ID: 977508015

View in Genome Browser
Species Human (GRCh38)
Location 4:97926482-97926504
Sequence GGTGGAGCATGTTCTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977508015_977508022 14 Left 977508015 4:97926482-97926504 CCATTAGAAGAACATGCTCCACC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 977508022 4:97926519-97926541 CAAGAACCATTATAAAGTCATGG 0: 1
1: 0
2: 0
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977508015 Original CRISPR GGTGGAGCATGTTCTTCTAA TGG (reversed) Intronic
903009604 1:20320397-20320419 GGGAGAGCATGTGCTTCTAGGGG - Intronic
905483901 1:38282208-38282230 TCTGGGGCATGTTCTTCTCATGG + Intergenic
914255140 1:145956351-145956373 AGTGAAGCATGTTCTACTTAAGG + Intronic
919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG + Intronic
920045621 1:203130333-203130355 GGTGGAGCAGGAGCTTTTAAAGG + Intronic
921796564 1:219351595-219351617 GATGGCGAATGTTCTTATAAGGG + Intergenic
922353347 1:224753684-224753706 GGTGGAGGATTTGCTTCTGAAGG + Intergenic
924058523 1:240146942-240146964 GGTGGATGATGTTCTCCTCAGGG + Intronic
1063520627 10:6737509-6737531 GGCTGAGCAAGTTCTTCTAATGG - Intergenic
1065786662 10:29222134-29222156 GGTGGAGAATGTGTTTCAAAAGG + Intergenic
1070360267 10:75681583-75681605 CATGGAGCATGCTCTTCTCATGG + Intronic
1071057429 10:81527901-81527923 TGTGTAGCATGTTCTTTTAGTGG - Intergenic
1071951217 10:90704414-90704436 GATGGAGAATGTTTTTCTACAGG + Intergenic
1072464057 10:95646832-95646854 GGTTGTCCATGTTCTTCTTAAGG + Intronic
1073352417 10:102829356-102829378 TGTGGAGAATGTTCTGCTAAGGG - Intergenic
1073518487 10:104101626-104101648 GATGGAGACTGTTCTGCTAAGGG + Intergenic
1075025636 10:118981276-118981298 GGAGGAGAATTTTCTCCTAAGGG + Intergenic
1075386333 10:122057959-122057981 GGTGGAGCAAGTCTTTCGAAAGG - Intronic
1078915163 11:15771848-15771870 GGTGGAGGGTGTTCTTTGAATGG + Intergenic
1080545261 11:33310844-33310866 GGTAGATCATGTTATTCTAAGGG + Intronic
1081001329 11:37676287-37676309 TCTGGGGCATGTTCTTCTCAGGG - Intergenic
1082736702 11:56863940-56863962 GGAGCATCATGTTCTTATAATGG - Intergenic
1083673947 11:64315227-64315249 AGAGGAGTATGTTCTACTAAAGG + Exonic
1087274879 11:96151167-96151189 GATGGAGCATGTTCTGAAAAAGG - Intronic
1087487393 11:98772977-98772999 GCTGGATAATTTTCTTCTAATGG + Intergenic
1090357649 11:126150596-126150618 GGTGGAGTAGGTTCTTCAAGTGG + Intergenic
1092125734 12:6073915-6073937 GATGGAAGATGTTCATCTAAGGG - Intronic
1095962878 12:47846356-47846378 GGAGGAGCATGTCCTGCTCATGG - Exonic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1104809173 12:131610308-131610330 GTTGGAGCAGGTTCGTCTGAAGG + Intergenic
1106611016 13:31280582-31280604 GATGGAACATGTTCTGCTCAAGG + Intronic
1112947229 13:104944313-104944335 GATGAAGCATGTGCTTCTGAAGG + Intergenic
1118945103 14:70377976-70377998 GGAAGAACATGTTTTTCTAAAGG + Intronic
1123721152 15:23063069-23063091 GGTAGAGCATGTACTTCACATGG + Intergenic
1130885018 15:88085446-88085468 GGCAGAGCATATTCTTCTCATGG - Intronic
1131380422 15:91959133-91959155 GCTGGAGGCTGTTATTCTAAGGG + Intronic
1131662226 15:94530183-94530205 GGTGGAGCAAGTGCTCCTGATGG - Intergenic
1138279070 16:55759245-55759267 ATTGTAGCATGTTCTTCTTATGG + Intergenic
1138289468 16:55834436-55834458 GTTGTAGCATGTTCTTCTTATGG - Intergenic
1147160274 17:38565701-38565723 GGGAGAGCATCTTCTTCTGATGG + Intronic
1147755662 17:42765868-42765890 GCTGGAGTACGTTCTTCTAGGGG + Intergenic
1155717689 18:28967464-28967486 AGTGGAGGATGTTCCTATAAGGG + Intergenic
1160415334 18:78706015-78706037 CGTGGACCGTTTTCTTCTAAAGG + Intergenic
1162224805 19:9211798-9211820 GGTGCAACATATTCTTCTCATGG + Intergenic
1162963072 19:14139862-14139884 GGTGGATCATGAGCTTCTCAGGG - Intergenic
1163050351 19:14678622-14678644 GGTGGAGGTTGTTGTTATAATGG + Intronic
926004214 2:9359703-9359725 TGTGGACCATGTTCCTCTCAAGG + Intronic
931104647 2:59042165-59042187 TCTGGAGCATGTTCTTCTTGTGG + Intergenic
933218082 2:79653428-79653450 AGAGGAGCCTGTTTTTCTAATGG - Intronic
934099218 2:88636067-88636089 CCTGGAGCATGTTCTTCTCATGG + Intergenic
936408369 2:112229526-112229548 GCTAGGGCATGTTCTTCTCATGG - Intronic
937299394 2:120829929-120829951 GGGGGCGCATGTTTTGCTAAGGG + Intronic
937843177 2:126547533-126547555 GTTGGAGCAAGCTCTTCTCATGG - Intergenic
937894539 2:126968764-126968786 GGTGGAGCATTTTCTCTTAGTGG - Intergenic
938546295 2:132335389-132335411 TGTGAACCTTGTTCTTCTAATGG + Intergenic
940788256 2:158005106-158005128 TGAGGAGCCTGTTCTTCTACTGG + Intronic
942040361 2:172055545-172055567 GGAGGACCATTATCTTCTAAAGG + Intronic
943192487 2:184696483-184696505 GGTCTAGAATGTTGTTCTAAAGG + Intronic
943562237 2:189477731-189477753 GGTTTAGCTTGTTGTTCTAATGG + Intergenic
944532559 2:200681549-200681571 GCTGGAGCATTTTCATCCAAGGG + Intergenic
945540736 2:211082924-211082946 GGTGGAACATGTTCTGAGAAAGG - Intergenic
946529480 2:220556463-220556485 GGTAGAACATGTTGTTCTTATGG - Intergenic
948058698 2:235028218-235028240 GATGGAGCCTGCTCTTCTAGGGG + Intronic
948083372 2:235226109-235226131 CTTGGAGCATGTGCTTCTCAGGG - Intergenic
1170873108 20:20226301-20226323 GCCAGAGCATGTTCTTCTCACGG - Intronic
1177903399 21:26945645-26945667 GGTGAAGCATGTAATTTTAAAGG + Intronic
1178992169 21:37366101-37366123 CGTGGAGCCGGTTCTTCGAAGGG - Intronic
1181825489 22:25512068-25512090 GGTGGGGAATGTTCTGCTTATGG + Intergenic
1185018447 22:48359197-48359219 GGTGGGCCAGGTTCCTCTAATGG - Intergenic
1185097462 22:48819249-48819271 GGTGGGGCCTGTCCTTCTGAAGG + Intronic
951097869 3:18652762-18652784 AGTTGAGCATATTCTTCTAGTGG + Intergenic
953477146 3:43215176-43215198 GCTGGGGCATGCTCTTCTCATGG + Intergenic
953700913 3:45195119-45195141 GGTGGGGCATGCTGTTCTCATGG - Intergenic
954279637 3:49567539-49567561 GCTGGGGCATGTTCTTCTTACGG + Intronic
955126088 3:56114374-56114396 GGTGGAGCAAATTTTTCCAAAGG + Intronic
956145095 3:66184074-66184096 TGTGGAGCAGGGTCTTCTGAAGG - Intronic
959214137 3:103428152-103428174 GCTGAATCATGTTCTTCTTATGG - Intergenic
959864305 3:111248603-111248625 GCTGGGGCATGTTCTTCTCATGG + Intronic
960136031 3:114106316-114106338 GGTGAAGCACTTTCTCCTAATGG - Intergenic
960700649 3:120436226-120436248 TGTGGACCATGTTGTTTTAAAGG - Intronic
963192430 3:142487538-142487560 GTTGTAGCATATTCTTATAATGG - Intronic
964660867 3:159118930-159118952 TCTGGAGCATGTTCTTAGAATGG + Intronic
966099151 3:176244859-176244881 GCTGGGGCATGTTCTTCTCATGG - Intergenic
969398783 4:6939868-6939890 GGTGAAGCGTGTTCTTCCGAAGG + Intronic
970058405 4:12001216-12001238 AGAGGAGCATGTTCCTATAAAGG - Intergenic
974704033 4:65488322-65488344 GCTGGAAAATGTACTTCTAAAGG + Intronic
975844274 4:78508529-78508551 GGTGGAGAAGATTCTTCTACTGG - Intronic
977508015 4:97926482-97926504 GGTGGAGCATGTTCTTCTAATGG - Intronic
977830828 4:101590613-101590635 CCTGGGGCATGTTTTTCTAATGG + Intronic
986115336 5:4768390-4768412 TGTGGTGCTTGTTCTTATAAGGG - Intergenic
987105659 5:14636097-14636119 AATGGAGAATGTACTTCTAATGG - Intergenic
987652359 5:20758833-20758855 GTTGGGGCATTTTTTTCTAAGGG + Intergenic
995430600 5:112071144-112071166 GCTGGAGCATATCCTTCAAAAGG - Intergenic
996795648 5:127343648-127343670 GGTGAAGAATGATCTTCTCAGGG + Intronic
997756518 5:136404812-136404834 GGTGGAGCAAGTCTTTCAAAAGG - Intergenic
999087384 5:148904762-148904784 CATGGAGCCTGTTCTTCTCAAGG + Intergenic
1000174972 5:158743076-158743098 ACTGGACCATGTTCTTCTCAAGG - Intronic
1001428331 5:171639792-171639814 GGTGGTGCAGGTTCTTCCCAGGG + Intergenic
1004172724 6:13309915-13309937 GGTTGAGCATGTTTTTATATGGG - Intronic
1004611184 6:17241104-17241126 GCTTGAGCATATTCTTCTTATGG - Intergenic
1008162079 6:48090862-48090884 GTGGGAGCATGCTCTTTTAAAGG - Intergenic
1008706338 6:54165187-54165209 GGAGGAGCATGTGCTTCAGAAGG + Intronic
1013153806 6:107473769-107473791 CGTGGAGCGTATTCTTCTCACGG - Intergenic
1015373973 6:132489620-132489642 GATGGAGAAGGATCTTCTAAAGG + Intronic
1015408432 6:132863947-132863969 GATGGAGAATGTTCTTTAAAGGG + Intergenic
1015890541 6:137965799-137965821 GGTGGAGCAAGACTTTCTAAGGG + Intergenic
1016277715 6:142374152-142374174 GGTGGCAAATGTTCTCCTAAAGG - Intronic
1017374839 6:153757319-153757341 GGATGAGCATGTTCTTGTCATGG + Intergenic
1019639072 7:2093398-2093420 CATGGAACATGTTTTTCTAATGG - Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021059057 7:16086907-16086929 GGCTGGGCATGTTCTTCTCATGG + Intergenic
1022479190 7:30732058-30732080 GGTGGAGCATGTTCTTGGGAAGG - Intronic
1025755768 7:64338479-64338501 AGTGGAGTATGTTGTTCAAATGG - Intronic
1028018081 7:85739797-85739819 GGTGGAGTCTGTTATTTTAAAGG + Intergenic
1028728507 7:94117347-94117369 GCTGGAGCATGTTCTCTTCATGG + Intergenic
1031195582 7:118609464-118609486 GGTGGAGACTGTTCTTCTGCTGG + Intergenic
1031639513 7:124144400-124144422 GTGAGAGCATGTTCTTCTAATGG + Intergenic
1033232308 7:139609867-139609889 GGTCTACCATGTTCTTTTAATGG + Intronic
1039393843 8:37205600-37205622 CATGGAGCATGTTCCTCTGAAGG - Intergenic
1039819335 8:41122345-41122367 GGTGTAGCATGGTCTGCTGAAGG - Intergenic
1041487618 8:58396313-58396335 GGTGGTGCCTCTTCTTATAAGGG - Intergenic
1043884928 8:85588113-85588135 GGCGGAGTATGATCTTCCAAAGG + Intergenic
1044136131 8:88588390-88588412 GGATGGGCAGGTTCTTCTAAAGG - Intergenic
1044906730 8:97012389-97012411 GTTGGGGCATGTTCTTGAAATGG + Intronic
1046062074 8:109151713-109151735 TGTGTAGCACGTTCTTCTGAAGG - Intergenic
1048304964 8:133277886-133277908 GGTGAAGCATCTTGTGCTAAGGG + Intronic
1053035988 9:34827125-34827147 GGTGGAGCAGGTCCTTCCCATGG - Intergenic
1059771096 9:117426645-117426667 GGCAGAGCATGTTCCTCTCACGG - Intergenic
1061107204 9:128540347-128540369 TGTGGGGCATGTTGGTCTAAGGG - Intronic
1190150301 X:47941087-47941109 GGTTGAGCAGTTTCTTGTAAAGG - Intronic
1197146469 X:123177878-123177900 GCTGCTGCATGTTCTTCTCATGG + Intergenic
1201518803 Y:14849385-14849407 GCTGCTGAATGTTCTTCTAATGG - Intergenic