ID: 977497096

View in Genome Browser
Species Human (GRCh38)
Location 4:97790640-97790662
Sequence ACCTTTCCTTGATGGCCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977497096 Original CRISPR ACCTTTCCTTGATGGCCTCG AGG (reversed) Intronic
900692066 1:3987015-3987037 AGCTGTCCATGGTGGCCTCGTGG - Intergenic
906665348 1:47617509-47617531 ACCTGGCCCTGATGGCCTCTTGG + Intergenic
908827537 1:68148111-68148133 ATCCTTCCTTGATGGGCTCAGGG - Intronic
913521770 1:119651315-119651337 ACCTTCCCCTGAGGGCCTCAAGG - Intergenic
914896103 1:151675043-151675065 ACCTCTCCTAGATGGCCACCTGG + Intronic
915528668 1:156490988-156491010 ACCTTCCCCTTATGGCCTCTGGG + Intronic
915537099 1:156543365-156543387 CCCTTTCCTTCCTGGCCTTGAGG - Intronic
916842004 1:168610148-168610170 ACCTTTCCTTGATGTCTCAGTGG + Intergenic
918049469 1:180961790-180961812 CCCTTTCCTAGATGGCTTCTAGG + Intergenic
924577755 1:245295858-245295880 GCCTTGACTTGATGGCCTTGAGG + Intronic
924829545 1:247578704-247578726 ACCTTACACTGATGGCCTCATGG + Intergenic
1065751760 10:28894315-28894337 ACAATTCCTTGCTGGCCTCTGGG + Intergenic
1065888248 10:30097911-30097933 ACGTTTCCTTGATGACTTTGAGG - Intronic
1066116755 10:32247480-32247502 GCCTTTCCTTTATGACTTCGGGG - Intergenic
1075776670 10:124993646-124993668 TCCTTTCCCTGATGACCTCTGGG + Intronic
1083477582 11:62923960-62923982 ACGTTCCCTTGGTGGCCTGGAGG - Intergenic
1083757135 11:64797624-64797646 ACCTTTCCTCCAGGGCCTCCTGG + Exonic
1089378546 11:118011817-118011839 TCCCTTCCTTGAAGGCCTCTTGG - Intergenic
1091855961 12:3740369-3740391 ATCTTTCCTTGATGGTGTCAAGG + Intronic
1092056353 12:5511392-5511414 CCCTTTCCTTGATTTCCACGCGG - Intronic
1113028987 13:105973223-105973245 CCATTTCCACGATGGCCTCGTGG + Intergenic
1114825902 14:26079083-26079105 ACCTCTCCTTGATGAACTTGGGG - Intergenic
1117216004 14:53552372-53552394 ACTGTTCCCTGATGGCCTCATGG + Intergenic
1119761977 14:77158145-77158167 ATCTCTCCTTGGTGGCCTTGAGG - Intronic
1130898212 15:88187227-88187249 ACCTGTCATTCATGGCCTCCAGG + Intronic
1131214583 15:90526672-90526694 ACATTTCCTAGATGACCTTGTGG + Intergenic
1132836278 16:1954840-1954862 TCCTTTCCTCGATGGCCCTGGGG + Intronic
1138596531 16:58032171-58032193 ACCTTTCTTTACTGGCCTTGGGG + Intronic
1142276249 16:89120379-89120401 GCCTTGCCCTGATGGCCCCGGGG - Intronic
1145286627 17:21511278-21511300 TCATTTCCTTGATGGCTTCTGGG + Intergenic
1145390989 17:22455063-22455085 TCATTTCCTTGATGGCTTCTGGG - Intergenic
1152556709 17:81056707-81056729 TGCTTTTCTTGATGGCCTGGTGG + Intronic
1154123203 18:11668241-11668263 ACCTTCCCTTGATGGTCTTTGGG + Intergenic
1155067453 18:22280041-22280063 TCCTATCCTTGCTGGCCCCGAGG - Intergenic
1157522162 18:48352679-48352701 ATCTTACCTTGATGCCCTTGAGG - Intronic
1157583242 18:48785557-48785579 TGCTTTCCTTGATGGTCTTGTGG - Intronic
1163216207 19:15879383-15879405 ACCTCTCCTTGATGTTCTCTGGG + Exonic
1163220386 19:15914342-15914364 ACCTCTCCTTGATGTTCTCTTGG + Exonic
1165137320 19:33677811-33677833 ACCATTCCTTGATGGCCCCCAGG - Intronic
931692321 2:64845722-64845744 ACCCTTCCTTGATTGCCTACAGG + Intergenic
934917453 2:98311771-98311793 ACCCTGCCTTGATGGCTGCGGGG - Intronic
935198508 2:100835698-100835720 ACCTTTCCATGCTGGCTTCTAGG - Intronic
938173441 2:129103123-129103145 ACTTTCCCTTGATGGCTTGGAGG - Intergenic
938980558 2:136522286-136522308 TCCTTACCTTGATGGCCACTAGG + Intergenic
943685949 2:190818381-190818403 GCCTTTCCTTGCTGACCTAGAGG - Intergenic
948334394 2:237195951-237195973 ACCTTTGATTTATGGCCTCTTGG + Intergenic
948401484 2:237688804-237688826 ACCTTTCCAAGGTGCCCTCGGGG + Intronic
948525227 2:238567227-238567249 ACCTTTCCTCCATGGCCAGGTGG + Intergenic
948654659 2:239469149-239469171 ACCATTCCTTGTTGGCCTTCTGG - Intergenic
1168773332 20:429761-429783 ACCTTTACTTGCTGTCCTCTAGG - Intronic
1173897253 20:46560406-46560428 CCCATTCATTGATGGCCTCTAGG + Intronic
1174451093 20:50620965-50620987 CCCTTTCCTTGATGAACTTGAGG - Intronic
1180709913 22:17832560-17832582 ACGTTTCATAGACGGCCTCGAGG + Intronic
1181552647 22:23649494-23649516 GGCTTTCCTTGGAGGCCTCGTGG + Intergenic
1182621162 22:31619518-31619540 CCCTTACCTGGATGGCCTCATGG + Exonic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
952985370 3:38774999-38775021 ACCTTTCCTTGCTGACCATGTGG + Intronic
954559432 3:51543906-51543928 AGCCTTCCTTGATTGCCTCCAGG + Intronic
956703862 3:71982603-71982625 AGCCTGCCCTGATGGCCTCGTGG - Intergenic
961090829 3:124111316-124111338 ACCTTTCCCAGATGTCCTCCAGG + Intronic
961773680 3:129268638-129268660 GCCTGGCCTTGATGGCCTCTGGG - Intronic
963300156 3:143588275-143588297 ACCTTTCCTGGCAGGCCTGGAGG - Intronic
963587499 3:147211087-147211109 ACCATTCCTTTGTGGCATCGAGG - Intergenic
964711865 3:159679703-159679725 AGCTCTCCATGATGGCCCCGAGG + Intronic
967578313 3:191123440-191123462 CCCATTCCTGGATGGCCTCTAGG + Intergenic
970205096 4:13647759-13647781 CCCTTTCCATGATGGCTTTGCGG + Intergenic
972597384 4:40541941-40541963 ACCTTTCCTGGATGCCATCAAGG + Intronic
977497096 4:97790640-97790662 ACCTTTCCTTGATGGCCTCGAGG - Intronic
978580211 4:110224366-110224388 GCCCTTCCTTTATGGCCTCCTGG - Intergenic
978799208 4:112739019-112739041 AACTTTCCATGATGGCTTTGCGG - Intergenic
991104138 5:62824989-62825011 TCTTTTCCTTGATGGCTTCTGGG + Intergenic
992369774 5:76130903-76130925 ACCTGTCCCTGAAGGCCTGGGGG + Intronic
995250361 5:109985940-109985962 ACCTTTCCTTTGTGTCCTCCAGG - Intergenic
995395249 5:111680682-111680704 ACCTTTCCTTCATGGACTCTGGG + Intronic
1002559121 5:180069466-180069488 CCCTTTCCTTGATTCCCTAGGGG - Intronic
1003079778 6:3012587-3012609 ACCTTTGCTTGTAGGCTTCGTGG - Exonic
1010582720 6:77619398-77619420 CTCTTTCCATGATGGCCTCAGGG - Intergenic
1010933756 6:81835581-81835603 ATCTTTCCTTGAGGGACTTGGGG + Intergenic
1014841346 6:126224328-126224350 TACATTCCTTGATGGCCTTGGGG + Intergenic
1015815625 6:137208365-137208387 ACATTTTCTCGATGGCCTTGGGG - Intronic
1015928941 6:138337303-138337325 TCCTTTCCTTGTTTGCCTTGGGG - Exonic
1017810348 6:157979781-157979803 CCTTTTCCTTGAAGGCCTCAAGG + Intergenic
1018747081 6:166770732-166770754 ACCTTGCCTTGCTGGACTCCGGG + Intronic
1019591511 7:1837838-1837860 GTCTTGCCTTGATGGCCTCACGG + Intronic
1031382638 7:121106675-121106697 ACCTTCCCTTGATGGCTCCAGGG - Intronic
1032752887 7:134859462-134859484 ACTTTTCCTTGATGAACTCAAGG - Intronic
1040532284 8:48275649-48275671 ACCTTTCCATGACTGCCTCTGGG + Intergenic
1047673053 8:127170033-127170055 ACATTTCTTTGATGGCCTAGTGG - Intergenic
1053676200 9:40430987-40431009 ATCTTTACTAGATGGCCTTGTGG + Intergenic
1053925972 9:43057099-43057121 ATCTTTACTAGATGGCCTTGTGG + Intergenic
1054287521 9:63193906-63193928 ATCTTTACTAGATGGCCTTGTGG - Intergenic
1054289268 9:63266512-63266534 ATCTTTACTAGATGGCCTTGTGG + Intergenic
1054387301 9:64571058-64571080 ATCTTTACTAGATGGCCTTGTGG + Intergenic
1057402751 9:94739227-94739249 AACTTTCCTTGTTGTCCTGGTGG + Intronic
1058063188 9:100521291-100521313 GCATTTCTTTGATGGCATCGTGG + Intronic
1060521142 9:124294819-124294841 ACCTTTCCATGGTGGGCTGGAGG + Intronic
1061534436 9:131238917-131238939 ACCTCTCCTTGCTGGCATCCTGG + Intergenic
1185629442 X:1505395-1505417 CCCTGTCCTTGCTGGCCACGAGG - Intronic
1185833938 X:3328185-3328207 TCCATTGCTTGATGGCCTCTTGG + Intronic
1187755342 X:22519362-22519384 ACCTTTCGTTGTTGGCGTCTGGG + Intergenic
1187833565 X:23407605-23407627 TCCTTTACTTGATGGCTTCTAGG - Intergenic
1188255492 X:27957407-27957429 AGCTTTCCTTAATGACCTCGTGG + Intergenic
1188448651 X:30285437-30285459 TCCTTTACTTTATGGCCTTGGGG + Intergenic
1192834323 X:74783111-74783133 AACTTTCCATGATGCTCTCGTGG - Intronic