ID: 977495611

View in Genome Browser
Species Human (GRCh38)
Location 4:97771571-97771593
Sequence TAGGCACGTGAGCATGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977495611 Original CRISPR TAGGCACGTGAGCATGTAGA AGG Intronic
900015542 1:146540-146562 TAGGCACCTCAGGATGGAGAGGG - Intergenic
900045806 1:505134-505156 TAGGCACCTCAGCATGGAGAGGG - Intergenic
900068006 1:746849-746871 TAGGCACCTCAGGATGGAGAGGG - Intergenic
900817211 1:4857626-4857648 CAGGCAAGAGAGCATGTACAGGG - Intergenic
901910148 1:12450614-12450636 TAGCCACGTGATCATGAAGAGGG + Intronic
907462394 1:54612629-54612651 TGGGGACGTGGACATGTAGAAGG + Exonic
908615928 1:65922662-65922684 TACTCACGTGAGAAAGTAGAGGG + Intronic
909664744 1:78120685-78120707 TAGGCAAGAAAGCATGTACAGGG + Intronic
909719951 1:78755622-78755644 CAGGCAAGAGAGCATGTACAGGG - Intergenic
910303790 1:85738806-85738828 TAAGCAAGTAAGCATTTAGAGGG - Intronic
910566136 1:88645057-88645079 TTGGAAGGTGAGCATGTAAATGG - Intergenic
912607173 1:111003108-111003130 CAGGCAAGAGAGCATGTACAGGG - Intergenic
916518111 1:165538940-165538962 TAGGCTGGTGAGAATGTAGCTGG - Intergenic
917500302 1:175579378-175579400 TGGGCTGGTGAGCATGGAGAGGG + Intronic
918401241 1:184164667-184164689 TTGGCACGTGAGCATGCAGAGGG + Intergenic
922253568 1:223871998-223872020 CAGGCACGAGAGCATGTGCAGGG - Intergenic
922418718 1:225445025-225445047 CAGGCACGTGAGCAGGAAGTGGG + Intergenic
923659094 1:235943124-235943146 TGGGCCCGGGAGCATGAAGAAGG - Intergenic
1063892345 10:10643390-10643412 TAGGCAAGAGAGCATGTGCAGGG - Intergenic
1069147590 10:64915268-64915290 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1076972133 11:141607-141629 TAGGCACCTCAGGATGGAGAGGG - Intergenic
1078800678 11:14642035-14642057 TTGGCACGTGATCATGGAAACGG - Intronic
1080401554 11:31941090-31941112 CAGGCAAGAGAGCATGTACAGGG + Intronic
1080693442 11:34579766-34579788 TAGCCACCTGAGCAGGTTGAAGG - Intergenic
1084719281 11:70893894-70893916 TAGTCACGTGAGCCTGTGGTGGG + Intronic
1087169293 11:95034236-95034258 TAGGCATGTGAGAATGTTGTGGG + Intergenic
1090457410 11:126861977-126861999 TAGGCACCTGGGCATGGAAAAGG + Intronic
1093874890 12:24338774-24338796 TAGGCAAGAGAGCGTGTACAGGG - Intergenic
1099020586 12:77399079-77399101 AAGGCACATGAGCATATTGAAGG + Intergenic
1100651729 12:96597435-96597457 TTGGCAACTGAGCATGTAAAAGG + Intronic
1100855795 12:98756298-98756320 TAGGCAAGAGAGCATGTACAGGG - Intronic
1103273568 12:119693321-119693343 TGGGCAGTTGAGAATGTAGAAGG - Intronic
1104198675 12:126566765-126566787 TAGGCAAGAGAGCATGTGCAGGG + Intergenic
1107619521 13:42211812-42211834 TAGGCAAGAGAGCATGTGCAAGG + Intronic
1109749450 13:66671117-66671139 CTGGCAAGAGAGCATGTAGAGGG - Intronic
1110298165 13:73894144-73894166 GAGGCAAGTGAGCAAGCAGACGG + Intronic
1111172289 13:84543177-84543199 TAGGCAAGAGAGCATGTGCAGGG + Intergenic
1111614440 13:90644961-90644983 CAGGCAAGTGAGCTTGTATAGGG + Intergenic
1113018751 13:105858324-105858346 TAGGCAGAGGTGCATGTAGAGGG + Intergenic
1118999908 14:70872455-70872477 TAGGCACGTGGTCATATTGAAGG + Intergenic
1122797895 14:104215537-104215559 TAGGGAGGTGAGCGTGTAGGGGG + Intergenic
1122923596 14:104890031-104890053 TGGGCAGGTGGGCAGGTAGATGG + Intronic
1124130136 15:26976459-26976481 TAGGCACTTGAGCATTGTGAGGG - Intronic
1132179854 15:99744010-99744032 CAGGCATGTGAGCACATAGAGGG + Intergenic
1138745766 16:59361929-59361951 CAGGCAAGAGAGCATGTACAGGG - Intergenic
1140317468 16:73913053-73913075 TAGGCAGGTAGGCAGGTAGATGG - Intergenic
1140960558 16:79907925-79907947 TGGGTGCGTGAGTATGTAGATGG + Intergenic
1140991695 16:80219308-80219330 CAGGCACGAGAGCATGTGCAGGG - Intergenic
1142448115 16:90155915-90155937 TAGGCACCTCAGCATGGAGAGGG + Intergenic
1142459371 17:79409-79431 TAGGCACCTCAGGATGGAGAGGG - Intergenic
1142800617 17:2343077-2343099 TGGGCTTTTGAGCATGTAGAGGG + Intronic
1148337107 17:46849425-46849447 TAGGCAGGTGAGGATGGAGTGGG - Intronic
1148554748 17:48571648-48571670 TTGTCACTTGAGCCTGTAGAAGG + Intronic
1149602059 17:57899380-57899402 TGGGCACGTGGGTATGTGGATGG - Intronic
1152419354 17:80183792-80183814 TGGGCAGGTGAGCATGTGGGCGG - Intronic
1155528070 18:26737413-26737435 CAGGCAAGAGAGCATGTACAGGG - Intergenic
1158200801 18:54937820-54937842 TATGTAAGTGAGCATGCAGATGG + Intronic
1159699170 18:71603249-71603271 TAGGCATTTGAGGCTGTAGATGG + Intergenic
1160243366 18:77138164-77138186 TGGGCCGGTGAGCATGTGGATGG + Intergenic
1160649089 19:211916-211938 TAGGCACCTCAGCATGGAGAGGG - Intergenic
1162612168 19:11765303-11765325 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1163022663 19:14491636-14491658 TAGGTAAGTGATCATGGAGATGG - Exonic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1167054427 19:47100421-47100443 TAGGCACGTTACCATGGAAATGG - Intronic
932012714 2:67994244-67994266 TAGGCAAGAGAGCATGTGCAGGG - Intergenic
935385071 2:102491493-102491515 CAGGCAAGAGAGCATGTACAGGG + Intronic
935385353 2:102493461-102493483 CAGGCAAGAGAGCATGTACAGGG + Intronic
936287689 2:111193393-111193415 AAGGCACTAGAGCATGTACATGG - Intergenic
941651057 2:168093401-168093423 CAGGCACATGAGCATGTGCAAGG + Intronic
942319429 2:174723729-174723751 CAGGCAAGCGAGCATGTACAGGG - Intergenic
942326960 2:174783974-174783996 TAGGCAGGTGAGTCCGTAGATGG - Intergenic
946472537 2:219975580-219975602 CAGGCAAGAGAGCATGTACAGGG - Intergenic
1170171572 20:13419283-13419305 CATGCTCGTGTGCATGTAGAGGG + Intronic
1173365274 20:42379535-42379557 GAGGCACCTGAGCCTGTGGAGGG + Intronic
1174718567 20:52786360-52786382 GAGGCATCTCAGCATGTAGAAGG + Intergenic
1176658009 21:9605308-9605330 TAAGCAAGAGAGCATGTGGAGGG - Intergenic
1179016456 21:37597879-37597901 CAGGCAAGAGAGCATGTGGAGGG + Intergenic
1180937715 22:19637070-19637092 TAGGCACGGAAGCATGAAGTAGG - Intergenic
1182424454 22:30264771-30264793 TAAGCAGGTGAGCATGGTGATGG + Intronic
1183991385 22:41599286-41599308 TGGGAAAGTGAGCATGAAGAAGG - Exonic
1184704799 22:46203582-46203604 TAGGCACGTGGACACGTTGAAGG + Intronic
949599510 3:5582703-5582725 TAGACATGTGAACATGTAGCTGG + Intergenic
952022612 3:29041203-29041225 TAGGCAAGACAGCATGTACAAGG - Intergenic
953099656 3:39811527-39811549 AAGGAACGTGAGCAGGAAGATGG - Intronic
954628037 3:52033385-52033407 AAGGCACGAGAGCAGGGAGAGGG - Intergenic
955036931 3:55277125-55277147 CAGGCAAGAGAGCATGTACAGGG + Intergenic
955989679 3:64613113-64613135 TAGGCACGTGGGTCTGTAAAAGG + Intronic
956567181 3:70652125-70652147 TAGGCAAGAGAGCATGTGCAGGG + Intergenic
957095302 3:75772264-75772286 GAGGTACGTGGGCAAGTAGAAGG - Intronic
958628637 3:96658878-96658900 AAGGCACATGAGTATGTAAAAGG - Intergenic
960632108 3:119742751-119742773 GAGGCAGGTGAGGATGAAGATGG + Intronic
968368758 3:198208211-198208233 TAGGCACCTCAGGATGGAGAGGG + Intergenic
968869755 4:3235772-3235794 TACACAGGTGAGCATGTACACGG + Exonic
970571519 4:17387933-17387955 TAGGCAAGAGAGCATGTGCAGGG + Intergenic
970592812 4:17574337-17574359 TAGGCATGTGAAAATGTAAATGG + Intergenic
970739402 4:19216436-19216458 CAGGCAAGAGAGCATGTACAAGG - Intergenic
971748420 4:30614211-30614233 CAGGCAAGAGAGCATGTGGAGGG - Intergenic
972945973 4:44256067-44256089 CAGGCAAGAGAGCATGTGGAGGG + Intronic
974066786 4:57086143-57086165 CAGGCAAGAGAGCATGCAGAGGG + Intronic
976742489 4:88370457-88370479 TAAGCACGTGAGCATTTAGGAGG - Intergenic
977495611 4:97771571-97771593 TAGGCACGTGAGCATGTAGAAGG + Intronic
981345410 4:143670424-143670446 TAGGCACATGTGTATGTACATGG + Intronic
981994042 4:150957325-150957347 CAGGCAAGTGAGCATGTGCAGGG + Intronic
983718632 4:170817106-170817128 TAGGCAAGTGAACATGTGCAGGG - Intergenic
983810141 4:172051176-172051198 TAGGAAGGGGAGCATGGAGACGG + Intronic
983863155 4:172733658-172733680 CAGGCAAGAGAGCATGTACAGGG - Intronic
985417402 4:189750765-189750787 TAAGCAAGAGAGCATGTGGAGGG + Intergenic
987461419 5:18216062-18216084 TAGGCAAGAGAGCATGTGCATGG + Intergenic
988822711 5:34903385-34903407 TAGGCATGTGTGCAGGTAGGGGG - Intergenic
989333893 5:40291737-40291759 TAGACAGGTCACCATGTAGATGG - Intergenic
991948524 5:71925563-71925585 TAGGTACTTGAGCCTGTGGAGGG - Intergenic
992460936 5:76959556-76959578 TAGTCATGTGAGAAAGTAGAAGG - Intronic
994410454 5:99401775-99401797 TAAGCACGGTAGCATGTATATGG - Intergenic
994483371 5:100363494-100363516 TAAGCACGGTAGCATGTATATGG + Intergenic
999181330 5:149671591-149671613 TAGCCACGTGAGCATCTATAGGG - Intergenic
1002728036 5:181313776-181313798 TAGGCACCTCAGGATGGAGAGGG + Intergenic
1006369260 6:33633965-33633987 TAGGCAAGTTTGCATGGAGAGGG - Intronic
1010806593 6:80244257-80244279 TACACACGTGCGCATGTAGGTGG + Intronic
1016593021 6:145766807-145766829 TAGGCAAGAGAGCATGTGCAGGG - Intergenic
1021866837 7:24966542-24966564 TTGGCAGGTGTGCATGAAGAAGG + Intronic
1022555715 7:31293826-31293848 TAGGCAAGAGGGCAGGTAGAAGG - Intergenic
1026141549 7:67711142-67711164 CAGGCACGAGAGCATGTGTAGGG + Intergenic
1029002450 7:97168158-97168180 TAGGCACGTGAACACGTTGAAGG - Intronic
1031716073 7:125110061-125110083 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1032440223 7:131937105-131937127 CAGGCAAGAGAGCATGTACAGGG - Intergenic
1035961931 8:4147313-4147335 TAGACAGGTGAGCATACAGAAGG - Intronic
1036567350 8:9948871-9948893 TATGCACGTCACCATGTAAAGGG + Intergenic
1038002057 8:23400358-23400380 CAGGCAAGAGAGCATGTACAGGG + Intronic
1040655063 8:49498421-49498443 CAGGCACGGGAGCATGTGCAGGG - Intergenic
1041161132 8:55044821-55044843 TAGGAACGCAAGCATGTGGAAGG - Intergenic
1043786139 8:84402487-84402509 TAGGTAGTTGATCATGTAGACGG - Intronic
1048403653 8:134096475-134096497 TAACCAGGTGAGCATGTAGGTGG - Intergenic
1053363864 9:37509056-37509078 TGGGCACAGGAGCATGGAGAAGG + Intergenic
1057740598 9:97708248-97708270 TAGGCAAGAGAGCATGTGTAGGG - Intergenic
1058333822 9:103800593-103800615 TAGGCATGTGAGCAAGTAAATGG + Intergenic
1059416552 9:114166155-114166177 TGGGCAGGTGAACAGGTAGATGG - Intronic
1062753099 9:138270917-138270939 TAGGCACCTCAGGATGGAGAGGG + Intergenic
1203575614 Un_KI270745v1:5694-5716 TAGGCACCTCAGCATGGAGAGGG + Intergenic
1203635738 Un_KI270750v1:108883-108905 TAAGCAAGAGAGCATGTGGAGGG - Intergenic
1186262787 X:7798085-7798107 CAGGCAAGAGAGCATGTGGAGGG - Intergenic
1186270461 X:7881110-7881132 CAGGCACGAGAGCATGTGCAGGG - Intergenic
1186313992 X:8349332-8349354 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1188260348 X:28016187-28016209 ACAGCACGTGAGCAGGTAGATGG + Intergenic
1189500649 X:41553348-41553370 TGGGCATGAAAGCATGTAGAAGG + Intronic
1190517994 X:51244382-51244404 TAGGCAAGAGAGCATGTGCAGGG - Intergenic
1190973363 X:55374852-55374874 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1198527443 X:137515993-137516015 CAGGCAAGAGAGCATGTATAGGG + Intergenic