ID: 977484925

View in Genome Browser
Species Human (GRCh38)
Location 4:97632937-97632959
Sequence AATTATATTTAGAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977484920_977484925 -9 Left 977484920 4:97632923-97632945 CCATGCACTGTTCTAATTATATT 0: 1
1: 0
2: 6
3: 69
4: 574
Right 977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG 0: 1
1: 0
2: 2
3: 39
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977484925 Original CRISPR AATTATATTTAGAAGGGGGA TGG Intronic
901169670 1:7247417-7247439 AGTCATATTTAGAAAGGGCAAGG + Intronic
901759523 1:11461686-11461708 AATTATTTTGTGAAGTGGGAGGG + Intergenic
902053568 1:13582774-13582796 AAGTAAATTTATAATGGGGAGGG + Intergenic
903430024 1:23289435-23289457 AATTATATTGTTTAGGGGGAGGG - Intergenic
904935305 1:34125959-34125981 AGTGATATTCAGAAGGGAGAGGG + Intronic
906249209 1:44298361-44298383 AATTAGATTTGAAAGGGTGAGGG + Intronic
906854520 1:49290537-49290559 AATTGTATTAAGAAGGGGAAAGG + Intronic
907895114 1:58681000-58681022 AGTTATTTTTAGAAGGGACAGGG + Intronic
908218440 1:61979218-61979240 ATTTTTATTTAGAAATGGGAGGG + Intronic
908870571 1:68606364-68606386 AATGATATTTAGTAGGTGGATGG + Intergenic
909430953 1:75587258-75587280 AATTTTGTTTAGGAGGGTGATGG - Intronic
911395984 1:97310746-97310768 AATTATATATACAAGTGAGATGG + Intronic
911680934 1:100714373-100714395 AAGTAAATTTAGAAGAGGGAAGG + Intergenic
911838825 1:102656000-102656022 AATTGTTTTTCAAAGGGGGAAGG + Intergenic
912578281 1:110695658-110695680 AATTATTTTCAGAATGGGGATGG - Intergenic
912810633 1:112791521-112791543 AATTAGATTTGGAAGGGTGCAGG - Intergenic
913063736 1:115231013-115231035 AAGTATATTTAGGAGTGGCAAGG - Intergenic
913380094 1:118201195-118201217 AAATATATTTATAAGGGTAATGG - Intergenic
914684933 1:149969996-149970018 AAATCTATTCAGAAGGGGGCTGG - Intronic
914695334 1:150072884-150072906 ATTTATTTTTTGAAGTGGGAAGG + Intronic
914781961 1:150793479-150793501 TATTATATTTTGAAGAGGCAGGG + Intergenic
918027573 1:180767110-180767132 ATTTGGATTTAAAAGGGGGAGGG + Intronic
918985212 1:191616277-191616299 AATCCAATTTAGAAGAGGGAAGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
919435109 1:197548752-197548774 AATTATATTTGAAAGGGAAAGGG + Intronic
919435934 1:197561042-197561064 AACTATATTCAGAAGAGAGAAGG - Intronic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
921233366 1:213097058-213097080 AATAATATTTTGAAAGGGCAGGG + Intronic
921660863 1:217800762-217800784 AATTAATTTTAGCAGGTGGAAGG - Intronic
924212571 1:241786037-241786059 AGTAAAATTTAGAAGGGTGAGGG - Intronic
1063226399 10:4019050-4019072 ATGTATATTTGGAAGAGGGAGGG + Intergenic
1063639465 10:7815997-7816019 AGTCATCTTTAGGAGGGGGATGG + Intergenic
1064830118 10:19454282-19454304 ATTTATTTCTATAAGGGGGAAGG + Intronic
1065581427 10:27175581-27175603 AACTATATTTAGAAGAGGTAAGG - Intronic
1066092824 10:32042663-32042685 AAGTATATTTAAAAGGGTGAGGG - Intronic
1067185313 10:44022193-44022215 AATTAGCTTGAGAAGAGGGATGG + Intergenic
1067912440 10:50359997-50360019 ACTTGCATTTAGAAGGGGAAAGG + Intronic
1067966666 10:50921263-50921285 AAATATATCTAGATTGGGGATGG + Intergenic
1068089412 10:52414081-52414103 AAATATATTTTGAAGAGGTATGG + Intergenic
1068209361 10:53900358-53900380 ACTGATAGTTTGAAGGGGGAGGG + Intronic
1070841259 10:79489583-79489605 AAGAATACTGAGAAGGGGGAAGG - Intergenic
1070942826 10:80361636-80361658 AAGTAGATTAAGAAGGGAGAAGG - Intronic
1071033656 10:81216014-81216036 AATTATATATAGAATGTGTAAGG + Intergenic
1071089036 10:81897745-81897767 AATGATATTTAAAAGGGTGGTGG + Intronic
1072468801 10:95693061-95693083 AGATATATTTAGAAGGGGCGGGG + Intronic
1072473349 10:95734558-95734580 AATTAAACGGAGAAGGGGGAAGG + Intronic
1073619762 10:105034836-105034858 AATTATATGAACAAGGGGGAGGG - Intronic
1079418686 11:20265011-20265033 AATCATATTTTGAAGGCGGCAGG + Intergenic
1079592757 11:22200796-22200818 AATTGTATCTTGATGGGGGATGG + Intronic
1080119599 11:28661961-28661983 AGTTTTAGTTAGGAGGGGGATGG - Intergenic
1080206804 11:29738690-29738712 AATTTTATTTTGGAGGGAGAGGG + Intergenic
1082219416 11:49615952-49615974 AATCATATTTAGAAGATAGAAGG - Intergenic
1085971154 11:81592257-81592279 AATTATTTTTATAAAGGGTATGG + Intergenic
1086103388 11:83125020-83125042 AATTATATTTTCAGGGAGGAGGG - Intergenic
1086332330 11:85766395-85766417 AATCATATGTAGAAGAGAGACGG + Intronic
1086487155 11:87318613-87318635 AATATTATTCAGAAGGAGGATGG + Intronic
1087906471 11:103703472-103703494 CAATATAGTTAGAAGGGTGAAGG - Intergenic
1088643951 11:111901052-111901074 AATCCTATTTAGAACTGGGAAGG - Intergenic
1088683033 11:112260699-112260721 ATGTATATTCAGAAGGGGCAGGG - Exonic
1091270247 11:134305864-134305886 AATTAAATATAGAAGTTGGAAGG + Intronic
1092254090 12:6916828-6916850 AATCATGGTTACAAGGGGGAAGG + Intronic
1093139875 12:15496945-15496967 CATTATATTTATAGGTGGGATGG + Intronic
1095561277 12:43569106-43569128 AAATATATTTTGAAGAGGTATGG - Intergenic
1095922048 12:47541513-47541535 AATGATATTTGGGAGGCGGAAGG - Intergenic
1095992819 12:48049282-48049304 AATTCTGACTAGAAGGGGGAAGG + Intronic
1096712548 12:53468015-53468037 CATCATTTTTAGAAGGGGGTTGG - Intronic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097618176 12:61908154-61908176 AATTAGATTTGGAAGGGGCCAGG + Intronic
1098225542 12:68318388-68318410 AATTTTATTTAGAAAGGAGGGGG + Intronic
1100396476 12:94190160-94190182 AGTAATATTGAGAAGGGGAAAGG + Intronic
1100434757 12:94561368-94561390 GATAATATTTGGAAGGGGGAAGG - Intergenic
1102136153 12:110577537-110577559 AATTATATTTAGGAAGTGAATGG - Intronic
1104509412 12:129362913-129362935 AATTAAAGTTAGAAGGTTGAAGG - Intronic
1104793206 12:131497176-131497198 AAGTATATTTAGAAGGGAAAAGG + Intergenic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1109562157 13:64064195-64064217 CTTTATATTTATAAGGGAGAAGG - Intergenic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1110347484 13:74465250-74465272 AAATATATTTACAATGGGGGTGG - Intergenic
1110467192 13:75815325-75815347 AGATATATTTAGAAGGCAGAGGG + Intronic
1110678712 13:78282546-78282568 AATTCTTTTTGTAAGGGGGATGG - Intergenic
1111343635 13:86920278-86920300 AATGATATTTGGAAGAGGAAGGG + Intergenic
1111845070 13:93497502-93497524 AATTGTATTTCAAAGAGGGAAGG + Intronic
1112100462 13:96183471-96183493 GGTTATAATTAGAAGGGGGTGGG - Intronic
1112760478 13:102689098-102689120 TATTATTTTTAAAAGGGAGATGG + Intronic
1112800623 13:103105735-103105757 AATTATATGTATAAGGGCTATGG - Intergenic
1113085466 13:106565774-106565796 AATAGTATTTAGGAGGGAGAAGG - Intronic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113541052 13:111109987-111110009 AGTTATATTTAGAAGGAAAAGGG + Intergenic
1114281467 14:21196067-21196089 AATTGTATTATGAATGGGGAGGG + Intergenic
1114362457 14:21989960-21989982 AAATAAATTTAGAATGGTGATGG - Intergenic
1116029100 14:39549539-39549561 AATTATTTTTTGGTGGGGGATGG + Intergenic
1118329283 14:64803154-64803176 AAGGAAATTTAGAAAGGGGAAGG - Intronic
1118537533 14:66784573-66784595 AATCATATTTAAAATGTGGAAGG + Intronic
1119979873 14:79068031-79068053 AAATATATCTAGAAAGGGTAAGG - Intronic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1120713211 14:87814616-87814638 AATTTGGTTTAGAAAGGGGAGGG - Intergenic
1124697704 15:31879585-31879607 AATTGTATTTCAAAAGGGGAAGG - Intergenic
1125024348 15:35015697-35015719 AACTTTATTTAGAAGAGGGAAGG + Intergenic
1125162193 15:36657944-36657966 AATTATTTTTAAATTGGGGAAGG - Intronic
1125697107 15:41648059-41648081 AATTATATTTAGAAGCATTAGGG - Intronic
1127475798 15:59331679-59331701 AATGAAATTTAGATGGTGGAAGG - Intronic
1127727668 15:61766205-61766227 AAATATATTTAGAAAGGAGGAGG + Intergenic
1127858141 15:62969291-62969313 AATGATTTTTAGAAAAGGGAGGG - Intergenic
1128899802 15:71410117-71410139 AAATATATCTAGCAGGAGGAGGG + Intronic
1129308145 15:74683832-74683854 CACTATATTTAAAAAGGGGAGGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1132187688 15:99816694-99816716 AATGATATCTAGAAAGGGAAAGG + Intergenic
1133516558 16:6514865-6514887 AATTATTTTAATAAGGAGGAAGG + Intronic
1133893735 16:9905740-9905762 AAAAATATATACAAGGGGGAGGG + Intronic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1137749626 16:50849972-50849994 AATTTTTTTTGGGAGGGGGACGG + Intergenic
1137827200 16:51509102-51509124 AATTATATATAGAAAGGGGACGG + Intergenic
1137914234 16:52411399-52411421 AAATAGATTTAGAATGAGGAAGG - Intergenic
1138312262 16:56037362-56037384 AATTGTATTTAAATGGGGGAAGG - Intergenic
1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG + Intergenic
1141275428 16:82583461-82583483 AATTATATTCAAAGGGGGGTGGG - Intergenic
1141333250 16:83131468-83131490 AGTCATACTTTGAAGGGGGAGGG - Intronic
1142728582 17:1834651-1834673 AATTATATAACGAAAGGGGAAGG + Intronic
1144941090 17:18941542-18941564 AATTTTTTTTTGAGGGGGGACGG + Intergenic
1145402243 17:22551406-22551428 CATTATATGTAAACGGGGGAGGG - Intergenic
1145405978 17:22594576-22594598 ATTTATATTTAAAAGGAGGATGG + Intergenic
1147474664 17:40699195-40699217 AATTATTTTTTGAAGAGGAAGGG + Intronic
1148725389 17:49786072-49786094 AGGTATATTTAGAATGGGGAAGG - Intronic
1149267335 17:54941292-54941314 TTCTATATTTAAAAGGGGGAGGG + Intronic
1150034577 17:61780430-61780452 AATTATCTTTAGAAGAGGCTGGG + Intronic
1150598703 17:66630722-66630744 AATTACATCTACAAGGTGGACGG + Intronic
1150874813 17:68959105-68959127 TATGATATTTAGAAGGGGCCAGG + Intergenic
1150879422 17:69006615-69006637 AATGATTTTTACAAGGAGGAGGG + Intronic
1150957487 17:69875954-69875976 AATTATATTAATAAGGGATATGG - Intergenic
1153908262 18:9683267-9683289 AATTTTACTTAGTAGGGTGATGG + Intergenic
1154171178 18:12052007-12052029 AATTCTATTTAAAAGGGGGGAGG - Intergenic
1155218569 18:23664023-23664045 AATTTAATTGAGAAGAGGGAAGG - Intergenic
1156469848 18:37370376-37370398 CATTACACTTAGAAGGGGTATGG + Intronic
1156538780 18:37889253-37889275 AAATAGATTTAGAAGGAGCAAGG + Intergenic
1157049789 18:44149534-44149556 AATTTTCTTTAGGAGGGAGACGG + Intergenic
1158428237 18:57358947-57358969 AATTTCATTTGGAAGGGGAAAGG + Intronic
1158681483 18:59571041-59571063 TATTATACTCAGAAGTGGGAGGG - Intronic
1158761200 18:60389200-60389222 AATTATATTTAATAGGTGTAGGG + Intergenic
1158978749 18:62737895-62737917 GATTATATGTGGAGGGGGGAAGG + Intronic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1159212881 18:65350278-65350300 AATAATAATTAAAAGGGTGATGG - Intergenic
1159251420 18:65882381-65882403 AATTATTTTTAAAAGGAGAAAGG - Exonic
1160235717 18:77084935-77084957 GATCACATTAAGAAGGGGGAGGG + Intronic
1163436535 19:17299237-17299259 AATTATATAGAGAATGGGGGGGG - Intronic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1165467173 19:35981837-35981859 TATTATTATTAGAAGGGTGAGGG + Intergenic
1165503291 19:36207246-36207268 ATTTATATTTAAAAGGGGCGGGG + Intronic
1166664717 19:44672090-44672112 AATTAGAATAAGATGGGGGAGGG + Intronic
1168541355 19:57213165-57213187 AATTATTTTTAAAAGGAGGAGGG + Exonic
925984160 2:9201839-9201861 AATTATACTCAGAAGTGGGCTGG + Intergenic
926831983 2:16973350-16973372 AATTATATTTTTAAGAGGAAAGG + Intergenic
927743933 2:25598593-25598615 AATTATATTTTGAAGGAGTGTGG - Intronic
928750016 2:34459798-34459820 AATGATATTTGGAAGGGGCCAGG + Intergenic
929023996 2:37581699-37581721 AATTAGAGTTACAAGGTGGAAGG - Intergenic
929214715 2:39399873-39399895 CATAATATTTATATGGGGGAGGG + Intronic
929443372 2:41983669-41983691 AATTACACTTAGAAGAAGGAAGG + Intergenic
930284452 2:49410499-49410521 AATTATACTTAAAATGGGCAAGG - Intergenic
930410014 2:51013473-51013495 AATTAGGTTTTGTAGGGGGAGGG + Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930646391 2:53913525-53913547 ATTTTTATTTGGAAGGGGAAGGG - Intronic
930966334 2:57332996-57333018 AAAGATATGTAGAAGGGGTAGGG - Intergenic
931874540 2:66497770-66497792 AATATTATTTAGAAGGCAGAGGG + Intronic
933103991 2:78298566-78298588 AATGATATATTGAAGGGTGATGG - Intergenic
933379520 2:81525124-81525146 AATTATTCTGAGAAGGAGGATGG - Intergenic
933831056 2:86208814-86208836 AATTAGATTTTGAAGAGGCAGGG - Intronic
935359254 2:102233574-102233596 CATTATATTTAGGGAGGGGAGGG - Intronic
936491125 2:112972998-112973020 AAATATATTTTGCAGGGGGTTGG + Intergenic
937169681 2:119853574-119853596 AATTATATTATAAAGGGGGAAGG - Intronic
938050310 2:128163725-128163747 AATTAATTTTAGAAGAGGCAGGG + Intronic
938179796 2:129170139-129170161 AATAATATTTAGATGATGGATGG - Intergenic
938937768 2:136142404-136142426 AACTATACTGAGTAGGGGGAGGG + Intergenic
939448058 2:142335020-142335042 ATTTATATTTAAAAGGGAAATGG - Intergenic
939667442 2:144968861-144968883 AATTAGATTTGGAAGGGGCCGGG - Intergenic
939900754 2:147846422-147846444 GATTATATTTAAAGGGGGGTGGG - Intronic
940651305 2:156443645-156443667 AAGGATATTTAGGAGAGGGAAGG + Intronic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
940792667 2:158044910-158044932 AAATATATTTATAAAGGGTAGGG - Intronic
941111882 2:161425138-161425160 TATTCTATTTAGAAGGTGGGGGG - Exonic
941278566 2:163521367-163521389 ATTTATATTTAGAAGGAAAATGG + Intergenic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
942371328 2:175288754-175288776 AATTAAATTCATGAGGGGGAAGG - Intergenic
942826252 2:180180441-180180463 AATTTTTTTTAGAAGGTGGGGGG - Intergenic
943068078 2:183109622-183109644 AATTATATTGCAAATGGGGAAGG + Intergenic
943370430 2:187009631-187009653 AATAAAATGAAGAAGGGGGAAGG - Intergenic
943515256 2:188877692-188877714 AGTTATTTTTATAAGGAGGATGG - Intergenic
943590247 2:189787136-189787158 GATGATATTTAGAAGGTAGATGG + Intronic
943839759 2:192564231-192564253 TATTAAATATAGAGGGGGGAGGG - Intergenic
944075446 2:195724808-195724830 AATTTTATATGGAAAGGGGAAGG + Intronic
946350464 2:219147961-219147983 AAATATATTAAGAAGGTGGCTGG + Intronic
946623337 2:221583026-221583048 ATTTATATAAAGGAGGGGGAAGG + Intergenic
946778906 2:223172714-223172736 AATTATTTTTTGTAGGGGCAGGG - Intronic
947347088 2:229203278-229203300 AGTTATATCTACAAAGGGGATGG + Intronic
1168802882 20:654484-654506 AATTATGTTTCGAAAGGGAAAGG - Intronic
1169715049 20:8606619-8606641 AATTATATTTGTAAGTGAGATGG + Intronic
1169995470 20:11551335-11551357 ATTTGTATTTAGAAAGGGGAAGG - Intergenic
1171293867 20:23999505-23999527 AGTTTTATTTAGAAGGATGAAGG + Intergenic
1172382109 20:34503289-34503311 TATTTTAATTAGAAGGGGGCAGG - Intronic
1177728921 21:25003255-25003277 AATTATTTTCAGAATGGAGAAGG - Intergenic
1179576154 21:42309783-42309805 ATTTGTATCTAGAAGGGGCAGGG + Intergenic
1180898197 22:19352684-19352706 AATTATAATCAAAATGGGGAGGG + Intronic
1181267530 22:21639487-21639509 AATTATAGTTGGTAGGTGGAGGG + Intergenic
1184961926 22:47936102-47936124 AATTATATTAAAAATGGGGAAGG + Intergenic
949832280 3:8228085-8228107 AATGATATTTAAAAGTGGGAAGG - Intergenic
951073083 3:18355151-18355173 AAAAAAATTTAAAAGGGGGAGGG + Intronic
951267452 3:20585949-20585971 AATTATATTTACTTGGAGGAGGG + Intergenic
951611003 3:24493775-24493797 ATTTATTTTAAGGAGGGGGAGGG - Intronic
952323931 3:32303621-32303643 AATTACAGTTGGGAGGGGGAGGG - Intronic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
953517480 3:43608982-43609004 AATTAAATTTAAAAGGCGGTAGG - Intronic
953833816 3:46326191-46326213 AAAGATAGTGAGAAGGGGGATGG - Intergenic
954951718 3:54480662-54480684 AAATATCTCTAGAAGGAGGAAGG - Intronic
955127451 3:56127553-56127575 AATTATTTTTAGTAGGGACAGGG - Intronic
955795519 3:62632744-62632766 AATGAAATCTAGAAGGGGAAGGG + Intronic
956123859 3:65993001-65993023 AATTATTTTTAGTAGAGGCAGGG + Intronic
956205061 3:66747031-66747053 AATTATATTTAGGAGTGGTAGGG - Intergenic
956239009 3:67108055-67108077 AATAACATTTGGAAGGGGAATGG + Intergenic
956254275 3:67266975-67266997 AATCAAATTTAAAAGGGGCAAGG - Intergenic
956429614 3:69172604-69172626 TAATATATTTAGAAGGTGGCAGG + Intronic
956514913 3:70035928-70035950 AATTATAGTTAGAAAGTGGGAGG + Intergenic
956571043 3:70695364-70695386 AATTAAATTACGAAGTGGGAAGG - Intergenic
956618550 3:71197896-71197918 AATTTTATTCAAAATGGGGAAGG + Intronic
957644019 3:82896095-82896117 AAATATATTTTGTTGGGGGAAGG - Intergenic
958019914 3:87982216-87982238 AAAAATATTTAGAAAGGGCAGGG - Intergenic
958634763 3:96729702-96729724 AATAATTTTTAAAAGGGGGATGG - Intergenic
959356719 3:105340580-105340602 AAAAGTATTTAGAAGGAGGAGGG - Intergenic
959400703 3:105898621-105898643 AATTATCTTTAAAGTGGGGAAGG + Intergenic
960441015 3:117689031-117689053 ATTTTTATTTAGAAAAGGGATGG + Intergenic
961848186 3:129786597-129786619 ATATATATTTAGAAGAGGGAAGG - Intronic
962986386 3:140539988-140540010 CATCATGTTTAGTAGGGGGAGGG + Intronic
963309363 3:143691662-143691684 AGTCTTATTTAGAAGGAGGAAGG - Intronic
964455234 3:156857979-156858001 AAATGTATTTTGTAGGGGGAGGG + Intronic
964609128 3:158591508-158591530 GATTGGAATTAGAAGGGGGAAGG + Intronic
966075673 3:175934489-175934511 TATTATATTTAAAAAGGAGAAGG + Intergenic
967588986 3:191249691-191249713 AAATAAAATTTGAAGGGGGACGG + Intronic
967669274 3:192213157-192213179 AATTGTGCTTACAAGGGGGAAGG - Intronic
968240442 3:197077847-197077869 TATTATTTTTTGGAGGGGGAAGG + Intronic
969171139 4:5364678-5364700 AATCATATTCAGTAGGGAGAGGG + Intronic
970073905 4:12195901-12195923 ACTTATATTTAAAAGGGGAGGGG - Intergenic
970382534 4:15522462-15522484 AGTTTTATTTAGAAGGGAGTTGG + Intronic
971330620 4:25678230-25678252 ATTGATATCTACAAGGGGGAGGG - Exonic
971997566 4:33984922-33984944 ATATATATTTAAAAGGAGGATGG - Intergenic
972071546 4:35025149-35025171 AATTATATTTAGCAGAGAGAGGG - Intergenic
972459823 4:39290943-39290965 AATTATGTTTAGAAGCTTGAAGG - Intronic
972938902 4:44172692-44172714 ACTTATATTGGGAAGAGGGAAGG + Intergenic
972962615 4:44472773-44472795 AATTAGATGTAGAAAGGGAAGGG + Intergenic
973671743 4:53226292-53226314 AATTATTTTTATGGGGGGGAGGG + Intronic
974977706 4:68911906-68911928 TATTATATTTATAGGAGGGAAGG + Intergenic
975647160 4:76556325-76556347 AATTATTTATGGAAAGGGGATGG + Intronic
976015987 4:80555028-80555050 AATAATATGTAGAATGGGAATGG + Intronic
976588823 4:86828648-86828670 AATTTTATTTGGAGGGGAGAAGG - Intronic
976803839 4:89023494-89023516 AAGTATATTTATTTGGGGGAAGG - Intronic
977381283 4:96277538-96277560 AAGTATATTTAGAAAAGAGATGG - Intergenic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
977912136 4:102549553-102549575 AATTATATATATATGGGGGGAGG + Intronic
981186221 4:141807145-141807167 AAATATATTGAAAAGGGCGATGG - Intergenic
981796747 4:148604401-148604423 AATTATCATGAGAATGGGGATGG + Intergenic
982137067 4:152281873-152281895 AATTAAATTTAGGTGTGGGAGGG + Intergenic
983096579 4:163569350-163569372 GGTTATATTTTGAAGTGGGAGGG + Intronic
983575480 4:169256770-169256792 AAAAAAATTTAGAAGGGGGATGG + Intronic
983762873 4:171434973-171434995 ATTTATATTCAGTAGTGGGATGG - Intergenic
984068017 4:175073902-175073924 AATGATATCTAGAATGGTGAAGG + Intergenic
986424908 5:7621665-7621687 AGGTATATTTAGAAGGGCTATGG + Intronic
987953300 5:24704214-24704236 AATTATATTCAAAAGTGGAATGG - Intergenic
988219338 5:28321889-28321911 AAATATAAATAGAAGTGGGATGG - Intergenic
988392105 5:30647665-30647687 AATCATATGTAAAAAGGGGAGGG + Intergenic
990271354 5:54144164-54144186 AATTATATTTGGAATTGAGAGGG + Intronic
991059757 5:62361266-62361288 AACTATATTTGAAAGGGGAATGG + Exonic
991567795 5:68022677-68022699 AATTATATTTCCAAGGAGGTCGG - Intergenic
992417231 5:76563282-76563304 ATTTAAATTTAGAAGGAGGAGGG + Intronic
992994027 5:82314996-82315018 AATTAAATTTAAAAAGAGGAAGG + Intronic
993050846 5:82924137-82924159 AAATATGTGTTGAAGGGGGAGGG - Intergenic
994628516 5:102251905-102251927 AATTATATTTAAAAGAAAGAAGG + Intronic
994901876 5:105783322-105783344 CATTATATTAAGAACGGGTAAGG + Intergenic
995563263 5:113405991-113406013 ATAATTATTTAGAAGGGGGATGG - Intronic
995627986 5:114100182-114100204 AAATAAATTTAAAAGGGTGAAGG + Intergenic
995787834 5:115849543-115849565 AATTATGTCAAGAAGGGGCATGG - Intronic
996179403 5:120400329-120400351 CATGATATTTGGAAGGGGGTAGG + Intergenic
996462317 5:123760548-123760570 AATTAGATTTGGGAGGGTGATGG - Intergenic
997191805 5:131944966-131944988 ATTTATTTTTAAAAAGGGGAAGG - Intronic
998850713 5:146348236-146348258 AATTCTATTCAGAAGGAGGTGGG - Intergenic
999355187 5:150921696-150921718 AATTACATTTTTAAGGGGGAGGG + Intergenic
999378548 5:151104027-151104049 CAATATCTTTAGAAGAGGGAGGG + Intronic
1000169945 5:158692368-158692390 GATCATATTTGGAAGAGGGAAGG + Intergenic
1000431608 5:161159225-161159247 AACTAGTTTAAGAAGGGGGATGG - Intergenic
1000588910 5:163134482-163134504 AAGTATATTTAGAAAAGTGATGG - Intergenic
1000895869 5:166854695-166854717 ATTTATATTCAAGAGGGGGAAGG + Intergenic
1001126870 5:169027631-169027653 TATTACATTCAGGAGGGGGAAGG - Intronic
1003723558 6:8733494-8733516 CATCAGATTTAGAAGGGGGAGGG + Intergenic
1004653000 6:17630187-17630209 AGTTACATTTGGAAGTGGGAGGG + Intronic
1005212184 6:23479360-23479382 AATGATCTTTAAAAGGGTGAAGG + Intergenic
1005238121 6:23790091-23790113 CATTATATTTAAAATGTGGAAGG - Intergenic
1007543702 6:42674297-42674319 AATTATACTCAGAAGGGGTAAGG - Intronic
1007670382 6:43547874-43547896 AATAATATTTGGGAGTGGGAAGG - Intronic
1008284466 6:49630581-49630603 TAATATATTTAGAGGGAGGAAGG - Intronic
1008838723 6:55870515-55870537 AAGTTTTTTTTGAAGGGGGATGG - Intronic
1009228893 6:61040877-61040899 CATCATATTTAGAAGGAGAAAGG - Intergenic
1009646711 6:66412831-66412853 AATTTTGTTTAGAAGAGGGGTGG + Intergenic
1010237857 6:73589999-73590021 AGTTTTATTTAGAATGGGGGTGG + Intergenic
1010418459 6:75643392-75643414 AATTTTAATTACAAGGGAGATGG + Intronic
1011763665 6:90595228-90595250 AGTGATATTTAAAGGGGGGAGGG - Intergenic
1011845515 6:91559502-91559524 CATAATATTTGGAAGGGGTAAGG - Intergenic
1012000631 6:93650348-93650370 CTTTATATTTACAAAGGGGAAGG + Intergenic
1012090208 6:94883348-94883370 AAGTATATTTACAAGAGGGTTGG - Intergenic
1012113586 6:95264505-95264527 TATTATTTTTAGAAGAGAGAGGG + Intergenic
1012456222 6:99408841-99408863 AATTAGATTTAAAAGGAGAAGGG + Intronic
1012570497 6:100720546-100720568 AATGATATTTAAAAGGAGGTAGG + Intronic
1012697328 6:102403828-102403850 AATGATATTTAAAAGAGAGATGG - Intergenic
1012715066 6:102658211-102658233 AATGACATTTAGAAGGGGAAGGG + Intergenic
1013020575 6:106212132-106212154 AATTAAATCTAGAAAAGGGATGG + Intronic
1013529790 6:111008585-111008607 AATTAAATTTAGAAAGTTGAGGG + Intronic
1014554342 6:122827712-122827734 TATTATATTTGGAAGAGGAAAGG + Intergenic
1015000596 6:128209742-128209764 AGTTATATTTTGAAGGAGCAGGG + Intronic
1015108422 6:129564641-129564663 TATGATATTAAGAAGAGGGAAGG - Intergenic
1015492030 6:133837511-133837533 AAATACACTTAGAAGGGGAACGG + Intergenic
1015572662 6:134637437-134637459 AAGATTATTTAGCAGGGGGAAGG + Intergenic
1015575345 6:134665421-134665443 AATAATTGTTAGAAGGGGGAGGG + Intergenic
1016354638 6:143204751-143204773 GATTATCTTTAGAATGGGGGAGG + Intronic
1016956558 6:149632685-149632707 GATTATATTTAGGAGGAGGATGG - Intronic
1017519815 6:155191999-155192021 AACTATCTTGAGATGGGGGATGG + Intronic
1018408134 6:163509431-163509453 AAAGAAATTAAGAAGGGGGAAGG - Intronic
1018741327 6:166731426-166731448 ATTTATGATTAAAAGGGGGAAGG + Intronic
1021421405 7:20449225-20449247 AATTTTTTTTTGGAGGGGGAGGG - Intergenic
1023658538 7:42450344-42450366 AATTAAATGTAGAAGAGGGAGGG + Intergenic
1025090460 7:56058922-56058944 AATAATGTTTACAAGGGGCAAGG - Intronic
1025880805 7:65534665-65534687 AAATATAAATTGAAGGGGGAGGG + Intergenic
1025892632 7:65667941-65667963 AAATATAAATTGAAGGGGGAGGG - Intergenic
1026075782 7:67166536-67166558 AATTATTTTTAGAGAGGGGAGGG - Intronic
1026236686 7:68533520-68533542 AATCTTATTTGGAAGGAGGAAGG - Intergenic
1026626000 7:71993064-71993086 AACTATATTTGGAATGGGGTGGG - Intronic
1026701073 7:72645752-72645774 AATTATTTTTAGAGAGGGGAGGG + Intronic
1029942145 7:104491484-104491506 AATTATAGGTGGAAGAGGGAGGG + Intronic
1030804689 7:113901311-113901333 AGTCCAATTTAGAAGGGGGATGG - Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031720006 7:125162683-125162705 AATTATTTTAAAAAGGGGGGAGG + Intergenic
1033948642 7:146755292-146755314 AATTATATTCTGAACAGGGACGG + Intronic
1035615287 8:995533-995555 AATTCTATTTGGAAGGGCTATGG - Intergenic
1037584808 8:20269082-20269104 CTTTATTTTTGGAAGGGGGAAGG - Intronic
1038203689 8:25442516-25442538 AATTATATAAAGATGGTGGATGG + Intronic
1038906646 8:31911791-31911813 TATTATATTTAGACAGGGAATGG + Intronic
1039189162 8:34952668-34952690 AATTATATTTTGTAGGGACAGGG - Intergenic
1039295217 8:36143842-36143864 AATGTTATTGAGATGGGGGAAGG + Intergenic
1039730164 8:40266532-40266554 AGGTATATTTAAAAGAGGGAGGG - Intergenic
1040743545 8:50611394-50611416 AATTATAGTTAGTGTGGGGAGGG + Intronic
1041469624 8:58194099-58194121 AATTTTTTTTAAAAGGGGGATGG - Intronic
1041961413 8:63621199-63621221 AATTATATTTAGGAGTGTGAGGG + Intergenic
1042413663 8:68494001-68494023 ATATATACTTAGAAGTGGGATGG - Intronic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043438572 8:80257176-80257198 ATTTCTATTTAGTTGGGGGAGGG - Intergenic
1043771552 8:84208378-84208400 AATCATATTTTGAGGGGAGAAGG - Intronic
1044245168 8:89935636-89935658 AATGATATTTAGATAAGGGATGG + Intronic
1044592420 8:93927137-93927159 AATTATCTTTAAAGGGGGGCAGG - Intergenic
1045205127 8:100030953-100030975 AATTATATGTAAAATGGGCAAGG + Intronic
1045736740 8:105304906-105304928 AATCATACTTGGAAAGGGGAAGG - Intronic
1046846530 8:118922300-118922322 AATTATTTTTGGGAGGGGGGCGG - Intergenic
1047021258 8:120777058-120777080 CACTAGATTTAGAACGGGGAAGG + Intronic
1047067715 8:121304781-121304803 AAATATTTTTAGAAGAGGGTGGG - Intergenic
1047701093 8:127450085-127450107 AATCATATATAGAAGGGAAAAGG + Intergenic
1048105923 8:131409857-131409879 AATTGTATTTAGAACAAGGAAGG - Intergenic
1048655660 8:136533061-136533083 CATTGTATTTAGAAAGGTGAAGG - Intergenic
1050069414 9:1794724-1794746 GATTATAAATAGAGGGGGGAGGG + Intergenic
1050273917 9:3976516-3976538 ACTCATACTTAGAAAGGGGAAGG - Intronic
1050338494 9:4612809-4612831 ATTAATATTCAGGAGGGGGATGG + Intronic
1050516608 9:6451002-6451024 AATTAAATTTAGAGGAGGAAAGG + Intronic
1051004879 9:12331559-12331581 AATTGAATTTAGAAGGTGGCAGG + Intergenic
1051696763 9:19776122-19776144 AAATATATTTACATGGGGCATGG + Intronic
1052292288 9:26856115-26856137 AATTTTTTTTAAAAGGGGGGGGG + Intronic
1052630698 9:31035087-31035109 AAATATATTTATACAGGGGAGGG + Intergenic
1052667196 9:31510217-31510239 AATATTATTGAGATGGGGGAAGG - Intergenic
1052921282 9:33971885-33971907 AGTTATATTTAAATAGGGGAAGG - Intronic
1055764892 9:79652125-79652147 ATATATTTTTAAAAGGGGGAAGG - Intronic
1056006945 9:82282788-82282810 AATTATATTTAAAAAGGTGCTGG + Intergenic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1057379855 9:94557888-94557910 AATTATGTTAAGACTGGGGAGGG - Intergenic
1059780156 9:117517798-117517820 AATTCTTTCTAGAAGGGGAAAGG + Intergenic
1060777889 9:126389966-126389988 TATTATATTTTGAGGGGGGTAGG - Intronic
1061692089 9:132341456-132341478 ATTTATATTTAGGAAGGGGAGGG - Intronic
1185512201 X:671924-671946 ATATACATTTAGAAAGGGGAAGG - Intergenic
1186972005 X:14856771-14856793 CATAATTTTTAAAAGGGGGAAGG + Intronic
1189311055 X:40017897-40017919 CTTTATATTGAGAAGCGGGAGGG - Intergenic
1189786150 X:44560446-44560468 AAGTGTTTTTTGAAGGGGGAAGG + Intergenic
1190229141 X:48568297-48568319 TATGATATTTAAAAGGGGGCTGG + Intergenic
1192323971 X:70116521-70116543 AAAGATATTTTGAAGGGTGAGGG + Intergenic
1194397721 X:93405891-93405913 AATTATATCAAGATGGGAGAAGG + Intergenic
1194706601 X:97182397-97182419 AATTTTATTTAGAAGGCTGAGGG + Intronic
1195361594 X:104087584-104087606 AATTATAGTGAGAAGGGCTAGGG - Intergenic
1195532058 X:105968775-105968797 AATGAAATTTAGAGGGTGGAGGG + Intergenic
1195990311 X:110675999-110676021 AATTATATGTGGGAGGAGGAGGG - Exonic
1196329840 X:114458694-114458716 AAATATATTTAAAAGGGGCCGGG + Intergenic
1196507208 X:116461634-116461656 AATTATTTTTTTAAGAGGGAGGG - Intergenic
1197583389 X:128312443-128312465 ATTTATACATAAAAGGGGGAAGG + Intergenic
1198309268 X:135413919-135413941 ATTTATATTTAGATGGGAGGAGG + Intergenic
1202345374 Y:23917804-23917826 AATTATTTTCTGAAGGAGGAGGG - Intergenic
1202525396 Y:25752285-25752307 AATTATTTTCTGAAGGAGGAGGG + Intergenic