTGGG + Intergenic
1064305703 10:14164225-14164247 TTGTGCCTGAAGATGAGGCTTGG - Intronic
1064523519 10:16229128-16229150 GTGTAACTGTAGATAAAGCCTGG + Intergenic
1064781874 10:18849500-18849522 TTGCATCTGTAGATCAAGCTGGG + Intergenic
1065758215 10:28954847-28954869 TTGAATCTGTAGATCAATCTGGG - Intergenic
1067336668 10:45372342-45372364 TTGAAGCTGTAGATCAATTTGGG - Intergenic
1069011267 10:63375863-63375885 TTGAATCTGTAGATGGATCTGGG - Intronic
1070789486 10:79180900-79180922 TTCTAGCTGGAGCAGAAGCTGGG - Intronic
1072173362 10:92890037-92890059 TTGAATCTATAGATGAAGTTGGG + Intronic
1072174543 10:92905342-92905364 TTGAATCTGTAGATCAAGTTGGG + Intronic
1075403236 10:122176199-122176221 TGGTGGCTGCAGATGAAGATTGG + Intronic
1076056641 10:127379642-127379664 TTGTAGCTCTTGCTGAGGCTGGG + Intronic
1076159333 10:128230685-128230707 TTAAATCTGTAGATGAAGTTGGG + Intergenic
1076467332 10:130692565-130692587 GTGTTGCTGTAGATGAGACTTGG - Intergenic
1079304131 11:19307681-19307703 TTGTGGATGAAGATGAAGCATGG - Intergenic
1081058956 11:38448419-38448441 TTGAAGCTGTTGCTGGAGCTGGG + Intergenic
1083497661 11:63072306-63072328 TTGTAGCAGGAGATGAAACATGG - Intergenic
1084339409 11:68484953-68484975 TTGAATCTGTAGATCAAGTTAGG + Intronic
1084343892 11:68529862-68529884 TTGTAGCTGTGGAAGGAGATGGG + Intronic
1086921197 11:92589104-92589126 CTGTAGTTGTAGTTGATGCTGGG + Intronic
1087064007 11:94010497-94010519 TTGTTGCTGTTGATGATGATGGG + Intergenic
1087456956 11:98398364-98398386 TTGTTGCTGTTGTTGAGGCTTGG - Intergenic
1087872181 11:103309657-103309679 TTGTAGCTGGAGAAGATTCTGGG - Intronic
1089170857 11:116510591-116510613 TTTTAGGTGTAGATGAAGTGAGG - Intergenic
1090483366 11:127087209-127087231 TTGTGACTGTAGAGGATGCTAGG - Intergenic
1091393466 12:139615-139637 TTACAGCTTAAGATGAAGCTAGG + Intronic
1092566958 12:9675706-9675728 TTTAATCTGTAGATTAAGCTGGG + Intronic
1093343203 12:18005433-18005455 TTGAATCTATAGATCAAGCTGGG - Intergenic
1094800186 12:34023869-34023891 TTGTTGCTGGAGATGAGACTTGG + Intronic
1095112979 12:38318168-38318190 TTGTTGCTGGAGATGAGACTTGG + Intronic
1095325890 12:40891953-40891975 TTGAATCTGTAGATCAAGCTGGG + Intronic
1095835540 12:46634540-46634562 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096347633 12:50864273-50864295 TTGAAGCCTTAGATGAAGTTGGG - Intronic
1096568567 12:52502683-52502705 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1101142211 12:101808187-101808209 TTGAATCTGTAGATGAAGTTGGG - Intronic
1101462084 12:104906369-104906391 TTGGAGGTGTAGATGGAGCTTGG + Intronic
1102255714 12:111413766-111413788 TAGGAGCTGGAGATGAAGCAGGG + Intronic
1102319833 12:111923009-111923031 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1104263232 12:127204666-127204688 TTGTAGCTATAGAGGAAGGGAGG + Intergenic
1104619000 12:130295829-130295851 TTGAAGCTGTAGATCAATTTGGG - Intergenic
1105278064 13:18947718-18947740 GTGCAGGTGTAGATGCAGCTGGG - Intergenic
1106556650 13:30815033-30815055 TTGACTCTATAGATGAAGCTGGG + Intergenic
1107177874 13:37420840-37420862 TTGTAGGTATAGGTGAAGTTGGG + Intergenic
1107266093 13:38556621-38556643 TTGTATCTGTAGATTATGTTGGG + Intergenic
1108042719 13:46354344-46354366 TGTTAGCAGTAGAGGAAGCTGGG + Intronic
1109078392 13:57866250-57866272 TTGTGGCTGTAGAGAATGCTGGG - Intergenic
1110400572 13:75086246-75086268 TTGAATCTGTAGATCAATCTGGG - Intergenic
1113216979 13:108053290-108053312 TTATAGCTGTAGATGGACCTAGG + Intergenic
1114581647 14:23766011-23766033 TTGTAACAGGAGATGAAGCATGG + Intergenic
1115438079 14:33399637-33399659 GATTAGTTGTAGATGAAGCTGGG + Intronic
1115937586 14:38571706-38571728 TTGAAGCTGTAGATCAATTTGGG - Intergenic
1117758399 14:58999759-58999781 TTATAGCTGTACAGGAAGCATGG - Intergenic
1121942405 14:98083975-98083997 AAATAGCTGTTGATGAAGCTGGG - Intergenic
1124578663 15:30931799-30931821 TTGTAGCTTTAGATACATCTTGG + Intronic
1124643679 15:31419004-31419026 CTGCAGCTGTACAGGAAGCTTGG + Intronic
1124713746 15:32037481-32037503 TTGAATCTGTAGATCAAGTTGGG + Intronic
1126308736 15:47291291-47291313 TTGTAACTGGAGAAGAAACTTGG + Intronic
1128941159 15:71788757-71788779 TTGTGGCTGCAGAGGAAGCTGGG + Intergenic
1130426234 15:83803719-83803741 TAGTGGCTGTAGAGGAAGATAGG + Intronic
1130731832 15:86502009-86502031 TTGAAACTGTAGATCAATCTGGG + Intronic
1131889646 15:96958819-96958841 TTGTAGCTGGAGCTGGAGCCAGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1138727976 16:59161720-59161742 ATAAAGCTGGAGATGAAGCTAGG - Intergenic
1139121825 16:64028190-64028212 TTGAATCTATAGATCAAGCTGGG + Intergenic
1141194101 16:81846700-81846722 TTGAATCTATAGATGAAGCCAGG - Intronic
1141304433 16:82848230-82848252 TTGAAGCTATAGATAAAACTGGG + Intronic
1144514268 17:15905098-15905120 TTGTATCTGTAAATCAAACTGGG + Intergenic
1146457004 17:33016234-33016256 TTGTTGCAGGAGATGGAGCTAGG + Intronic
1150184794 17:63169336-63169358 TTGTAGAAATAAATGAAGCTAGG + Intronic
1154232217 18:12567390-12567412 TTGAATCTGTAGATCAAGCTGGG - Intronic
1154319392 18:13333968-13333990 TTGAATCTATTGATGAAGCTGGG + Intronic
1155316656 18:24578336-24578358 TTATAGATGGAGATGAAGCTGGG + Intergenic
1155854790 18:30819730-30819752 TTGTAGCAGGAGATGAAACATGG + Intergenic
1156416888 18:36904104-36904126 TTGTAGCTTTGGATGATGATGGG + Intronic
1157416676 18:47509296-47509318 TTCTACCTGTAGGTGAAGCCTGG + Intergenic
1158701036 18:59747007-59747029 TTGAATCTATAGATGAAGATAGG + Intergenic
1159198393 18:65149057-65149079 TTGTAACTGGAGATGAAGCAGGG - Intergenic
1160616543 18:80134501-80134523 CTGGGGCTTTAGATGAAGCTAGG + Intronic
1162458096 19:10797967-10797989 TTGGTGCTGCAGATGAAGCCTGG + Intronic
1162669180 19:12240102-12240124 TTGTATCTGTAGATTAATTTGGG - Intronic
1164144369 19:22502409-22502431 TTGGAGCTCAAGATGGAGCTCGG - Intronic
1164639614 19:29814314-29814336 TTCCAGCTGAAGATGAAGCAGGG + Intronic
1165282597 19:34809883-34809905 CTGTAGCTGTACAGGAAGCATGG - Intergenic
925195868 2:1925305-1925327 TTGTGGCTGTAGAAGCAGCAAGG - Intronic
926363605 2:12113139-12113161 AGGTAGCAGGAGATGAAGCTGGG + Intergenic
927757663 2:25722334-25722356 TTATTGTTGTTGATGAAGCTTGG + Intergenic
928921170 2:36529526-36529548 ATGTACCTGTAGATGCATCTTGG + Intronic
929663376 2:43812673-43812695 TTGTGGGTTTAGATGAAGCAAGG - Exonic
930977720 2:57484341-57484363 TTGAATCTGTAGATCAAGTTGGG + Intergenic
932095377 2:68843097-68843119 TTGTAACAGTAGATGAAACATGG - Intergenic
932559011 2:72851050-72851072 GTGCAGCTGTGGATGGAGCTTGG - Intergenic
932705496 2:74021202-74021224 ATGCAGCTGTGGATGCAGCTGGG - Intronic
932723349 2:74156519-74156541 TTCTAGCAATAGATGAAGCAAGG + Exonic
935245766 2:101217832-101217854 TTGATGCTGTAAATGAACCTAGG - Intronic
936005167 2:108880342-108880364 TTGTATCTATAGATCAAGTTGGG - Intronic
937838697 2:126502134-126502156 TTGAATCTGTAGATGAAATTGGG - Intergenic
938113106 2:128582331-128582353 TTGAATCTGTAGATGAATTTGGG + Intergenic
940544800 2:155070170-155070192 TCTTGGTTGTAGATGAAGCTAGG + Intergenic
941834980 2:170006024-170006046 TTTTTGCTGTAACTGAAGCTGGG - Intronic
942365095 2:175217703-175217725 TTGCATCTGTAGATGAATTTGGG - Intergenic
943945838 2:194062592-194062614 TTGTAACTGTAGATGCAGCATGG + Intergenic
945021485 2:205576861-205576883 TTGAATCTGTAGATCAAGTTGGG + Intronic
945674226 2:212835727-212835749 TTGAATCTATAGATGAAGTTAGG + Intergenic
947433666 2:230053606-230053628 TTGTAGCTGTAGTAGAAACGGGG - Intronic
948391229 2:237612982-237613004 TTGCAGCTGAAGCTGCAGCTGGG + Intergenic
1169032933 20:2426070-2426092 TTGAATCTATAGATCAAGCTAGG + Intronic
1170689495 20:18600668-18600690 TTGAGTCTGTAGATGAAGTTGGG + Intronic
1173271976 20:41545228-41545250 TGTGAGCTGTGGATGAAGCTAGG - Intronic
1175820351 20:61905754-61905776 TTGTGGCTGTAGAGGAGGCCAGG + Intronic
1178846483 21:36178100-36178122 GTGTAGCTGTATATCAAGGTAGG + Intronic
1179117314 21:38505705-38505727 TTGTAGCTGTAAATAAAGGCTGG - Intronic
1181388654 22:22563159-22563181 TTGTGGCTGTATATGGAGATGGG - Intronic
1182642532 22:31779982-31780004 TTGTAGCTGCTGAGGAGGCTGGG + Intronic
1183791779 22:40077164-40077186 TTGTAGGGGTTGAGGAAGCTGGG - Intronic
1184509250 22:44922891-44922913 TTGAATCTGTAGATCAATCTGGG - Intronic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949264041 3:2136270-2136292 ATGAAGCTGTACCTGAAGCTAGG + Intronic
949410936 3:3763602-3763624 TTGTTGCTGGAGAGCAAGCTAGG - Intronic
949515427 3:4803025-4803047 TTGCAGCTGTACAGGAAGCATGG + Intronic
950517185 3:13474976-13474998 CTGTGGCTGTAGAAGCAGCTGGG + Intergenic
951189920 3:19756084-19756106 TTGTAGCTGGAGAAGAATGTGGG + Intergenic
951435577 3:22659545-22659567 TTGTATCTGTAGATAAATTTGGG - Intergenic
951760825 3:26145691-26145713 TTGTTGGTGTAGCAGAAGCTGGG + Intergenic
952156981 3:30654208-30654230 TTGTTGTTGTAAATGAGGCTTGG + Intronic
954171370 3:48805369-48805391 TTCCAGCTGTAGCTGAAGCTTGG - Intronic
960478153 3:118156928-118156950 TTGAATCTGTAGATGAATTTTGG - Intergenic
960882112 3:122355618-122355640 TTGGAGCTGCAGGGGAAGCTGGG + Intergenic
962194322 3:133347202-133347224 TTGAATCTGTAGATCAAGTTGGG + Intronic
963604822 3:147405221-147405243 TTGTATCAGTAGATCAGGCTGGG + Intronic
963694620 3:148550094-148550116 TTGTAGTTTTAGATGAATTTTGG - Intergenic
964057903 3:152484232-152484254 TTGTGACTGTAGAGAAAGCTGGG + Intergenic
965463368 3:168997083-168997105 AAGTGGCTGAAGATGAAGCTTGG - Intergenic
965803332 3:172516655-172516677 ATGTAGTTGGAGGTGAAGCTGGG + Intronic
966914147 3:184575665-184575687 TTGTAGCTGCAGCTGGAGTTAGG + Intronic
966922827 3:184625314-184625336 TTTTAGCTGCAAAAGAAGCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970469676 4:16364589-16364611 TTGTTGCTGTTGATGATGATTGG + Intergenic
970722216 4:19001119-19001141 TTGTAGGCTTAGATGAAGCCTGG + Intergenic
973634339 4:52848065-52848087 TTGTAGATGCAGATGAATGTAGG - Intergenic
973795802 4:54425154-54425176 TTGTAGCTGGAGATGGTGGTTGG + Intergenic
974854908 4:67449358-67449380 TTGAATCTGTAGATTAAGTTGGG - Intergenic
975958394 4:79870276-79870298 TTGAAGCTATAGATCAAGTTGGG - Intergenic
976193340 4:82510021-82510043 TTAAAGCTGTAAATGAAGATTGG - Intronic
976893705 4:90082285-90082307 TGGTAGCTAGAGATGCAGCTTGG - Intergenic
977483683 4:97613953-97613975 TTGTAGCTGTAGATGAAGCTAGG - Intronic
977790776 4:101099904-101099926 TTTTAGGTGTAGATGGACCTTGG - Intronic
978850999 4:113336255-113336277 TTGTAGCTGGAGATTAATTTTGG - Intronic
979071267 4:116209867-116209889 TTGAATCTGTAGATCAAGATGGG - Intergenic
979191504 4:117864844-117864866 TTGTAACAGTAGATGAAACATGG + Intergenic
980664463 4:135911667-135911689 TTGTAGCTGCCTATGAAGTTGGG + Intergenic
982399117 4:154946538-154946560 TTGCAGCTGAAGATTAAGCCCGG + Intergenic
983093279 4:163532021-163532043 TTGAATCTGTAGATCAAACTGGG - Intronic
984636632 4:182117856-182117878 TTGAATCTGTAGATCAAGTTGGG + Intergenic
985638852 5:1053787-1053809 TTGCAGATGTAGATGTAGTTAGG - Intronic
985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG + Intergenic
990514510 5:56519102-56519124 TTGTGGTTCTAGATGGAGCTGGG + Intronic
991119146 5:62991077-62991099 TTGAATCTGTAGATCAAGTTGGG + Intergenic
991530730 5:67611108-67611130 GTGAAGCTGGAGATGAAGCTTGG - Intergenic
992208113 5:74450972-74450994 TTGTAGCTGTAGAGGGAGTGTGG + Intergenic
992601074 5:78400433-78400455 TTGAATCTGTAGATCAAGTTGGG + Intronic
996592897 5:125167779-125167801 TTGAATCTGTAGATCAAGTTGGG - Intergenic
996901267 5:128543900-128543922 TAGTAGGTGTATATGAATCTTGG - Intronic
998076677 5:139242123-139242145 TTGAAGCTGTAGATCAATTTGGG - Intronic
999733555 5:154494560-154494582 AAGTAGCTGCACATGAAGCTGGG + Intergenic
1000640701 5:163698589-163698611 TTGATGCTCTGGATGAAGCTGGG + Intergenic
1002695097 5:181082237-181082259 TTGAATCTGTAGATGAAATTAGG - Intergenic
1008863115 6:56175704-56175726 TTGAATCTGTAGATCAAGTTAGG - Intronic
1013275675 6:108582710-108582732 GTGTAGCTGTATATTAAGATGGG + Intronic
1013600478 6:111699544-111699566 TTGTGTCTGGAGAAGAAGCTGGG - Intronic
1014115358 6:117663215-117663237 TTGTGGCTGGAGATGTGGCTGGG + Intergenic
1014634905 6:123833493-123833515 TTGAAGCTATAGATCAAGTTGGG + Intronic
1014784645 6:125604461-125604483 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1014856167 6:126403976-126403998 TTGGAACTGTAAATGAGGCTTGG - Intergenic
1015144027 6:129966002-129966024 TTCTAACTTTAAATGAAGCTTGG - Intergenic
1015158845 6:130128579-130128601 TTTTAGCTGAAAAGGAAGCTGGG + Intronic
1016383408 6:143508537-143508559 TCGCAGCTGTAGTGGAAGCTGGG - Intronic
1017128019 6:151084082-151084104 ATGTAGCTATAGATGTAGCCAGG - Intronic
1017710317 6:157161847-157161869 CTGTCACTGTAGATGTAGCTGGG - Intronic
1021331526 7:19344174-19344196 TTGAATGTGTAGATTAAGCTGGG + Intergenic
1021852129 7:24818715-24818737 TTGTGATTGTAGATGTAGCTGGG - Intronic
1023838756 7:44083722-44083744 TTGAATCTATAGATCAAGCTGGG + Intergenic
1027387976 7:77677297-77677319 TTGAATCTATAGATGAAGTTGGG + Intergenic
1027562797 7:79753221-79753243 TTGTTGTTCTATATGAAGCTTGG + Intergenic
1028543722 7:91974667-91974689 TTGAATCTGTAGATGAATTTGGG + Intronic
1028567916 7:92253323-92253345 TAGTAGGGGTAGATGAAGGTGGG - Intronic
1029092224 7:98057247-98057269 TGGTAGATGAAAATGAAGCTTGG + Intergenic
1029092250 7:98057405-98057427 TGGTAGATGAAAATGAAGCTTGG + Intergenic
1031960807 7:127988170-127988192 TTCTATCTGTAGATGTAGCTCGG + Intronic
1034024969 7:147691492-147691514 TTGAATCTGTAGATCAAGTTAGG - Intronic
1035218879 7:157392842-157392864 TTGTATCACTACATGAAGCTGGG + Intronic
1036567443 8:9949551-9949573 TTCTAGCTGCAAAGGAAGCTGGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039196477 8:35037301-35037323 TTATATCTGTAGATAAAGTTGGG - Intergenic
1040784981 8:51155017-51155039 TTGGAGATGAAGCTGAAGCTAGG + Intergenic
1041201896 8:55458053-55458075 TTTCAGCTGTAGATCAATCTGGG - Intronic
1041577309 8:59413753-59413775 ATGAACCTGTAGATCAAGCTGGG - Intergenic
1042941568 8:74113885-74113907 TTCTAGCTTTACATCAAGCTAGG + Intergenic
1044571956 8:93729802-93729824 TTGTTGTTGTAGTGGAAGCTAGG - Exonic
1047128329 8:121988311-121988333 TTGAATCTATAGATCAAGCTGGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1059439065 9:114292679-114292701 TTGTAGCAGCAGATGTAGTTGGG - Intronic
1062594455 9:137292446-137292468 TTGAATCTGTAGATGAATTTGGG + Intergenic
1186457829 X:9724206-9724228 TTGTAACAGGAGATGAAGCATGG + Intergenic
1188335594 X:28928363-28928385 TTGTATCTGTAGAGGAAGAAGGG - Intronic
1190402456 X:50051582-50051604 TTGAATCTATAGATCAAGCTGGG + Intronic
1190559506 X:51673102-51673124 TTGTACCTGTACATGCAGGTAGG + Intergenic
1190564785 X:51720219-51720241 TTGTACCTGTACATGCAGGTAGG - Intergenic
1191684520 X:63875976-63875998 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1192420683 X:71027427-71027449 TAATAGTTGTAGAAGAAGCTGGG + Intergenic
1195587339 X:106579931-106579953 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1195877453 X:109557019-109557041 TAGTAACTGAAGGTGAAGCTTGG + Intergenic
1196112167 X:111958280-111958302 ATGTAGATGGAAATGAAGCTAGG - Intronic
1196182561 X:112708414-112708436 TTGAAGCTGTAGATCAATTTAGG + Intergenic
1198726503 X:139683408-139683430 TTGAATCTGTAGATGAATTTAGG - Intronic
1199409495 X:147504317-147504339 GTGTAGCAGTTGATGAAGGTTGG - Intergenic