ID: 977509848

View in Genome Browser
Species Human (GRCh38)
Location 4:97949527-97949549
Sequence GTTCTATTCTGGTGCATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977509844_977509848 3 Left 977509844 4:97949501-97949523 CCGTGTGAGTTTTATGCTTGCAA 0: 1
1: 17
2: 39
3: 92
4: 316
Right 977509848 4:97949527-97949549 GTTCTATTCTGGTGCATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977509848 Original CRISPR GTTCTATTCTGGTGCATAAT GGG Intronic
No off target data available for this crispr