ID: 977492983

View in Genome Browser
Species Human (GRCh38)
Location 4:97737125-97737147
Sequence CTCCAACACACCTGCAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977492973_977492983 26 Left 977492973 4:97737076-97737098 CCGCTGCTGGAACCCAGGCAACC 0: 1
1: 3
2: 146
3: 1427
4: 1968
Right 977492983 4:97737125-97737147 CTCCAACACACCTGCAGCGGAGG No data
977492978_977492983 13 Left 977492978 4:97737089-97737111 CCAGGCAACCAGGGTCTGGAGTG 0: 7
1: 2928
2: 2364
3: 1193
4: 776
Right 977492983 4:97737125-97737147 CTCCAACACACCTGCAGCGGAGG No data
977492972_977492983 29 Left 977492972 4:97737073-97737095 CCACCGCTGCTGGAACCCAGGCA 0: 3
1: 115
2: 847
3: 1852
4: 2378
Right 977492983 4:97737125-97737147 CTCCAACACACCTGCAGCGGAGG No data
977492977_977492983 14 Left 977492977 4:97737088-97737110 CCCAGGCAACCAGGGTCTGGAGT 0: 6
1: 2920
2: 2386
3: 1195
4: 832
Right 977492983 4:97737125-97737147 CTCCAACACACCTGCAGCGGAGG No data
977492980_977492983 5 Left 977492980 4:97737097-97737119 CCAGGGTCTGGAGTGGACCTCTA 0: 6
1: 11
2: 12
3: 25
4: 122
Right 977492983 4:97737125-97737147 CTCCAACACACCTGCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977492983 Original CRISPR CTCCAACACACCTGCAGCGG AGG Intronic
No off target data available for this crispr