ID: 977504183

View in Genome Browser
Species Human (GRCh38)
Location 4:97880850-97880872
Sequence GCATCCTTCTGAACTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977504183 Original CRISPR GCATCCTTCTGAACTGGTAT TGG (reversed) Intronic
901431526 1:9218223-9218245 CCATCCTTCTGCATTTGTATGGG - Intergenic
903943664 1:26948616-26948638 GGATCCTTCTGAACTCATCTGGG + Intergenic
906042451 1:42798566-42798588 AGAGCCTTCAGAACTGGTATTGG + Intergenic
907419989 1:54340789-54340811 GCAGCCCTCTGGGCTGGTATGGG - Intronic
907566739 1:55442584-55442606 GCATCCATCTGAAGAGGTTTGGG - Intergenic
908511924 1:64856569-64856591 GCCTCCTCCTGAAGTGGAATTGG - Intronic
912926264 1:113915810-113915832 GCATCATTCTGTTCAGGTATAGG - Intergenic
914703663 1:150154507-150154529 CCATCCTTCTGAACTGCTGCTGG - Intronic
915898548 1:159829787-159829809 GCATGCATCTGAGCTGCTATAGG - Intronic
916680568 1:167100981-167101003 TCATTCATCTGAACTGGTTTAGG - Intronic
1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG + Intergenic
1072541060 10:96398249-96398271 GCACCATTCTGAACTGGCCTAGG + Intronic
1073044502 10:100628812-100628834 GCTTCCATCCCAACTGGTATTGG - Intergenic
1075260946 10:120963484-120963506 GCAGCCTTCTGACCTGGGCTGGG - Intergenic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1082187398 11:49200947-49200969 GATTCATTCTGAACTTGTATCGG - Intronic
1083836637 11:65273402-65273424 GCATCCTTGAGAACTGGTACTGG + Intronic
1084689272 11:70715783-70715805 GCATCCTTCTGGACAGATAGAGG - Intronic
1086678937 11:89644475-89644497 GATTCATTCTGAACTTGTATCGG + Intergenic
1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG + Intronic
1093490399 12:19698688-19698710 GGACCCTTATGAACTGGAATGGG + Intronic
1109704217 13:66068344-66068366 ACATCCTCCAAAACTGGTATGGG + Intergenic
1117612760 14:57501671-57501693 GCATACTTCAGAAATGGCATGGG - Intergenic
1121388407 14:93551966-93551988 GAATCCTTCTGGGATGGTATGGG + Intronic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1124038414 15:26078136-26078158 GCATTCTTTTCAACTGCTATGGG - Intergenic
1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG + Intronic
1124546771 15:30635961-30635983 GCATCCTTCTCATCTAGAATAGG - Intronic
1124780376 15:32625961-32625983 GCATCCTTCTCATCTAGAATAGG - Intronic
1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG + Intergenic
1129270613 15:74417537-74417559 GGATGCTTCTGAACTGGGCTGGG - Intronic
1131693528 15:94852278-94852300 TCATCCTTCTTAATTGGTATTGG + Intergenic
1146494815 17:33312274-33312296 GCAGCATTCTAAACTGTTATTGG + Intronic
1152651586 17:81496541-81496563 GCATCATTATGAACTTGTCTGGG - Intergenic
1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG + Intronic
1153690789 18:7591486-7591508 GAATACTTCTGAACTTGTAGTGG - Intronic
1156281823 18:35646558-35646580 GCATCCTTCTGACATGGCACTGG + Intronic
1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG + Exonic
928889654 2:36188980-36189002 GTGTCCTGCTGATCTGGTATGGG - Intergenic
931695783 2:64869556-64869578 CCATCCTTCTGATTTGGTCTTGG - Intergenic
934556654 2:95290079-95290101 GCTTCCTTCTGAAGAGGTAAGGG - Exonic
939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG + Intronic
941674364 2:168328238-168328260 GCAATCTGCTGAACTGGAATTGG + Intergenic
942688270 2:178557268-178557290 CCATCCTTCTGAACCAGTCTTGG - Exonic
944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG + Intronic
1170485424 20:16810866-16810888 GCATCCTTCACAGCTGGTGTAGG + Intergenic
1173757964 20:45534898-45534920 GCTTCCGTCTGACCTGGTCTGGG + Intronic
1173950240 20:46987081-46987103 GCATCCTGCTTAACTGATACAGG + Intronic
1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG + Intergenic
1177198579 21:17929546-17929568 GCAGCCTGCTGAGCTGGGATTGG + Intronic
1179153223 21:38827383-38827405 GGATCCTTCTGAAAGGGTCTCGG + Intergenic
1181234967 22:21443208-21443230 GCACCCTCCTGAACTGCTGTGGG + Intronic
959319329 3:104850832-104850854 GCAGCTTTCAGAACTGGAATTGG + Intergenic
963794539 3:149618384-149618406 GCATCCATCTGTGCTGGTCTTGG + Intronic
967896786 3:194401871-194401893 GCAGACTTCTGACCTGGTAATGG - Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978564953 4:110071686-110071708 GCATCCTTCTGAGCAGGCAGTGG - Intronic
979893343 4:126128729-126128751 TCATCCATATGAACTGTTATGGG + Intergenic
980274448 4:130631503-130631525 GAATTCTTCTGCACAGGTATTGG - Intergenic
989143717 5:38227750-38227772 ACATTCTTCTCAAATGGTATCGG - Intergenic
1009942283 6:70303339-70303361 GCAGCTTTCAGAACTGCTATAGG + Intergenic
1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG + Intronic
1017479257 6:154833258-154833280 GGATCATTCTGTACTGGTATAGG - Exonic
1018841976 6:167523986-167524008 GCATCCTCCTGAACCGGAAGAGG - Intergenic
1021512218 7:21446336-21446358 GCAGCTGTCTGAACTGGTAGTGG + Intronic
1021834283 7:24652671-24652693 GCATCCTACTGAGATGCTATAGG + Intronic
1031568554 7:123329990-123330012 GCAGCCTTCTTGACTGGTGTAGG + Intergenic
1031867505 7:127053987-127054009 AGATACTTCTTAACTGGTATAGG + Intronic
1035746980 8:1968122-1968144 GCATCCTCTTGAACTTGTCTGGG - Intergenic
1038904793 8:31888315-31888337 ACACCCTTCTGTACTGATATAGG - Intronic
1045281859 8:100756363-100756385 GCATCCGTCTGAACTGCTGCTGG + Intergenic
1050913969 9:11108166-11108188 GCTTCCCTCTGACCTGGGATAGG - Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1056535936 9:87527724-87527746 GCTTCTTTCTGAACTGTTACTGG + Intronic
1057055756 9:91959474-91959496 TCATCCTGCTGAACTGTGATGGG - Intergenic
1059930178 9:119252795-119252817 TCATTCTTCTGTACTGGTACTGG - Intronic
1196998992 X:121416866-121416888 GCAGCCTACTCAACTGGGATTGG - Intergenic