ID: 977490100

View in Genome Browser
Species Human (GRCh38)
Location 4:97700246-97700268
Sequence TGTACAAGCTGCTCTGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 5, 2: 9, 3: 10, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977490100_977490104 15 Left 977490100 4:97700246-97700268 CCAGTGGCAGAGCAGCTTGTACA 0: 1
1: 5
2: 9
3: 10
4: 151
Right 977490104 4:97700284-97700306 TACAGAACCTTCTCCTGTACTGG 0: 1
1: 2
2: 16
3: 215
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977490100 Original CRISPR TGTACAAGCTGCTCTGCCAC TGG (reversed) Intronic
901057507 1:6455497-6455519 TGGGCAAGCTGCTGGGCCACTGG + Intronic
903644048 1:24880443-24880465 TGTAGAAGCTGCTTTGGAACTGG - Intergenic
904432624 1:30474673-30474695 TGTGCTAGCTGCTCTGCCACTGG + Intergenic
905478787 1:38247236-38247258 TGTACGGGCTCCTCGGCCACAGG + Intergenic
905892205 1:41524567-41524589 GGAGCCAGCTGCTCTGCCACTGG + Intronic
907322223 1:53611657-53611679 TGTACAAGTTGCTCTGTTTCTGG + Intronic
908789499 1:67767415-67767437 GGAACAAACTCCTCTGCCACGGG + Intronic
910064067 1:83131639-83131661 TGAATAATCTGCTCTGGCACAGG + Intergenic
910194987 1:84630863-84630885 TGTACAGGCTGCTGACCCACAGG + Exonic
911053502 1:93692165-93692187 TGTGCCAGCTGCTCTTGCACTGG - Intronic
912115156 1:106396897-106396919 TGTTCAAACTGCTCTGCAAGAGG + Intergenic
914935759 1:151978541-151978563 AATACAAGCTGCTCTGCCTATGG + Intergenic
915510735 1:156385697-156385719 TCTTCAACCTTCTCTGCCACAGG - Intergenic
916183809 1:162111788-162111810 TCGAGAAGCTGCTCTGCCCCTGG + Intronic
921178733 1:212615170-212615192 AGAACAAGCACCTCTGCCACCGG + Exonic
921286553 1:213614795-213614817 TTTGCAAGCTCCTCTTCCACAGG - Intergenic
921796177 1:219347209-219347231 TGGACAAGCTGCTATGCCCAGGG + Intergenic
923019346 1:230150916-230150938 TCTCTAAGTTGCTCTGCCACTGG - Intronic
923344612 1:233039325-233039347 TGTTCATGCTCCTCTACCACTGG + Intronic
1064279914 10:13942149-13942171 TCTGAAAACTGCTCTGCCACAGG + Intronic
1067026714 10:42848499-42848521 CGTGCATGCTACTCTGCCACAGG - Intergenic
1071942813 10:90607929-90607951 TATGCAAGCTGCTCTGCCACTGG - Intergenic
1072104507 10:92261058-92261080 TGTACAAGCTGATGAGTCACAGG + Intronic
1073591288 10:104759851-104759873 TGTACAAGCTCCTCAAGCACAGG - Intronic
1074977596 10:118594279-118594301 TGGTGCAGCTGCTCTGCCACTGG - Exonic
1076060370 10:127409369-127409391 CTTACAATCTGCTCTGACACTGG - Exonic
1080557990 11:33434540-33434562 TGTGCAAGCTGCTCTGCACTTGG - Intergenic
1080833608 11:35919244-35919266 TGGGCAGGCTGCTCTGCCAGGGG - Intergenic
1080938683 11:36889476-36889498 TGTACAAGTTTTTCTCCCACTGG - Intergenic
1081707183 11:45189440-45189462 TGTACCAGCTACTCTCCCAGTGG - Intronic
1081889518 11:46529140-46529162 TGTCCAAGGTGCTCTGCAAAAGG + Intronic
1085079244 11:73620554-73620576 TGTGCAAGCTGCTCTGCGCTTGG + Intergenic
1086251600 11:84821721-84821743 TGTAGAAGATTCTTTGCCACTGG + Intronic
1089678375 11:120105721-120105743 TGTAGCGGCTGGTCTGCCACTGG + Intergenic
1089819748 11:121213628-121213650 ACTACAAACTGCTCTGACACTGG + Intergenic
1097735268 12:63175491-63175513 TGTAGAAGCTGCTTTGGAACTGG + Intergenic
1101697475 12:107140015-107140037 TGTGCAAGCTGCTCTGCCACTGG - Intergenic
1101965926 12:109281771-109281793 TGGACAAGCTGATCTCCGACCGG - Exonic
1104788389 12:131466559-131466581 TGTACCCGCTGCTCAGCCACAGG + Intergenic
1104863985 12:131941911-131941933 TGGGCAAGGTGCTCAGCCACTGG - Exonic
1105829252 13:24149720-24149742 TGTACAAGCCGCTCTCCCTCTGG - Intronic
1106882200 13:34143816-34143838 TGTACAAGCTGCCCTGCTGGAGG + Intergenic
1108874857 13:55033529-55033551 TAAACAAGCTGCTTTGCCAAGGG - Intergenic
1110168588 13:72473389-72473411 TGTACAATCTTCTGAGCCACTGG - Intergenic
1115226577 14:31109236-31109258 TGAAAAAGATGCTCTGCCAGAGG + Intronic
1117780136 14:59223566-59223588 CGTGCAAGTTGCTCTTCCACTGG - Intronic
1119083876 14:71722104-71722126 TCTCCAAGCTGCTGTGCCAGGGG + Intronic
1120169383 14:81233810-81233832 TGTGCAAGCTGCTTTGCCACTGG + Intergenic
1124795411 15:32773453-32773475 TGTAAAAGGTGCTCTGCCGCTGG + Exonic
1124954266 15:34349682-34349704 TGTACATGGTGCTCTTCCAGTGG + Intronic
1140059195 16:71553339-71553361 TGGACAAGCTGCTCTTCCCTTGG + Intronic
1140929014 16:79609887-79609909 TGTAAATCCTGCTCTGCCCCAGG + Intergenic
1141706329 16:85667179-85667201 TCTACAAGGTGCACTGCCAAAGG - Intronic
1142960781 17:3551278-3551300 TCTAGCAGCTGCTCTGCCCCAGG - Intronic
1143058373 17:4179639-4179661 TGTGCAAGGTCCTCTGCCATAGG + Intronic
1145589299 17:25258290-25258312 TTTCCAAGCTGCTCTGTCAAAGG - Intergenic
1145608099 17:25532821-25532843 TTTCCAAGCTGCTCTGTCAAAGG - Intergenic
1146275931 17:31515571-31515593 TGAAGAAGCTGCTCAGCGACAGG - Intronic
1146278183 17:31528660-31528682 TGTACAAGCTGGACTGCGAGCGG + Exonic
1149314387 17:55424793-55424815 TGTTCAAGCTGTTCTCCCAGTGG - Intergenic
1151646530 17:75436238-75436260 TAGACAAACTGCTCAGCCACAGG + Intergenic
1152776504 17:82205303-82205325 TGTACCAGCTGCCCTGCCACTGG + Intronic
1154908668 18:20614188-20614210 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154909183 18:20622348-20622370 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154909613 18:20628935-20628957 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154910815 18:20647872-20647894 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154910974 18:20650428-20650450 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154911144 18:20652927-20652949 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154911508 18:20658880-20658902 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154912444 18:20673516-20673538 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154912524 18:20674710-20674732 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154913107 18:20683904-20683926 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154913211 18:20685605-20685627 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154923326 18:20842407-20842429 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154923532 18:20845810-20845832 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154923738 18:20849212-20849234 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154923990 18:20853098-20853120 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154924195 18:20856500-20856522 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154924263 18:20857523-20857545 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154924427 18:20860076-20860098 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154925089 18:20920494-20920516 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1154925293 18:20923897-20923919 TTTCCAAACTGCTCTGTCACAGG - Intergenic
1159277116 18:66235345-66235367 TGTGCAAGCTGCTATGCCCTTGG + Intergenic
1164769480 19:30797192-30797214 GATACAACTTGCTCTGCCACGGG - Intergenic
1165453244 19:35897058-35897080 TGTAGGATCTTCTCTGCCACAGG - Exonic
1167951550 19:53031747-53031769 TGTGCAAGCTGCTCTGCCACTGG + Intergenic
1168470407 19:56636115-56636137 TTTACAAGCTGACCTGCCCCAGG + Intergenic
928218111 2:29379237-29379259 TGTGTAAGCTGCTCTTTCACTGG + Intronic
929331446 2:40686310-40686332 TGTTCAAGTTGCTCTGCTTCTGG + Intergenic
929550232 2:42885852-42885874 TGTGCAAGCTGCCCTGCCACTGG + Intergenic
934939511 2:98490219-98490241 TGTCCAGCCTGCTCTGCCCCCGG - Intronic
935239654 2:101167478-101167500 TGTACAAGCAGCTATGGAACTGG + Intronic
935748015 2:106206134-106206156 TGTTCAAGGTGCTCTTCCCCGGG + Intergenic
935767487 2:106383675-106383697 AGAACAAACTTCTCTGCCACAGG + Intergenic
936122114 2:109755954-109755976 TGTTCAAGGTGCTCTTCCCCGGG - Intergenic
936222580 2:110615520-110615542 TGTTCAAGGTGCTCTTCCCCGGG + Intergenic
936710160 2:115122295-115122317 TGTTCACTCTGATCTGCCACAGG - Intronic
943641909 2:190368857-190368879 TATACAAATTGCTATGCCACAGG + Intronic
945717856 2:213380799-213380821 TGTGCAAGCTGCTCTACCACTGG - Intronic
1173674263 20:44820338-44820360 ATTAAAATCTGCTCTGCCACAGG + Intergenic
1176172688 20:63703312-63703334 TGCACAAGCTTGTCTGGCACTGG - Intronic
1177615169 21:23508019-23508041 TGTACAAGCTGCTCTGCCCCTGG - Intergenic
1178348007 21:31848783-31848805 GCCACAAGCTTCTCTGCCACTGG + Intergenic
1179175155 21:39002942-39002964 TGTAGCTGCTGCTCTGCCTCTGG - Intergenic
1180856237 22:19047434-19047456 TGCCCAAGCTGCTCTTCTACAGG + Intronic
1181864888 22:25847169-25847191 AGTCCCAGCTGTTCTGCCACTGG + Intronic
1185347431 22:50316759-50316781 AGTAAAAGCTGCTCAGCCCCTGG - Intronic
949866195 3:8549477-8549499 TGTATTAGCTGCACTGCCCCAGG + Intronic
950162970 3:10773852-10773874 TTTGCAAGCTGCTCTGCCTTGGG - Intergenic
950392924 3:12710748-12710770 AGTACAAGCAGCTCAGCCTCTGG - Intergenic
951900425 3:27652706-27652728 TGTACATGCTGTTCTGCAACTGG - Intergenic
952131368 3:30367389-30367411 TGTACATGCTTCTTTGCCATTGG + Intergenic
952315222 3:32226469-32226491 AGAGAAAGCTGCTCTGCCACAGG + Intergenic
957060694 3:75479207-75479229 TGTACTTACTGCTCTGTCACTGG - Intergenic
959746470 3:109781116-109781138 GGTCTAAGCTGCTTTGCCACTGG - Intergenic
964505932 3:157398806-157398828 TGTGCAAGCTGCTGTACCTCTGG - Intronic
965031449 3:163373529-163373551 TGAAAAAGCTGCTCAGGCACAGG + Intergenic
968855355 4:3116240-3116262 TGGACAAGCTGCTCTGCAGAAGG - Exonic
969542936 4:7804983-7805005 TGTACCAGCTCCTCTGCCCCTGG - Intronic
970263556 4:14255640-14255662 TGTCCAACATGCTTTGCCACAGG + Intergenic
973073573 4:45895674-45895696 TGTAGAAGCTGCTTTGGAACTGG - Intergenic
975373804 4:73619486-73619508 AGAATAAGCTGCTCTGCCAAAGG - Intronic
975917311 4:79340679-79340701 TGTACAATGTGCTCAGGCACTGG - Intergenic
977490100 4:97700246-97700268 TGTACAAGCTGCTCTGCCACTGG - Intronic
978123249 4:105107023-105107045 TGTAAAAGCTGCTGTTCCTCTGG - Intergenic
978169777 4:105655961-105655983 TTTAAAAGCTGCACTGACACTGG - Intronic
978589224 4:110306262-110306284 TGACCACGCTGCTCTGCCAATGG - Intergenic
979396676 4:120197585-120197607 CGTACAAGCTGCACTGCCTGGGG - Intergenic
986330825 5:6714661-6714683 TGTACGCGCGGCTCTTCCACGGG - Exonic
986823244 5:11492265-11492287 TCTAAAAGCTCCTTTGCCACAGG - Intronic
990748338 5:58983720-58983742 TGTGCAAGCTGCTCTGCACATGG - Intronic
993203365 5:84847362-84847384 TGTGCAACCTGCTCTGCCACTGG + Intergenic
994533638 5:100999624-100999646 TTTCCATGCTGCTCTGCCTCGGG - Intergenic
994770411 5:103974116-103974138 TGCAGAGGCTGCTCTGCCAGTGG - Intergenic
996389275 5:122942357-122942379 TGTACAGGGTGCTGTGCTACTGG - Intronic
997918455 5:137953097-137953119 TCTAAAAGCTGCTTTGCCAGTGG + Intronic
1003198681 6:3938801-3938823 AGCTCAACCTGCTCTGCCACTGG - Intergenic
1003841907 6:10129278-10129300 TGTACCACCTGGACTGCCACTGG + Intronic
1009293383 6:61912582-61912604 TGTACCAGTTGCTCTGTCATGGG - Intronic
1009806466 6:68606773-68606795 TATGCAAGCTGCTCTGTCACTGG + Intergenic
1010011785 6:71056135-71056157 CTTAGAACCTGCTCTGCCACAGG + Intergenic
1011339029 6:86292104-86292126 TGTAAAAGCTCCTCTTCCAAGGG - Intergenic
1013319536 6:108973437-108973459 TTTAGAAGCTGCTGTGCCACAGG - Exonic
1013580882 6:111533507-111533529 TTTACTGGCAGCTCTGCCACTGG + Intergenic
1018123814 6:160662540-160662562 AGAACAAACTTCTCTGCCACAGG - Intronic
1020282276 7:6655747-6655769 TGTGCAAGCTGCCAGGCCACGGG - Exonic
1027450726 7:78328043-78328065 TGAACAAGATGCTGTGCCTCTGG - Intronic
1028712017 7:93920569-93920591 TGTAGTTGCAGCTCTGCCACAGG - Intergenic
1033237726 7:139651295-139651317 TTTGCAAGCTGCTATTCCACAGG + Intronic
1034517423 7:151591628-151591650 TGTACGTGCTACTCTGACACCGG + Intronic
1035604621 8:921633-921655 TGTAACAGCTGCGCTGCCAGCGG - Intergenic
1037093152 8:14947479-14947501 TATAAAAGATGCTCTGCTACTGG + Intronic
1044198974 8:89412544-89412566 TGAACAAGAGCCTCTGCCACAGG + Intergenic
1046064003 8:109175315-109175337 TGTGCAAGCTGCTCTGCCACTGG - Intergenic
1048912988 8:139153956-139153978 TGTACCAAGTGCTCTGCCACTGG + Intergenic
1048913341 8:139157865-139157887 TGCACCAGCTGCTCTGCCACTGG + Intergenic
1051387994 9:16530869-16530891 TGCACAAGCAGCTCTGCAGCAGG + Intronic
1052227568 9:26108197-26108219 TGTGCAAGCTGCTCTGCACTTGG + Intronic
1056157641 9:83854839-83854861 TGGACAAGATAGTCTGCCACAGG - Intronic
1056352903 9:85769243-85769265 TGGACAAGATAGTCTGCCACAGG + Intergenic
1057156355 9:92843627-92843649 TGTACCACCTACTCTGCCACTGG - Intergenic
1060589841 9:124809823-124809845 TGTACAAGCTACCCTACAACTGG + Exonic
1061349138 9:130050329-130050351 TGTATAACTTGCTCAGCCACAGG - Intergenic
1061892150 9:133628148-133628170 TGTACACACTGTCCTGCCACTGG - Intergenic
1061904593 9:133690291-133690313 TGGACAAGCTGTTCTGCCCAAGG + Intronic
1062551775 9:137090960-137090982 TGGAGAAGCTGCTCAGCGACAGG - Intronic
1186264112 X:7813084-7813106 TTTTCAAGTTCCTCTGCCACAGG - Intergenic
1188456737 X:30374939-30374961 TGTACCAGATGCTCTGGCAGAGG - Intergenic
1188657662 X:32717757-32717779 TGTACACCCTGCTGAGCCACAGG + Intronic
1191226696 X:58051503-58051525 TGTGAAAGCTGCTCTGCCACTGG + Intergenic
1191946328 X:66538829-66538851 TGTGCAAGCTGCTCTGCCACTGG + Intergenic
1193531397 X:82658841-82658863 TGTGCAAGCTACTCTGACACTGG - Intergenic
1194077992 X:89420448-89420470 TGTTCTAGCTGCTCTGGCAGCGG + Intergenic
1197941459 X:131794424-131794446 TCTTCAAGCTGCTCTGCTCCTGG - Intergenic
1199555644 X:149105669-149105691 TATACAAGCTGCTGAGCAACAGG - Intergenic
1200430639 Y:3076002-3076024 TGTTCTAGCTGCTCTGGCAGCGG + Intergenic