ID: 977509533

View in Genome Browser
Species Human (GRCh38)
Location 4:97945214-97945236
Sequence TTGGAGACTTAGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 1, 1: 3, 2: 52, 3: 167, 4: 687}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977509533_977509540 17 Left 977509533 4:97945214-97945236 CCCTCCCCTTTCTAAGTCTCCAA 0: 1
1: 3
2: 52
3: 167
4: 687
Right 977509540 4:97945254-97945276 TGTGTGTCTTTGCGTACCCATGG 0: 1
1: 0
2: 3
3: 31
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977509533 Original CRISPR TTGGAGACTTAGAAAGGGGA GGG (reversed) Intronic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902408249 1:16198288-16198310 TTGAGGACATAGAAAGGAGAGGG + Exonic
902472649 1:16659457-16659479 TTGAATAATTAGAAATGGGAAGG + Intergenic
902486155 1:16747986-16748008 TTGAATAATTAGAAATGGGAAGG - Intronic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902749738 1:18499451-18499473 ATGGGGACCTGGAAAGGGGAAGG - Intergenic
902780965 1:18704860-18704882 ATTGAGGCATAGAAAGGGGAAGG - Intronic
903235301 1:21946530-21946552 TTGGGGACTTGGTAGGGGGAAGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903792126 1:25900968-25900990 TTGGATATTTAGGAAGGGGATGG + Intronic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
905823530 1:41012841-41012863 TTTATGACTGAGAAAGGGGAGGG + Intergenic
905853821 1:41294022-41294044 TTGGAGATGGAGAAAAGGGAAGG + Intergenic
906077997 1:43066352-43066374 ACTGAGGCTTAGAAAGGGGAAGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909350828 1:74651533-74651555 TCTGAGATTTAGAAAGGGTAAGG - Intronic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
910086935 1:83414212-83414234 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
910301819 1:85714416-85714438 TTGGCGATTTTCAAAGGGGAGGG + Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911546319 1:99221967-99221989 ATGGACTCTTAGAAAGAGGAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
911956667 1:104244187-104244209 TCAGAGACTAAGAAGGGGGAGGG + Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912041738 1:105398696-105398718 GTGGGGAATTGGAAAGGGGATGG + Intergenic
912375370 1:109205283-109205305 TGGTAGATATAGAAAGGGGATGG + Intronic
912515720 1:110215481-110215503 TTGGAGACTAGGGTAGGGGAAGG - Intronic
912661978 1:111539773-111539795 TTCCAGCCATAGAAAGGGGATGG + Intronic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
913613589 1:120533027-120533049 TTGAAGACTGAGAAAGTTGAAGG + Intergenic
914577483 1:148988224-148988246 TTGAAGACTGAGAAAGTTGAAGG - Intronic
915162397 1:153929736-153929758 ATGGAGAGTGAGAAAGGGAAGGG - Exonic
915419197 1:155766139-155766161 TTCGAAACTTAGAAGGGGCAAGG + Exonic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915942794 1:160129513-160129535 TGGGGGACTTAGCAGGGGGAGGG - Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917521497 1:175751583-175751605 TAGGACCCTTATAAAGGGGATGG + Intergenic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918432512 1:184476784-184476806 TTGGAGACAAAGGAAGGAGATGG - Intronic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918895532 1:190338788-190338810 TTTTAGACTTAGAAAAGGTAAGG + Intronic
919037843 1:192338951-192338973 TTGCATAACTAGAAAGGGGAAGG - Intronic
919104369 1:193130450-193130472 TTTGAGACTGTGAAAGGAGATGG - Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919331970 1:196183398-196183420 TCAGAGACCTTGAAAGGGGAAGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920795570 1:209133093-209133115 ATGGAGAATTGGAAAAGGGATGG + Intergenic
920879590 1:209867449-209867471 TTGAGGACTTTAAAAGGGGAGGG - Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922145855 1:222943545-222943567 TTGCAGACAGGGAAAGGGGAAGG - Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923710186 1:236382213-236382235 TTGGAGACATAGAAATTGAAGGG - Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064776339 10:18781930-18781952 TTGGAGACTTAGCTAAGGGTTGG + Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1064982635 10:21179781-21179803 TTGAAGACGGAGGAAGGGGAAGG + Intergenic
1065009138 10:21405964-21405986 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065561445 10:26968100-26968122 TTGGAGACCTATAAAGGAGTTGG - Intergenic
1066050092 10:31626116-31626138 ATGGAGATTTGGAAAGGTGAAGG - Intergenic
1066251471 10:33637281-33637303 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068106708 10:52626974-52626996 TTGCAGACATTGAAAGTGGATGG - Intergenic
1068358577 10:55945113-55945135 GTGGAGAGCTGGAAAGGGGATGG + Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069024362 10:63523296-63523318 TTGGAGAATCAGAAAAGGCAAGG + Intronic
1069997239 10:72349995-72350017 TGGCAGACTTAGAAAAGGAAGGG + Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072479852 10:95800300-95800322 TTAGGGATTTTGAAAGGGGAGGG + Intronic
1073447323 10:103589498-103589520 GTGGAGCCTGTGAAAGGGGAGGG - Exonic
1073502270 10:103951163-103951185 TTTGATACTTAGAGAGGGGAAGG + Intergenic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074566625 10:114585253-114585275 CTGGAGACTAAAAAAGGGAAAGG - Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1075968237 10:126631242-126631264 TTGGAGAGCTAGAAAGGAGGAGG - Intronic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1076350679 10:129812991-129813013 TTGGGGACAGACAAAGGGGAAGG - Intergenic
1076564216 10:131387067-131387089 CTGGAGACTTGAAAAGGTGAGGG - Intergenic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077645382 11:3918961-3918983 CAGGAGACTTGGACAGGGGAGGG + Intronic
1078297573 11:10089200-10089222 TTGGAGACTTAAAGGTGGGAGGG - Intronic
1078673335 11:13385091-13385113 TTTGAGACTCAGCCAGGGGAAGG + Intronic
1079252897 11:18800409-18800431 CTGGAGACTTGGAAGGGTGAAGG + Intergenic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080266422 11:30406541-30406563 GGGGACACTTAGAAAAGGGAGGG + Intronic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081034390 11:38124140-38124162 GAGGAGAGTTAGAAAGGGGATGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081894162 11:46570318-46570340 GAGGAGACTTAGAGTGGGGATGG - Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1084635237 11:70387790-70387812 TGGGAGACTGGGAGAGGGGAAGG - Intergenic
1084661387 11:70548543-70548565 TTGGGGACTCTGGAAGGGGAAGG - Intronic
1085318339 11:75559536-75559558 CTGGAGACTTTGGAAGGGCAGGG - Intergenic
1085776904 11:79374937-79374959 TTAGAGTCTTTGAAAGGAGAAGG - Intronic
1086893341 11:92284195-92284217 TTGGACACATAGAAAAGGGAGGG + Intergenic
1087270916 11:96110732-96110754 TGGGAGACTTACAAAAGAGATGG + Intronic
1087705591 11:101487536-101487558 TTGGAGACTTAGAAAAGTGGGGG - Intronic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088591565 11:111408103-111408125 TTGGAGGCTTAGGACAGGGAAGG - Intronic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1088849750 11:113695207-113695229 ATGGAGGCTTAGAAAGGGTTCGG + Intronic
1090299528 11:125623491-125623513 TTGGTTACATAGAAAGGGAAGGG + Intronic
1090701617 11:129301110-129301132 TTGGATACTTAGAAAGGAGTTGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091130165 11:133139579-133139601 TCTGACACTTAGAAATGGGAAGG + Intronic
1091272453 11:134327177-134327199 GTGCAGACCGAGAAAGGGGATGG - Intergenic
1091812891 12:3414720-3414742 ATGGGGAGTTGGAAAGGGGATGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092549104 12:9478384-9478406 CTGGAGACTTGGGAAGGGGTGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093037013 12:14341712-14341734 CTGTAGTTTTAGAAAGGGGAAGG - Intergenic
1093174341 12:15895547-15895569 TTGGCTACTTAAAAATGGGAAGG + Intronic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094503891 12:31044083-31044105 CTGGAGACTTGGGAAGGGGTGGG - Intergenic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096427443 12:51516153-51516175 TTGGAGACTTAGAGAAGAGGGGG + Intergenic
1096612245 12:52810090-52810112 ATGGAGACTTGAAAAAGGGAGGG + Intronic
1096791853 12:54050318-54050340 ATCGAGATTTAGAAAGGAGATGG + Intronic
1097136330 12:56859523-56859545 ATGGAGACTTGGAAGGGAGAGGG - Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098109359 12:67105505-67105527 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1098161986 12:67654592-67654614 TTGGTGACTTGGGAAGGTGAGGG + Intronic
1098500105 12:71182168-71182190 TTGGAGACTTAGGATGGGGGAGG + Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099102292 12:78457898-78457920 TTGGAAAATTAGAAATGGGAAGG + Intergenic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1100910922 12:99362149-99362171 TTGGTGTCTTAAAAAGTGGAGGG + Intronic
1101132179 12:101700200-101700222 TTGAACACTTAGAAAGAGCAGGG + Intronic
1101378039 12:104187853-104187875 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102244032 12:111343619-111343641 TTGGGGACTGAGAGAGGGTATGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103205971 12:119129182-119129204 TTGAAGACATAGACAGGGCAAGG - Intronic
1104127968 12:125865209-125865231 TTAGGGATTTTGAAAGGGGAAGG + Intergenic
1104143132 12:126007153-126007175 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1104190393 12:126476799-126476821 TTGGAGACTTGGAAGGGTCAGGG + Intergenic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1107716076 13:43200588-43200610 CTGGAAAATTAGAAAGGGCAAGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1108159056 13:47618897-47618919 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109863761 13:68234562-68234584 TTGCAGACATACAAAGTGGAAGG - Intergenic
1109885205 13:68532866-68532888 TTGGAGTCTGAGGGAGGGGAAGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110257814 13:73451472-73451494 TTGGAGACTGGGAAAGGGCCAGG + Intergenic
1110418831 13:75281441-75281463 TTGGAGACTTGGGAAAGGGTAGG - Intergenic
1111330559 13:86759056-86759078 TTGAAGAGTTAGAAAGGTGTTGG + Intergenic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1111894913 13:94129452-94129474 CTGGAGACTTGGAAAGGAAATGG - Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1113025734 13:105938916-105938938 TTGAAGAATGAGAAAGGTGAAGG - Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1114517098 14:23307177-23307199 GTGGAGCCCTGGAAAGGGGAGGG - Exonic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115525975 14:34281126-34281148 TTAGAGATTTTAAAAGGGGAGGG + Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115838658 14:37440430-37440452 ATAGAGACTGAGAAAGGTGAGGG - Intronic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117749717 14:58908613-58908635 CTGGAGACTTGGAAGGGTGAGGG + Intergenic
1117997262 14:61489542-61489564 TAGGAGACTCAGCAAGGGAAGGG + Intronic
1118133276 14:62991982-62992004 TTGGAGACTTGGGAGGGTGAAGG - Intronic
1118329283 14:64803154-64803176 AAGGAAATTTAGAAAGGGGAAGG - Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1119817081 14:77579332-77579354 GTGGAGACTTGGAAGGGTGAGGG - Intronic
1119871891 14:78024913-78024935 GGGGAGAGTAAGAAAGGGGAAGG + Intergenic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1122111332 14:99505123-99505145 TTGGAGATTTAGCAGGGGAATGG + Exonic
1123127940 14:105962789-105962811 TTGGAGAACTTGAAAGGAGAAGG + Intergenic
1202889758 14_KI270722v1_random:144941-144963 TTAGGGATTTTGAAAGGGGAGGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1125052941 15:35322308-35322330 TTGGACTCTAAGCAAGGGGAGGG + Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126573715 15:50177929-50177951 TTGGAAACTTTGAAGGGGGTAGG + Intronic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1127065700 15:55235672-55235694 TAGGAGACTTTGAAAAAGGAGGG - Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129825278 15:78630868-78630890 TTGGAGGCTGAGGGAGGGGAGGG - Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130583986 15:85165194-85165216 TTAGGGATTTTGAAAGGGGAGGG - Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131227890 15:90640367-90640389 TAGAAAACTGAGAAAGGGGAAGG - Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131586606 15:93702545-93702567 TAGGAGATTTAGAAAGCTGAAGG + Intergenic
1131638708 15:94265785-94265807 TTGAAAACTTAGAAAGTAGAAGG + Intronic
1132179104 15:99738261-99738283 TTGGAGCCCTAGCAAGGGTAGGG + Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134167450 16:11941773-11941795 TGGGAGACTGAGATGGGGGAGGG - Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134712775 16:16336180-16336202 TGGGGGACTGAGAAGGGGGAGGG + Intergenic
1134954052 16:18372513-18372535 TGGGGGACTGAGAAGGGGGAGGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135281927 16:21159538-21159560 TTGGAGCCTTGGAAGGGGAAAGG + Intronic
1135312881 16:21419425-21419447 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135365804 16:21851705-21851727 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135446010 16:22519457-22519479 TGGGAGACTGAGATGGGGGAGGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135672511 16:24387296-24387318 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135885847 16:26306788-26306810 TTAGAGACTTAATAATGGGATGG + Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136152038 16:28357156-28357178 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136168291 16:28471024-28471046 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136194710 16:28644027-28644049 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136211042 16:28758126-28758148 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136255763 16:29038084-29038106 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1136309547 16:29398152-29398174 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136322994 16:29499933-29499955 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1136437678 16:30239901-30239923 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137802758 16:51276093-51276115 TTGGACAATTAGAAACTGGAAGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138135128 16:54514855-54514877 CCGGAGACTTAGAAGGTGGATGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138800286 16:60018144-60018166 ATGGAGGCTTAGAAAGGTGAGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1140230363 16:73112758-73112780 CAGTAGACTGAGAAAGGGGAAGG + Intergenic
1140365441 16:74377389-74377411 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141023825 16:80524373-80524395 TTGGAGAGTTAAAAAGGTGAGGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1143588247 17:7862911-7862933 TTGGAGATTTATAAGGGGGAGGG + Intronic
1143740527 17:8949749-8949771 TTGGGGACTTAGCAGGGGAAAGG + Intronic
1144637498 17:16919646-16919668 TTGGAGACTCCCCAAGGGGAAGG - Intergenic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1146008479 17:29177080-29177102 GTGGAGGCTTAGAGAGGGGAGGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146460738 17:33044339-33044361 TTGGACACATAGAAGGTGGATGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1147649892 17:42055824-42055846 TCAAAGACTTGGAAAGGGGATGG + Intronic
1148142021 17:45335752-45335774 TTGAAGACAGAGAAAGGGAATGG - Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148466244 17:47866830-47866852 TTGGAGGCTTGGCAAGGAGAGGG + Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149883290 17:60314638-60314660 TTAGAGACAAAGAAAAGGGAAGG + Intronic
1151453175 17:74211734-74211756 TTGGAGACTGCGGCAGGGGAGGG - Intergenic
1153155790 18:2147440-2147462 CTGAAGACTTAGAAATGTGAAGG + Intergenic
1153389719 18:4541605-4541627 TTGGAAACATAGAAAGCTGAAGG - Intergenic
1153482590 18:5562526-5562548 TTTGATATTTATAAAGGGGATGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154118680 18:11633782-11633804 TGGGAGACTGAGATGGGGGAGGG - Intergenic
1154193080 18:12246406-12246428 TTGATGTCATAGAAAGGGGAAGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155407358 18:25503570-25503592 GTGGAGGCTTAGAGATGGGATGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156395739 18:36698293-36698315 TTAGAGACTGAGAAATGGCAAGG - Intronic
1156895193 18:42238299-42238321 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
1157505740 18:48225224-48225246 TTGGAGTTTTAGAAATGGGAGGG + Intronic
1157522877 18:48357276-48357298 TTGGAGGCTGGGAAGGGGGAGGG + Intronic
1157758605 18:50241683-50241705 TTAGGGATTTTGAAAGGGGAGGG + Intronic
1157999525 18:52599958-52599980 TAGGAACCATAGAAAGGGGATGG - Intronic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1159347757 18:67228606-67228628 TTAAAGACTTCAAAAGGGGAGGG - Intergenic
1159447392 18:68557524-68557546 GTGGGGAATTGGAAAGGGGATGG + Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160914987 19:1492050-1492072 CTAGAGATTTGGAAAGGGGAAGG - Intronic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163381941 19:16975008-16975030 TTGGAGATTCAGAAATGGGTTGG - Intronic
1163888985 19:19994147-19994169 TTGGAGCCTTAGAAACAAGATGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165254904 19:34570603-34570625 TTAAGGACTTCGAAAGGGGAAGG - Intergenic
1166236759 19:41462434-41462456 TTAGGGACTTCAAAAGGGGAGGG + Intergenic
1166317250 19:41996171-41996193 ATGGAGACTGGGAAAGGGGGAGG + Intronic
1166539512 19:43595958-43595980 TTGGTGATTTGGAAGGGGGAAGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166888747 19:45976765-45976787 TGAGAGACTCAGAAAGGGTAAGG - Intergenic
1167414080 19:49361388-49361410 ACGGAGACCTAGAAAGGGCAGGG + Exonic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168327070 19:55543944-55543966 GTTGAGAATTAGAAAGGGGGAGG + Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1202705040 1_KI270713v1_random:16275-16297 TTGAATAATTAGAAATGGGAAGG + Intergenic
925189088 2:1868618-1868640 TTGAAGGCTTAGGAAGGGAAGGG + Intronic
925434969 2:3828955-3828977 TTTGAGAATTAGGAAGCGGAGGG + Intronic
925438808 2:3866394-3866416 TTGGGGCCTCAGCAAGGGGAAGG + Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
928324077 2:30306189-30306211 ATGGAAACTTACAGAGGGGAAGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930590458 2:53320813-53320835 ATGGAGACTTACAGAGGTGATGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
932815725 2:74860151-74860173 ATGGAGACTTGGAAGGGTGAGGG + Intronic
932827269 2:74953025-74953047 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933148446 2:78885470-78885492 TTAGAGACTTGGAAGGGGGAGGG + Intergenic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934721064 2:96577199-96577221 GTGGAGAGTTAGAACAGGGAAGG - Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937642290 2:124227372-124227394 TTGGACATTTAGAAGGGGCAGGG - Intronic
937684985 2:124685904-124685926 TAAGAAACTTAGAAAGCGGAGGG - Intronic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940442438 2:153733941-153733963 TTGAAGAAATAAAAAGGGGATGG - Intergenic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
941622984 2:167799344-167799366 TTGGAGACTTGCAAGGGGGAGGG - Intergenic
941717529 2:168779713-168779735 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
941998148 2:171621057-171621079 ATGGGGAATTTGAAAGGGGATGG + Intergenic
942312906 2:174671981-174672003 TTGGTGATTTTCAAAGGGGAGGG - Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943928168 2:193815325-193815347 CTTTAGACTGAGAAAGGGGAAGG + Intergenic
944024146 2:195143389-195143411 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
946633857 2:221702459-221702481 TTGGGGACTTTGAGAGTGGAAGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
948775345 2:240285177-240285199 TTGGAGACTTGGAAAGTCCAGGG - Intergenic
948814984 2:240505948-240505970 CTGGATATTTAGGAAGGGGAAGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169292283 20:4362982-4363004 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169938826 20:10915092-10915114 ATGGAGACTTGGAAGGGTGAGGG + Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170856920 20:20065358-20065380 TTGGGGTCTGAGCAAGGGGAAGG - Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1172794368 20:37527082-37527104 AAGGAGATTTGGAAAGGGGAAGG + Intronic
1172871684 20:38139656-38139678 TGGCAGAGGTAGAAAGGGGAAGG + Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173903423 20:46607643-46607665 TCTGAGACTCAGGAAGGGGAAGG - Intronic
1176458169 21:6930826-6930848 TTAGAGATTTTAAAAGGGGAGGG + Intergenic
1176836343 21:13795921-13795943 TTAGAGATTTTAAAAGGGGAGGG + Intergenic
1177123822 21:17170796-17170818 ATGGATACTTGGAAAGGCGAAGG - Intergenic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177848599 21:26320446-26320468 TTTAAGACTTAAAAAGGGGAAGG - Intergenic
1177883849 21:26725004-26725026 ATGGAGACTTAGAAGTGGGGAGG - Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178638618 21:34327656-34327678 ATGGAGATGTACAAAGGGGAGGG - Intergenic
1178742819 21:35218723-35218745 TTGTATACTTTGAAGGGGGATGG - Intronic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1178901380 21:36601611-36601633 TTAGAGACCCAGGAAGGGGAGGG + Intergenic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179056357 21:37938754-37938776 TTGGGAACTCAGGAAGGGGAAGG + Intergenic
1179130994 21:38636964-38636986 TGGGAGACTTTAAATGGGGATGG + Intronic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180331884 22:11488683-11488705 TTAGGGATTTTGAAAGGGGAGGG + Intergenic
1180926796 22:19560774-19560796 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1182838722 22:33366091-33366113 TTAGAAACTTAGAAAGTGAAGGG - Intronic
1183398241 22:37585512-37585534 TTGGAGACTTAGCAGGGAGTGGG + Intergenic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951823662 3:26843109-26843131 TTGGAGACTTTGAAGGGTGGGGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952331339 3:32367039-32367061 TTGGAGACAGAGGAAGGGGTAGG - Intronic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952588968 3:34928297-34928319 TTAGAGACATAGAAGTGGGAGGG + Intergenic
952618086 3:35299896-35299918 TTAGAAACTCAGAAACGGGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952924736 3:38312800-38312822 TGTGAGGCTTAGACAGGGGAAGG + Intronic
953081239 3:39620530-39620552 TTAGAGACCCAGAAATGGGAGGG + Intergenic
953137303 3:40192253-40192275 AGGGAGAATTAGAAAGGTGAGGG - Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
954144432 3:48627419-48627441 TTAGAGACTGAGACAGGGCAGGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957090756 3:75727820-75727842 TTAGGGATTTTGAAAGGGGAGGG - Intronic
957244706 3:77702378-77702400 GTGGAGAGCTGGAAAGGGGATGG - Intergenic
957481023 3:80793961-80793983 GTGGAGACTTGGAAGGGTGAGGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959375512 3:105584334-105584356 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960235346 3:115275305-115275327 TTGGGGATTTAGAAAGGGACAGG + Intergenic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
960879796 3:122332760-122332782 TGGCAGACTGAGAAAGGTGAAGG + Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962011317 3:131393777-131393799 TTGGATTCTCAGATAGGGGATGG - Intergenic
962293345 3:134156177-134156199 TTGGAGTCTTTGACATGGGAAGG - Intronic
962764165 3:138546069-138546091 TTAAAGACTTTAAAAGGGGAGGG - Intronic
963025954 3:140918975-140918997 ATGGAGACTTGTTAAGGGGATGG - Intergenic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
964577067 3:158183064-158183086 GTAAAGAATTAGAAAGGGGAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965347735 3:167572963-167572985 AGGAAGAATTAGAAAGGGGAGGG - Intronic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
966934138 3:184694778-184694800 ATGGACACTTAGAAATGGGGCGG - Intergenic
967070892 3:185961443-185961465 TTGGGGAGCTAGACAGGGGATGG + Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967427909 3:189348776-189348798 TGGAAGACTAAGAAAGGTGAAGG + Intergenic
967673858 3:192272314-192272336 TTGCAGACAAGGAAAGGGGACGG + Intronic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
968885421 4:3328225-3328247 ATGGAGACTTGGAAAGGTGAGGG + Intronic
969144618 4:5111600-5111622 CTGGAGACTTCAAAAGGGGTTGG + Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
970998180 4:22291895-22291917 TTGTGGACTTAGAAAGGGAAAGG - Intergenic
971628416 4:28955549-28955571 CTGGAGACTTAGAAATGTTAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972357503 4:38294344-38294366 TTGGAAAGCTTGAAAGGGGATGG + Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975201557 4:71596249-71596271 TTGGAGAGAGAGAAAGGGAAGGG + Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
975707116 4:77122219-77122241 TTAGAGGCTAAGAAAGGAGAGGG + Intergenic
975790594 4:77945749-77945771 TTGAGGACTTCAAAAGGGGAGGG + Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976784997 4:88809272-88809294 TTGGAGAGTTAAAAAGGGAATGG - Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977249728 4:94676380-94676402 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978002450 4:103573009-103573031 TTTGAGTCTTAGAAGGTGGATGG + Intergenic
978555621 4:109977199-109977221 TTGGAGAGTTAGAAATTGGTTGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980154859 4:129092216-129092238 TTGAAGGCGTAGAAAGGGGCTGG - Intronic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980855816 4:138438535-138438557 ATGGAGATCTAGAAAAGGGAAGG - Intergenic
980871459 4:138615753-138615775 ATGGGGACCTGGAAAGGGGATGG - Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981382603 4:144090620-144090642 ATGGAGAGTTGGAAAGGGGATGG - Intergenic
981473793 4:145167015-145167037 GTGCACACATAGAAAGGGGATGG + Intronic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981786052 4:148480881-148480903 TTGGAGAGCTAGAATGTGGAGGG - Intergenic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982325809 4:154127277-154127299 GTGGGGAGCTAGAAAGGGGATGG + Intergenic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983523050 4:168730772-168730794 TTGGAGCCTGAGTAAGGGAAGGG + Intronic
984129543 4:175856694-175856716 ATGGGGACCTGGAAAGGGGATGG + Intronic
984245315 4:177268484-177268506 ATAGAGAGTTGGAAAGGGGATGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984440199 4:179760102-179760124 TTGAAGTCTTAGAAAGGGGTAGG - Intergenic
984919225 4:184749271-184749293 CTGGAGGCTGAGGAAGGGGAGGG + Intergenic
984933743 4:184871556-184871578 TTGTAGGCTGAGAAAGGGTAGGG + Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986616117 5:9619027-9619049 TTGGAGGCTTGGGAAGAGGATGG - Intergenic
986658383 5:10037479-10037501 TTTGAGACATACAAAGGAGACGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987615573 5:20269705-20269727 TTGTAGACTTAGAAGGGTGAAGG + Intronic
987715057 5:21557734-21557756 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
988062278 5:26186500-26186522 TTGGAGGCTGAGATAGAGGAAGG - Intergenic
988679749 5:33473401-33473423 TTAAAGACTTGGAAAGGGAAGGG - Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
988912172 5:35854350-35854372 TTGGAGACTTAGAAAAGCTGAGG - Intronic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
990631461 5:57674755-57674777 AGGGAAACTGAGAAAGGGGAAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991644996 5:68792664-68792686 TTGGGGATCTGGAAAGGGGATGG + Intergenic
991712178 5:69418650-69418672 TTGTTGATTTAGGAAGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992446181 5:76835985-76836007 TTGGAGAAATAGGAATGGGATGG + Intergenic
992503938 5:77367107-77367129 TTGTAAACTTAGAAAGAGGAGGG + Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993768448 5:91893182-91893204 TTGAAGATTGAGAGAGGGGAAGG + Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994415607 5:99466633-99466655 TTGAAAACTCAGAAAGGAGAAGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
995346256 5:111122554-111122576 TTCTTGAGTTAGAAAGGGGATGG - Intronic
995661166 5:114484780-114484802 TTAGGGAATTAGAAAGGGGATGG + Intronic
996444985 5:123537412-123537434 GTGGAGACTTGGAAGGGTGAGGG + Intronic
996446506 5:123559174-123559196 TTAGAGACTGAGAATGGGGGAGG + Intronic
996577078 5:124987582-124987604 TTGCAGACATAGAGAAGGGATGG + Intergenic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997069675 5:130606655-130606677 TTGGGTACTTAGAAAGAGGAAGG - Intergenic
997707499 5:135971718-135971740 TTGGAGACTTGGGAAGGGTGGGG - Intergenic
999525333 5:152399305-152399327 TTAAAGACTAAGAATGGGGAAGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
999901429 5:156090451-156090473 TTAGGGATTTTGAAAGGGGAGGG + Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000718703 5:164679477-164679499 GGGGAGGCATAGAAAGGGGATGG - Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001704488 5:173731944-173731966 TCTGAGACTTAGAAAGGAAAAGG + Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003488110 6:6597039-6597061 TTGGAGAGGTAGAAATGGGAAGG + Intronic
1003967379 6:11266020-11266042 ATGGAGACTTGGAAGGGAGAGGG + Intronic
1004101364 6:12615489-12615511 CTGGATACTTTGAAAGGTGAAGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004675572 6:17838760-17838782 ATGGAGACTTGGAAGGGTGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005010986 6:21335455-21335477 TTAGAGCCTTAGACAGGGAAAGG - Intergenic
1005369239 6:25113302-25113324 CTGGAGGTTTAGAAAGGTGAGGG - Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007703205 6:43776212-43776234 TTGGAGGCCTAGAGAGGGGAGGG + Intronic
1008144049 6:47868018-47868040 TTGGAGACTTAGATATGTCAGGG + Intergenic
1009001666 6:57724310-57724332 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010255662 6:73754409-73754431 TTAGAGACTGAGTGAGGGGAAGG + Intronic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010785804 6:79999708-79999730 TTGTATATTTAGAAAAGGGAAGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011213030 6:84974659-84974681 TGAGAAACTTAAAAAGGGGAAGG - Intergenic
1011293282 6:85799795-85799817 ACGGAGACTTGGAAAGGGGAGGG - Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011884517 6:92077598-92077620 TCAGAGACTTATAAAGGAGACGG + Intergenic
1012120711 6:95363256-95363278 TCAGAGACTTAGAATGGGAAGGG + Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1013028596 6:106306819-106306841 TTGGAGATTTTGGAATGGGAAGG - Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013653756 6:112224224-112224246 TTGGAGGATAATAAAGGGGAGGG - Intronic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1014010803 6:116473593-116473615 TTGGAGAGCTAGAAAGTAGATGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014545581 6:122731573-122731595 TTGGAGACTTGGAAGCGGGTGGG + Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1017164315 6:151392607-151392629 TTTGAGATTTAGAAAGGATATGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017498343 6:155001165-155001187 TTGGTGACTGAGAAAATGGAGGG + Intronic
1017523637 6:155223842-155223864 TTGCTGACATGGAAAGGGGAAGG - Intronic
1017782359 6:157725794-157725816 ATGGGGAGTTGGAAAGGGGATGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1017949069 6:159120248-159120270 TTCAAGACTTAAGAAGGGGAAGG - Intergenic
1018402058 6:163433291-163433313 TTGAAGCCTGAGAAGGGGGAAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019404887 7:877866-877888 GTGGAGACAGAGGAAGGGGAGGG - Intronic
1020560981 7:9728341-9728363 TTGGAGATTCAGAAATGGGTTGG + Intergenic
1021416529 7:20392681-20392703 ATGGAGACTTGGAAGGGTGAGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021645945 7:22789592-22789614 GAGGAGAGTTGGAAAGGGGACGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022354585 7:29600832-29600854 CTGGGGACTTAGGAAGGGGCTGG + Intergenic
1022919382 7:34997121-34997143 GTGAAGACATAAAAAGGGGAAGG + Intronic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1024163220 7:46701929-46701951 TTGGAGACAAAGAAAAGTGATGG - Intronic
1024606287 7:51025102-51025124 TGCGAGACTGAGAAAGGTGATGG - Exonic
1026484314 7:70804848-70804870 ATGTATACTTAGAAATGGGATGG - Intergenic
1026506927 7:70992804-70992826 TTGGAGACTCACAAATGGGCAGG - Intergenic
1027303817 7:76870697-76870719 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028264070 7:88701631-88701653 TTGAAGACTTGGAATGGTGAGGG - Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030299164 7:107957901-107957923 TTTGAGAATGAGAAAGGGTATGG - Intronic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031020006 7:116617309-116617331 TTTGAGACATAAAGAGGGGAGGG + Intergenic
1031238501 7:119209189-119209211 GTGGAGACTTAGAAGAGGGTGGG + Intergenic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1032814848 7:135462832-135462854 TTAGAGTTTTAGAATGGGGAGGG - Intronic
1032998447 7:137475986-137476008 TTTGAGACTTTGAAAGGAAAGGG - Intronic
1033881302 7:145887155-145887177 ATGGTGAGCTAGAAAGGGGATGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034465464 7:151226009-151226031 ATGGAAACTGAGAAAGGGGCAGG + Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035672143 8:1426287-1426309 TTGGAGACCTAAAATTGGGAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036968582 8:13328673-13328695 TTTGAGACTTTGACATGGGAAGG + Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037712393 8:21365314-21365336 TTGGAGACTTGGAAGGGTGGAGG - Intergenic
1038238818 8:25788525-25788547 TTGGAGAGTGAGGAAGGGCACGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041310321 8:56510115-56510137 TTGGAGCCTAAGGAAGGGGAAGG - Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041807877 8:61873576-61873598 TTGGTGACTTATAAATGGGTTGG + Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1042716359 8:71777340-71777362 TTGGAGACTTGGAAGGTGGGAGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043220454 8:77655814-77655836 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043482281 8:80665510-80665532 TTAGAGACTTCGAAACGGGGAGG + Intronic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1044338851 8:91023616-91023638 TTGGAGGCTTGGGAAGTGGAGGG + Intronic
1044837783 8:96313051-96313073 TTTGGGAGGTAGAAAGGGGAAGG + Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045065734 8:98442249-98442271 TTGGAGAATTGGAGAGGGGAAGG - Intronic
1045855679 8:106762829-106762851 TTGGAGACAGAGAAATGGCAGGG - Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046363167 8:113187858-113187880 TTGGAGAAGTATAAAGGGGTAGG - Intronic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047102531 8:121694111-121694133 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047379629 8:124347421-124347443 TTGGAGACTTAGAATGGAAGAGG + Intronic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047594682 8:126366386-126366408 CTGGAGAATTAGAAAAGGAAGGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1050195411 9:3078037-3078059 TTGGATACTCAAAACGGGGAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050847275 9:10237652-10237674 TTGCAGACCTAGGAAGAGGAGGG - Intronic
1051287604 9:15512389-15512411 ATGGTGACTAAGAAAAGGGAAGG + Intergenic
1051769742 9:20564331-20564353 GAGGAGACTTAGAAAAGAGATGG + Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052947427 9:34179305-34179327 TGGGAGACTGGGAAACGGGATGG + Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053324250 9:37128382-37128404 TTGGAAGCTTAGAATGTGGAAGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054715399 9:68552537-68552559 GCAGAGACTTAGAGAGGGGATGG + Intergenic
1054749008 9:68885670-68885692 TTGAAGACTTAGAAGAGGGAGGG + Intronic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1056479064 9:86982512-86982534 TTGAAGATCGAGAAAGGGGAAGG + Intergenic
1057635487 9:96762044-96762066 TTGGAGACTTAGGGTGGGAAGGG + Intronic
1057724727 9:97560306-97560328 TGGGAGAATTAGAAAGGGAGAGG + Intronic
1057763464 9:97895489-97895511 TGGGAGGCTGAGACAGGGGATGG - Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058384729 9:104421045-104421067 TTGGAAATTTAGAGATGGGAAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058785637 9:108384116-108384138 TTAGAGGCTTAGGAAGGGGAGGG - Intergenic
1058794546 9:108485201-108485223 CTGGAGAATTAAAAAGGGAATGG + Intergenic
1059094848 9:111401371-111401393 TTAGGGATTTTGAAAGGGGAGGG + Intronic
1059864823 9:118502616-118502638 TTGGAGATTTAGAAGGCTGAGGG - Intergenic
1059985067 9:119813556-119813578 ATTGAGACCTGGAAAGGGGATGG - Intergenic
1059986773 9:119828013-119828035 TGGGACACCTAGGAAGGGGATGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1060376606 9:123120210-123120232 TAGGAGTCTTGGAAAGGAGATGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061268728 9:129524131-129524153 ATGGAGACTTAGAGATGAGAAGG - Intergenic
1061320942 9:129829034-129829056 ACTGAGGCTTAGAAAGGGGAAGG + Intronic
1061553003 9:131348880-131348902 CTGGAGACTTACAGAGGGGTGGG + Intergenic
1061707189 9:132462169-132462191 TTGGAGTCGCAGAAAGGGAATGG + Intronic
1203486860 Un_GL000224v1:64171-64193 TTAGGGATTTTGAAAGGGGAAGG + Intergenic
1203499480 Un_KI270741v1:6071-6093 TTAGGGATTTTGAAAGGGGAAGG + Intergenic
1185679110 X:1873746-1873768 AAGGAGACTGAGAAAGGAGAGGG - Intergenic
1185679114 X:1873782-1873804 AAGGAGACTGAGAAAGGAGAGGG - Intergenic
1185769787 X:2757073-2757095 TTGGGGAGTTGGAAAGGGGATGG + Intronic
1185796716 X:2971851-2971873 ATGGGGAGTTGGAAAGGGGACGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186116142 X:6306869-6306891 TTGGATACATATAGAGGGGAAGG + Intergenic
1186568727 X:10692201-10692223 TTAGGGATTTTGAAAGGGGAGGG - Intronic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1188000561 X:24976755-24976777 TTGAAGACTGGGAAATGGGAAGG - Intronic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188113147 X:26215635-26215657 TTTGAGACTTAGACAGTAGAGGG + Intergenic
1188142240 X:26565766-26565788 TTGGAGGTAGAGAAAGGGGAGGG + Intergenic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188186083 X:27116126-27116148 TTGGGGATTTCAAAAGGGGAGGG - Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189434985 X:40984532-40984554 TTGGAGACTTGGAAGAGGGAGGG + Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1191179457 X:57544737-57544759 TTGGAAAGTTAGAAAGGGAGGGG + Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192842468 X:74871292-74871314 TTAGGGATTTTGAAAGGGGAGGG + Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194182962 X:90736190-90736212 TTAGAGATTTAGAAAAAGGATGG - Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1196071188 X:111524176-111524198 TTGGGCACTTATAAAGTGGAAGG + Intergenic
1196395906 X:115261479-115261501 ATGGGGAGTTAAAAAGGGGATGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198489218 X:137122174-137122196 ATGGAGATTTGGAAAGGTGAGGG + Intergenic
1198539291 X:137619678-137619700 CTAGAGACATAGAAAGTGGATGG - Intergenic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199339711 X:146662342-146662364 TTAGCGACTTTCAAAGGGGAGGG - Intergenic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200529582 Y:4318147-4318169 TTAGAGATTTAGAAAAAGGATGG - Intergenic
1201300732 Y:12502559-12502581 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201481110 Y:14440572-14440594 TTGGATACATATAGAGGGGAAGG - Intergenic
1201695339 Y:16818278-16818300 ATGGGGACTTAGAAGGCGGATGG + Intergenic