ID: 977508703

View in Genome Browser
Species Human (GRCh38)
Location 4:97934977-97934999
Sequence ATCTGATACTGGGCGTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4205
Summary {0: 1, 1: 1, 2: 31, 3: 610, 4: 3562}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977508700_977508703 4 Left 977508700 4:97934950-97934972 CCTCTAGTAGAATTTGTCTGTGA 0: 2
1: 73
2: 2052
3: 6751
4: 3931
Right 977508703 4:97934977-97934999 ATCTGATACTGGGCGTTTTTTGG 0: 1
1: 1
2: 31
3: 610
4: 3562
977508699_977508703 14 Left 977508699 4:97934940-97934962 CCTCTTTGTACCTCTAGTAGAAT 0: 66
1: 2856
2: 7785
3: 2940
4: 939
Right 977508703 4:97934977-97934999 ATCTGATACTGGGCGTTTTTTGG 0: 1
1: 1
2: 31
3: 610
4: 3562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977508703 Original CRISPR ATCTGATACTGGGCGTTTTT TGG Intronic
Too many off-targets to display for this crispr