ID: 977505302

View in Genome Browser
Species Human (GRCh38)
Location 4:97894797-97894819
Sequence CAACAATAGCTGTCAGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977505301_977505302 -1 Left 977505301 4:97894775-97894797 CCTAATTCAGAGACTGGGGTCTC 0: 1
1: 0
2: 2
3: 11
4: 138
Right 977505302 4:97894797-97894819 CAACAATAGCTGTCAGCCTAAGG No data
977505297_977505302 13 Left 977505297 4:97894761-97894783 CCAAATGCTGGTATCCTAATTCA 0: 1
1: 0
2: 0
3: 16
4: 143
Right 977505302 4:97894797-97894819 CAACAATAGCTGTCAGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977505302 Original CRISPR CAACAATAGCTGTCAGCCTA AGG Intronic
No off target data available for this crispr