ID: 977511865

View in Genome Browser
Species Human (GRCh38)
Location 4:97972145-97972167
Sequence TTTCCTTAACATATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977511862_977511865 17 Left 977511862 4:97972105-97972127 CCATTTCTCTATTATGTAATATG 0: 1
1: 0
2: 1
3: 65
4: 556
Right 977511865 4:97972145-97972167 TTTCCTTAACATATGGAACATGG 0: 1
1: 0
2: 1
3: 31
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977511865 Original CRISPR TTTCCTTAACATATGGAACA TGG Intronic
904958287 1:34307127-34307149 TTTCCTTGACATATAGGAGAAGG + Intergenic
908057096 1:60299384-60299406 TTCCCTTTACATTTGGAAAAAGG - Intergenic
908533825 1:65058909-65058931 TTTCCTGAACATCTAGAAGAGGG - Intergenic
909011764 1:70342698-70342720 TTTCTTTACCATTTGGAGCATGG - Intronic
909232089 1:73104303-73104325 TCTCCTTAAGAAATGGAACAAGG + Intergenic
909312532 1:74171210-74171232 TTTTCCTAAGATATGGAACAAGG - Intronic
909789411 1:79655561-79655583 TTTCTTTACTATATGAAACATGG - Intergenic
910037538 1:82805940-82805962 TTTGCTGGCCATATGGAACAAGG - Intergenic
910507371 1:87965269-87965291 TTTGTTTAACATATGAAACTTGG - Intergenic
912389851 1:109295414-109295436 TTCCCACAACATAAGGAACAGGG - Intronic
915407478 1:155672043-155672065 TTTCTTTAAAATACTGAACACGG + Intronic
915420128 1:155774181-155774203 TTTCTTTAAAATACTGAACATGG + Intronic
917950603 1:180029162-180029184 TTGCTTTAAGATATGGAATATGG + Intronic
919148781 1:193668571-193668593 ATTCCATAAAATATGGAACCAGG + Intergenic
920294071 1:204945288-204945310 GTTCCTTGACACAAGGAACAGGG - Intronic
920332914 1:205224194-205224216 TTACTTAAACATATGGAATATGG + Intergenic
921358671 1:214309978-214310000 ATTTCTTAAAATGTGGAACAGGG - Intronic
921655380 1:217729307-217729329 TGTCCTTGAAATAGGGAACAGGG - Intronic
921754139 1:218833794-218833816 TTTCCTTCACTTGGGGAACATGG - Intergenic
921990258 1:221358566-221358588 TTCCCCTAAAATAGGGAACAAGG - Intergenic
923134488 1:231105984-231106006 TTCTCTTAACATTTGGAATAAGG + Intergenic
1063477177 10:6339525-6339547 CTTCCTCAACATATTAAACATGG + Intergenic
1064798998 10:19047260-19047282 ATTCATTGAAATATGGAACATGG + Intergenic
1065489245 10:26266040-26266062 TTTTCTTAACATATGGACCCAGG + Intronic
1066142581 10:32521769-32521791 TTTCTCTAAGATCTGGAACATGG - Intronic
1068146807 10:53082419-53082441 TTCCCTTAAGAACTGGAACAGGG - Intergenic
1070311663 10:75277804-75277826 TTCCCTTAAGATATGGAATCAGG - Intergenic
1070705704 10:78636457-78636479 GTTCCATAACCTATGAAACATGG - Intergenic
1071665357 10:87550602-87550624 TTTCCTGAACATTTAGAAAAAGG + Intronic
1072138675 10:92571466-92571488 TTTCCTAAGCCTATGGAACAGGG + Intronic
1072149229 10:92672170-92672192 TTGCCTTAATAAATGGAACCTGG + Intergenic
1072306192 10:94109657-94109679 CTTCCTTAATAAATGGAAAATGG + Intronic
1074343299 10:112655665-112655687 TTTACTTAAATTATGAAACAAGG - Intronic
1074606092 10:114969129-114969151 TTTTTTTTAAATATGGAACACGG + Intronic
1075311216 10:121415259-121415281 TTTCCTTGACAGCTGTAACAAGG - Intergenic
1075431095 10:122381744-122381766 TTTCCTGAACAACTGGAAGAAGG + Intronic
1075461171 10:122617463-122617485 GTTCCTGAACACTTGGAACAGGG - Intronic
1075938431 10:126365043-126365065 ATCCCTTAACATATGGCAAAGGG - Intronic
1078960955 11:16269988-16270010 TTCCCTTAAGATCAGGAACAAGG - Intronic
1079471245 11:20779999-20780021 TTTTTTTAACATCTGGATCATGG + Intronic
1079923349 11:26459528-26459550 TCTCCTTAACATCTAGAATAGGG - Intronic
1080216488 11:29847861-29847883 GTTCCTTAACATCAGGAACAAGG + Intergenic
1081239703 11:40689833-40689855 TCTCCTTACCATATTTAACAAGG + Intronic
1081463472 11:43294179-43294201 TTTCCATAAGAACTGGAACAAGG + Intergenic
1086398143 11:86438047-86438069 TCTCCCTAAGATCTGGAACAAGG - Intergenic
1087080251 11:94163293-94163315 TTCCTCTAAGATATGGAACAAGG - Intronic
1087290211 11:96313121-96313143 TTTCCTTCACATGTGCAAGAGGG - Intronic
1087333052 11:96807398-96807420 TTCCCTTAAGATCAGGAACAAGG - Intergenic
1089914289 11:122137581-122137603 TTTCTTTAACAAATGGAGGAGGG - Intergenic
1090873345 11:130767265-130767287 TTACCTTAACAAATAGAACTGGG - Intergenic
1091192123 11:133704857-133704879 TTTTCTTCATCTATGGAACAGGG - Intergenic
1091299904 11:134501165-134501187 TTTCCTAAGCAGATGGAAGAGGG + Intergenic
1091859088 12:3762709-3762731 TTTCCTTAAAATTTTAAACATGG - Intronic
1093320919 12:17713827-17713849 TTCCTTTAAGATATGGAACTAGG - Intergenic
1094082795 12:26555876-26555898 TTTCATTAACATAGGGAGAAAGG - Intronic
1094161527 12:27395962-27395984 TTCTCTTAATATATGGAAAATGG + Intronic
1095217178 12:39563422-39563444 TTTCTGTAAGATACGGAACAAGG + Intronic
1095363656 12:41374875-41374897 TTCCCCTAACAAATAGAACAAGG + Intronic
1097407562 12:59209758-59209780 TTCCGTTAACATTGGGAACAAGG + Intergenic
1098594238 12:72253446-72253468 TTTCTCTAAGATAGGGAACAAGG - Intronic
1100008414 12:89922573-89922595 TGTCCTGGAAATATGGAACAAGG + Intergenic
1101745171 12:107535351-107535373 TTGCCCTAAGAAATGGAACAAGG + Intronic
1103062911 12:117873366-117873388 TTATCTTATGATATGGAACATGG - Intronic
1104248186 12:127062819-127062841 TTCCCATAACATATGGAAGTAGG + Intergenic
1105849264 13:24319873-24319895 GTTCCCTCACATATGGAACTAGG - Intronic
1105999318 13:25705089-25705111 TTTCTTGAACATATTGAAAATGG - Intronic
1107339135 13:39387586-39387608 TTTCCTTCACCTATTAAACAGGG - Intronic
1108684334 13:52805628-52805650 ATTTCCTAACCTATGGAACAGGG + Intergenic
1109263593 13:60171251-60171273 TTTCTTTAACCTATTTAACAAGG + Intergenic
1109560686 13:64045743-64045765 TCTCCCTAAGATCTGGAACATGG + Intergenic
1110188154 13:72699300-72699322 TTCCCTGAACATATGGAATGTGG + Intergenic
1110235255 13:73211245-73211267 TTTTCTTTACAAATGGAAGATGG + Intergenic
1111029549 13:82577216-82577238 CTTCCTTGATAAATGGAACAAGG - Intergenic
1112709981 13:102116299-102116321 GTTCCTCAAAATATGAAACATGG + Intronic
1113320377 13:109227096-109227118 TCTACTTAACATCTGGAAGAAGG - Intergenic
1113439784 13:110319250-110319272 TTTCCTAAACTTAAGGAAAATGG - Intronic
1114822744 14:26041203-26041225 ATTCCTAAAAATATGGAAAATGG + Intergenic
1115447473 14:33508139-33508161 TTGCCATAACATAGGAAACATGG - Intronic
1115835016 14:37392592-37392614 TTTCCTCAAGATAGAGAACAAGG - Intronic
1115880146 14:37906859-37906881 TATCCATTACAAATGGAACAGGG + Intronic
1116680087 14:47957250-47957272 TTTCTTTAATATATAGAAAAGGG + Intergenic
1119123704 14:72103797-72103819 TTTCTTTAATCAATGGAACATGG - Intronic
1120679449 14:87462876-87462898 TTTCCTTAATATATTTAAGATGG - Intergenic
1121684486 14:95824401-95824423 TTTCCCTAAGATCAGGAACAAGG + Intergenic
1121857662 14:97284706-97284728 TGTCCTTAACAACTGGCACAAGG + Intergenic
1125532245 15:40421246-40421268 TTTGCTTCACATATAGAACCAGG - Intronic
1125656110 15:41358874-41358896 TTTCCTTTACATAAGGGACGAGG - Intronic
1125978314 15:43976100-43976122 TTTTTTTAATATATGGAACAAGG - Intronic
1127160219 15:56174898-56174920 TTTCCTTAAGATCCGGAACAAGG + Intronic
1128195811 15:65754848-65754870 GTTCCTTAAAAGATTGAACATGG + Intronic
1128864361 15:71102930-71102952 TTCCCTTACTTTATGGAACATGG + Intronic
1128955985 15:71945798-71945820 TTTCCCTAACATTAAGAACAAGG - Intronic
1129546627 15:76402727-76402749 TCTCAATTACATATGGAACATGG - Intronic
1130336988 15:82964894-82964916 TTTCCCAAACCTATGGAGCACGG - Intronic
1132242792 15:100272763-100272785 TTTCTTTAAAATCTGGAACAAGG - Intronic
1135157798 16:20068680-20068702 TTTCCCTAAGATCTAGAACAAGG - Intronic
1140614671 16:76647848-76647870 TTTCCTTAAGATCAGTAACAAGG - Intergenic
1141617523 16:85218618-85218640 TTTCCAAATCATATGGAAAATGG + Intergenic
1142360652 16:89624973-89624995 TTTCCTTTCCATCTGGGACATGG + Intronic
1144114508 17:12074162-12074184 TTTTTTTAATATATGGAACGTGG + Intronic
1145875012 17:28311620-28311642 TTTCATTTACATAGGCAACATGG - Intergenic
1147273023 17:39290444-39290466 ATTCCCTAACATCAGGAACAAGG - Intronic
1147955336 17:44130513-44130535 GTTCCCTAACACAAGGAACAGGG + Intergenic
1149194987 17:54108835-54108857 TTCCCTTAACATGCAGAACAAGG - Intergenic
1153031249 18:714334-714356 TCTCCTTAAGATTTGGAACAAGG + Intergenic
1155575128 18:27236911-27236933 TTTCCTAATAATATGGATCAAGG + Intergenic
1155834593 18:30565104-30565126 CTTCCTAAACATATGAAAGATGG + Intergenic
1156854240 18:41763771-41763793 TTTCCTTAGCAGATGAAACAAGG + Intergenic
1158160347 18:54475392-54475414 TGTCCCTAACATTTGGAACAAGG + Intergenic
1158637119 18:59169622-59169644 ATTCCTTAAGATCTAGAACAAGG + Intergenic
1159363876 18:67440610-67440632 GTTCCTTAATATATGAAAGATGG - Intergenic
1159585013 18:70275593-70275615 TCTCTTTAACATAAGGAACTAGG + Intergenic
1160440606 18:78888111-78888133 TTTCCTTGAGAACTGGAACAAGG + Intergenic
1162214924 19:9126186-9126208 TTTCCTTGTTTTATGGAACAGGG - Exonic
1162229239 19:9251840-9251862 TTTGCTTATTTTATGGAACAGGG + Exonic
1162556173 19:11387192-11387214 TATCCCTAGCATATAGAACAGGG + Intronic
925106004 2:1292416-1292438 TTTCTTTAAGATCAGGAACAAGG - Intronic
925564981 2:5241634-5241656 TTTCCTTCAAAAATGGAAAAGGG - Intergenic
925871419 2:8274758-8274780 TTTCCTTTGCATTTGGAACATGG + Intergenic
927629627 2:24761516-24761538 TTTCTTAAACAAATGGAATATGG + Intronic
928047274 2:27948810-27948832 TTCCCCTAAAATCTGGAACAAGG - Intronic
928854882 2:35791152-35791174 TTTCCTGAAGATATAGCACAAGG - Intergenic
929650075 2:43670231-43670253 TTTCCTTGATATCTGAAACATGG - Intronic
929665716 2:43832199-43832221 TGTCCTTAACACCTAGAACAGGG - Intronic
932014828 2:68014677-68014699 TTTTCTTAACAAATAAAACAAGG + Intergenic
932980855 2:76664218-76664240 TTTCTTGAACATAGTGAACAGGG - Intergenic
933518928 2:83345885-83345907 TTCCCCTAAAATTTGGAACAAGG - Intergenic
933630216 2:84647258-84647280 TTTCCATAACATAAGGTACAAGG + Intronic
935155679 2:100481847-100481869 TTTCCCAAACATATGGACCATGG + Intronic
937920721 2:127127901-127127923 TCTCCTTAACATTGGGAACCAGG - Intergenic
938418712 2:131125992-131126014 TTTCATTAACAGATTGAAGAAGG + Intronic
939534755 2:143414079-143414101 TTTCCTAAATATATGCAATAAGG - Intronic
941862382 2:170297070-170297092 TCTCCTTCACATATTGAATAAGG + Intronic
941941485 2:171043242-171043264 TTTCTTTAATATATGAAAGATGG - Intronic
942709354 2:178815275-178815297 TTTCCTTAAAATATGATTCAGGG - Intronic
943647692 2:190425401-190425423 TTTCTCTAAGATAGGGAACAAGG - Intronic
943966404 2:194339543-194339565 TTTCCTTAATATTTGTCACATGG + Intergenic
944039314 2:195336301-195336323 TTCCCTTAACATAAGGGGCATGG + Intergenic
945379241 2:209119841-209119863 TTTCCCTATCATTGGGAACATGG + Intergenic
945964631 2:216173290-216173312 TTTCCTTAAGATCAGGAACAGGG - Intronic
946957787 2:224950847-224950869 GTTCCTTTACATATGGTAGATGG + Intronic
947121079 2:226815784-226815806 GTTCCTCAACAAATGGAAGATGG + Intergenic
947848463 2:233264528-233264550 TTTCCTTAATATGTGGAAAGGGG + Intronic
948344763 2:237286396-237286418 TTTCCTAAAAAAATGAAACATGG - Intergenic
1169989368 20:11483927-11483949 TTTCCTTAACATTAGGAAAGTGG + Intergenic
1170530418 20:17285786-17285808 TGTCCTTAAAATCTGGAGCAAGG - Intronic
1170972815 20:21132191-21132213 TTTGATTAATATATGGAACCTGG - Intronic
1171475680 20:25406978-25407000 TTTCTTAAGCATATGGAAGATGG - Intergenic
1172780501 20:37434077-37434099 TTCCCTTAAGATCAGGAACAAGG + Intergenic
1172797603 20:37552370-37552392 TTCCCCTAAGATCTGGAACAAGG - Intergenic
1176273800 20:64251992-64252014 TCTCCTTAAGATCAGGAACAAGG - Intergenic
1176999470 21:15594178-15594200 TTTCTCTAAGATCTGGAACATGG + Intergenic
1177161019 21:17548284-17548306 TTTCCTTAACATAAACATCAAGG - Intronic
1177464195 21:21453669-21453691 TTTACTAAACATATGGCAGAAGG - Intronic
1177473520 21:21589325-21589347 TTCCCTTAAAATAAGGAATAAGG + Intergenic
1177753130 21:25310706-25310728 TTTCTTTAAGATTGGGAACAAGG + Intergenic
1177780493 21:25617628-25617650 TTTCCTCAAAATGTTGAACATGG + Intergenic
1179070897 21:38069748-38069770 TTTCCTTAACTTTTGGTACTTGG + Intronic
1179335101 21:40444009-40444031 TTTCCTTAAGACAAGGAATAAGG + Intronic
1182463408 22:30498625-30498647 TTTCTTTAAGATCAGGAACAAGG - Intronic
1183852463 22:40602249-40602271 TTTCCTTAGCATCTAGCACATGG - Intronic
950879027 3:16306612-16306634 TTTCTTTAACAAATGAATCATGG - Intronic
951196897 3:19834728-19834750 TTTCATCAGCACATGGAACATGG - Intergenic
952094037 3:29926745-29926767 TTGCCTTATCATTTGGAAGAAGG + Intronic
952252830 3:31671329-31671351 TTTCCTTAAGAAAATGAACAGGG + Intronic
952345764 3:32483426-32483448 TTTCCTTAACATATATTACCAGG - Exonic
953542881 3:43837897-43837919 TTTCCTTTAAATGTGGAAGAGGG - Intergenic
955616122 3:60808628-60808650 TTTCCTTTACAGCTGGAAAAGGG + Intronic
955966777 3:64397000-64397022 TTTTCTTGACCCATGGAACATGG - Intronic
957798807 3:85048029-85048051 TTTCCCGAAAATATAGAACATGG - Intronic
958474367 3:94562417-94562439 ATTCCCTAATATGTGGAACAAGG - Intergenic
958598627 3:96263894-96263916 TTTCCCTAAGATCTGGAACAAGG + Intergenic
958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG + Intergenic
958872686 3:99579662-99579684 ATTCCATAACATATGGCATAAGG + Intergenic
959458603 3:106594883-106594905 TTTACCTAAGATCTGGAACAAGG - Intergenic
960126395 3:114003312-114003334 TTTCTCTAAAATATGGCACAAGG - Intronic
960562035 3:119095044-119095066 TTTCCTGAACTTTTGGAATAGGG - Intronic
960904311 3:122584457-122584479 TTTCATTAACGTCAGGAACAAGG - Intronic
963824852 3:149941942-149941964 TCTCCTTAACAAATGGTACTGGG - Intronic
965397487 3:168176629-168176651 TTTCCCTAAGATCAGGAACAAGG - Intergenic
966607557 3:181836561-181836583 TTTCTGAAACATATGGAAGATGG + Intergenic
968353839 3:198084603-198084625 TTTCCCTAACATCTAGAACAAGG + Intergenic
968513831 4:1007614-1007636 CATCTTGAACATATGGAACATGG + Intergenic
968513838 4:1007688-1007710 CATCTTGAACATATGGAACATGG + Intergenic
968513845 4:1007762-1007784 CATCTTGAACATATGGAACATGG + Intergenic
968513852 4:1007836-1007858 CATCTTGAACATATGGAACATGG + Intergenic
968740454 4:2327450-2327472 TTCCTGTAAGATATGGAACAAGG - Intronic
970620529 4:17812758-17812780 TTTGCTATACATATGGACCAAGG + Intronic
971872317 4:32258597-32258619 TTTAATTCACATTTGGAACATGG + Intergenic
972005119 4:34092444-34092466 TCTCCTTAACTTCAGGAACATGG + Intergenic
972103469 4:35451485-35451507 TTCCCTTAAGATTAGGAACAAGG + Intergenic
972119660 4:35684226-35684248 TTTCTTTGACAAATGGAATATGG + Intergenic
972212093 4:36850611-36850633 TTTCCTAAACTTATAGAGCAAGG - Intergenic
972529929 4:39952365-39952387 TTTCCTTTACATATGTAAGAAGG + Intronic
972649525 4:41003372-41003394 ATTCCTTAATAGATGCAACATGG - Intronic
972781319 4:42289110-42289132 TTCCCTTGACATAAGGAGCATGG + Intergenic
973842972 4:54881162-54881184 TTTCCTAAGCATCTAGAACAAGG + Intergenic
974520502 4:62975671-62975693 TTCCCTTGACATAAGGGACATGG - Intergenic
974969111 4:68803344-68803366 TTTCCTTGGCATATTGGACAGGG - Intergenic
975739007 4:77410223-77410245 TTGCCTGAACTTTTGGAACATGG - Intronic
977511865 4:97972145-97972167 TTTCCTTAACATATGGAACATGG + Intronic
978093643 4:104748255-104748277 TTTCTTTAAGATGTGCAACAAGG - Intergenic
978642598 4:110889297-110889319 TTACCTTAGAATCTGGAACATGG + Intergenic
978925810 4:114242191-114242213 TTTCCCTAAGAACTGGAACAAGG - Intergenic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
980428162 4:132654377-132654399 TTTCTTTAAGATCTGGAACAAGG - Intergenic
981308960 4:143277158-143277180 TTTTATTAACATATTAAACATGG - Intergenic
981516989 4:145620047-145620069 TTTTCTAAACATATGGATTAGGG - Intronic
981672671 4:147305121-147305143 TTTCCTAAACAGATGGAAATGGG - Intergenic
981910464 4:149974930-149974952 TTTCCCTAAGATCAGGAACATGG + Intergenic
983124636 4:163935465-163935487 TTTCCATAACATAAAGAGCAAGG - Intronic
983527655 4:168776568-168776590 TCTCCCTAATATAAGGAACAAGG - Intronic
983801120 4:171930532-171930554 TTTCTTTAAGATCAGGAACAAGG + Intronic
984596368 4:181673140-181673162 TTTCATGAACCTGTGGAACATGG - Intergenic
985428153 4:189850589-189850611 TTTACTGAACATGAGGAACAAGG + Intergenic
986165052 5:5265822-5265844 TTGCCTTGACATATGGAAGTTGG + Intronic
986622630 5:9691564-9691586 TTTCCTTACGATATGAAATAAGG - Intronic
987622213 5:20349118-20349140 ATTCCTTTAGTTATGGAACAAGG - Intronic
989225205 5:39019499-39019521 TGTGCTTTACAAATGGAACAAGG + Intronic
989424871 5:41284798-41284820 TTTAATTAAAATATGGAAAAAGG + Intergenic
990384613 5:55247742-55247764 TTTGCTTTACATTTGGAACAGGG - Intergenic
991267212 5:64734977-64734999 CTTCCATAACATAAGAAACAAGG - Intronic
991403681 5:66280089-66280111 CTTCCTTAAAATATGAATCAGGG + Intergenic
991527030 5:67571001-67571023 TTTCTCTAAGATCTGGAACAGGG - Intergenic
992311383 5:75503512-75503534 TTTCCTTTAAATATGTAACATGG + Intronic
993300892 5:86208749-86208771 TTTCTTTAAAATATGCAACTTGG + Intergenic
993802535 5:92360549-92360571 CTTCTTAAACATATGAAACATGG + Intergenic
993812655 5:92501674-92501696 TTCCCTTCACAAATGGAAAAAGG - Intergenic
994037887 5:95223539-95223561 TTTGCTTAACAAATGGCTCATGG + Intronic
994313499 5:98304699-98304721 TTTCCTGAACATATGTCCCAGGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996119960 5:119660281-119660303 TTGTCTTACCACATGGAACATGG + Intergenic
996310395 5:122097928-122097950 TTTCCTTCACATATACAAAAGGG - Intergenic
997752235 5:136357376-136357398 GTTCCTCAACCTATGGGACAAGG + Exonic
998204181 5:140147432-140147454 TTTCTTTAGCATCTGGAACCTGG + Intergenic
999486819 5:152004990-152005012 TTGCCTTAACATCACGAACATGG + Intergenic
999592325 5:153161703-153161725 ATTCCTTAAAATATCAAACATGG - Intergenic
1000404507 5:160873316-160873338 TCTCATTAACATCAGGAACAAGG + Intergenic
1000474238 5:161685771-161685793 TTTCCTTCTCACGTGGAACAAGG - Exonic
1001304867 5:170564586-170564608 TTTTCTTAAAATATAGATCACGG - Intronic
1003093601 6:3124908-3124930 TTTCCTTAACCTGATGAACAAGG + Intronic
1004236851 6:13882049-13882071 TTTCCTTGACATAAGGGGCATGG - Intergenic
1005040923 6:21599467-21599489 TTTAATTAACATTTGGAAGATGG - Intergenic
1005787320 6:29258060-29258082 TTTTCTAAACATTTGCAACATGG - Intergenic
1006181593 6:32156570-32156592 ATTCATTCACATATGGTACATGG - Intronic
1006326611 6:33358745-33358767 TTTCATTAAGATAGGGAACCAGG - Intergenic
1007571582 6:42895344-42895366 TTCCGTTAAAATATGGAAGATGG + Intergenic
1008142508 6:47847970-47847992 TTTCCTTAACATATATAAAATGG + Intergenic
1008246441 6:49179705-49179727 TTTTCCTCATATATGGAACATGG - Intergenic
1009588130 6:65632822-65632844 ATTTCTTCACCTATGGAACATGG - Intronic
1010386618 6:75287751-75287773 TTTCATTCACATCTGTAACAAGG + Intergenic
1010746370 6:79566637-79566659 TTTCCATAATATCTAGAACAGGG + Intergenic
1010808930 6:80275808-80275830 TTCACTTATAATATGGAACAAGG - Intronic
1012759727 6:103283332-103283354 TTTCCCTAAGATCAGGAACAAGG - Intergenic
1012782014 6:103572530-103572552 TTCCCCTAATATAGGGAACAAGG - Intergenic
1013144803 6:107378192-107378214 TCCCCCTAACATTTGGAACAAGG + Intronic
1013934122 6:115572449-115572471 TATCCTTAAGACAGGGAACAAGG - Intergenic
1015170856 6:130250986-130251008 TTTCCTCAAAAGATGAAACAGGG - Intronic
1015356526 6:132283353-132283375 TGTCTTTAACATATGAAATATGG - Intergenic
1017207748 6:151821948-151821970 TTTCTTTAACACATGTAACGGGG - Intronic
1017310033 6:152965740-152965762 TTCCCCTAACATCTGGAACAAGG + Intergenic
1018425640 6:163677936-163677958 TTTCCTCATGAGATGGAACATGG - Intergenic
1021445559 7:20730170-20730192 TTTCCTTATAAAATGGAATATGG + Intronic
1021998603 7:26202654-26202676 TGTCCTTTAAAAATGGAACATGG + Intronic
1022719326 7:32928688-32928710 CTTCCTAAACAAAGGGAACAAGG + Intergenic
1022756910 7:33303332-33303354 TTTCTCTAAGATCTGGAACATGG - Intronic
1022976543 7:35562939-35562961 TTTCCTTCACAGTTGGAAGATGG - Intergenic
1026367731 7:69666560-69666582 TTTCCTTATCATGGGGAACATGG - Intronic
1026394894 7:69941465-69941487 TCTGCTTAACATTTGGAACTGGG + Intronic
1028075726 7:86512621-86512643 TTTCTTTAATATTAGGAACAAGG - Intergenic
1029134836 7:98362588-98362610 TTCCCTTACCTGATGGAACAGGG + Intronic
1031100257 7:117471190-117471212 TTTCCTTAACAAAAGGTACTAGG - Intronic
1033268340 7:139907106-139907128 TTTCCTTAAGATGGGGAACAAGG - Intronic
1033534151 7:142296793-142296815 TTTCCTTACTTTATGGCACAAGG - Intergenic
1034025757 7:147701978-147702000 TTTCCTTAACTGAGGGAAAAAGG + Intronic
1034085640 7:148320049-148320071 TTTCCTTTTCATATGGAGAAGGG + Intronic
1034350244 7:150410598-150410620 TTTCATTCACATCTGGAAGAAGG - Intronic
1035919421 8:3661093-3661115 TTGCTTTAACAGATGGAACCCGG - Intronic
1036466917 8:9006683-9006705 TTTCCTTAACATTGTTAACAAGG + Intronic
1037797153 8:22005426-22005448 TTTTCATAACATTTTGAACAAGG + Exonic
1038297436 8:26307910-26307932 TTTCATTTACATATAGTACATGG - Intronic
1038898813 8:31818749-31818771 TTTTTATAACATGTGGAACACGG - Intronic
1041822019 8:62046902-62046924 TCTCCTTAAGATCAGGAACAAGG - Intergenic
1042919674 8:73909103-73909125 TTGCCTTAACATACTGGACATGG - Intergenic
1042953416 8:74224036-74224058 TTTCCTTACCAGAAGGAACCTGG - Intergenic
1043490002 8:80739833-80739855 TTCCCTTGACATAAGGGACATGG - Intronic
1044023158 8:87132185-87132207 TTTTTTTAACATATGAAGCAAGG - Intronic
1044317334 8:90765077-90765099 TATCCCTAAGATATGGAACCTGG - Intronic
1045929244 8:107603673-107603695 TTGCCTTGACATATTGGACATGG + Intergenic
1046360104 8:113141745-113141767 TTTCTATAACATCAGGAACAAGG + Intronic
1047371078 8:124256561-124256583 TTTCCTTGAGCTATGGAAAAAGG - Intergenic
1047855914 8:128912943-128912965 TTCCCCTAAGATAAGGAACATGG + Intergenic
1050947236 9:11541168-11541190 ATTACTTAAAATATAGAACAAGG - Intergenic
1051004628 9:12328749-12328771 TTTCATTAATATCTGGAACAAGG - Intergenic
1051126011 9:13806592-13806614 TTTCCTCAGCATATGGTACCAGG + Intergenic
1051616341 9:19010459-19010481 TTTCCTAGAAATATGGAACCTGG - Intronic
1051823668 9:21195156-21195178 TTTCCTTAACTTCTGTATCATGG - Intergenic
1052519173 9:29522340-29522362 TTACCTTTACATATGACACAAGG - Intergenic
1053836244 9:42138301-42138323 TTTTATTCACCTATGGAACATGG + Intergenic
1054126858 9:61321660-61321682 TTTTATTCACCTATGGAACATGG - Intergenic
1054594374 9:67050222-67050244 TTTTATTCACCTATGGAACATGG - Intergenic
1054840197 9:69730357-69730379 TTTCCATAAAATCAGGAACAAGG - Intronic
1055535680 9:77240829-77240851 TCTCCTTAACACATTGAAGAGGG + Intronic
1055918243 9:81430198-81430220 TTTCCTTGACATTTTGAAGAAGG - Intergenic
1056111474 9:83399901-83399923 TTCCCTTAAAACAGGGAACAAGG + Intronic
1056454879 9:86750773-86750795 TTGCATTAACGTATGGAAAATGG - Intergenic
1058283345 9:103145495-103145517 TTTCCTTTACAAATGGAGAATGG + Intergenic
1059037411 9:110770877-110770899 TTTTATTAAAATAAGGAACAAGG - Intronic
1061819126 9:133214829-133214851 TCTCCTTAACATCAGGGACAAGG + Intergenic
1186293409 X:8123395-8123417 TGACCTACACATATGGAACATGG - Intergenic
1188120012 X:26293024-26293046 TTTCTTTAAGATTAGGAACATGG + Intergenic
1188217158 X:27492781-27492803 TTTTCTTAACATATAAAACATGG - Intergenic
1188437704 X:30180919-30180941 TTTCTTAAATATATGGAATATGG - Intergenic
1190012457 X:46796934-46796956 TTTCTTTAAAAAATAGAACAAGG - Intergenic
1190024254 X:46908502-46908524 TCCCCTTAAGATAAGGAACAAGG + Intergenic
1192192184 X:68997824-68997846 TTTCCTTAACAACTAGATCAGGG - Intergenic
1193466840 X:81858962-81858984 TCTCTTTAACATAAAGAACAAGG - Intergenic
1193518085 X:82494879-82494901 CTTCCTTAACATATAAATCATGG + Intergenic
1194138752 X:90181058-90181080 TTTCCTTAACACAAGCAACAGGG + Intergenic
1194793918 X:98186300-98186322 TATCCTTAAAATGTGGTACAGGG - Intergenic
1195627140 X:107015795-107015817 TCTCCTGAAAATATAGAACAAGG + Intergenic
1195819913 X:108933271-108933293 TTTCTATAAGATTTGGAACATGG - Intergenic
1196527309 X:116741226-116741248 TTCCCTTAACATAAGGGACGTGG + Intergenic
1196916919 X:120546615-120546637 TATCCTTAACATATGTTTCAGGG - Exonic
1197019756 X:121672585-121672607 CTTTCTTATTATATGGAACATGG + Intergenic
1197060393 X:122172709-122172731 TTTCCTTATGATATAGAGCAAGG - Intergenic
1197317738 X:124988980-124989002 TTTCCCTAACATCAGAAACAAGG + Intergenic
1199181741 X:144864920-144864942 TTCCCATAAGATCTGGAACAAGG - Intergenic
1199479870 X:148286277-148286299 TTTTCTTAACATTTGAAACAAGG + Intergenic
1199708472 X:150451271-150451293 TTTCCTTGACATAAGGCCCAAGG + Intronic
1200484553 Y:3751293-3751315 TTTCCTTAACACAAGCAACAGGG + Intergenic
1200524277 Y:4252464-4252486 TTTTACTAACATCTGGAACATGG + Intergenic
1201688154 Y:16730776-16730798 TTTCCTTAAATTTAGGAACATGG - Intergenic