ID: 977512266

View in Genome Browser
Species Human (GRCh38)
Location 4:97976292-97976314
Sequence TGTTATTTATATATCTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 544}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977512266_977512267 8 Left 977512266 4:97976292-97976314 CCACTTAAGATATATAAATAACA 0: 1
1: 0
2: 1
3: 47
4: 544
Right 977512267 4:97976323-97976345 TGTCAAATCTATCTCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977512266 Original CRISPR TGTTATTTATATATCTTAAG TGG (reversed) Intronic
901281747 1:8042558-8042580 TTTTATTTTTATAGATTAAGGGG + Intergenic
901695970 1:11008452-11008474 TTTTATTTAAATATCTTTATTGG + Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
903987116 1:27236181-27236203 TGTGATTCTTATATCTTTAGCGG + Intronic
905558457 1:38906762-38906784 TTTTATTTATATCTCCTAAATGG - Intronic
907234789 1:53036236-53036258 TTTTATATATATATCTTAAATGG - Intronic
907234806 1:53036569-53036591 TTATATATATATATCTTAAGTGG + Intronic
907913545 1:58848140-58848162 AGTTATTGATAAATTTTAAGAGG - Intergenic
908068025 1:60428626-60428648 TGTTAATTATAGAATTTAAGTGG - Intergenic
908869533 1:68592969-68592991 TGTTAGCAATATATATTAAGTGG - Intergenic
909143444 1:71896494-71896516 TGTTATTTCACTTTCTTAAGTGG + Intronic
909510799 1:76449693-76449715 TGTTATCTGTGTATCTTAATTGG + Intronic
910952110 1:92660211-92660233 TGTTATTTTTATACATTTAGGGG - Intronic
911412116 1:97522773-97522795 TTTTATTTATATCTCTACAGAGG - Intronic
911461058 1:98191756-98191778 TGATATATATATATATAAAGGGG - Intergenic
912051178 1:105529467-105529489 TGATTTTTACATTTCTTAAGGGG - Intergenic
912080055 1:105925150-105925172 TGTTATATATATATATGAATGGG + Intergenic
912928242 1:113931806-113931828 TGTTAGTTATATATTGTAACTGG + Intronic
913514547 1:119592523-119592545 TATAATTTATATATCTTATTTGG - Intergenic
913700261 1:121367682-121367704 TGGTATTTCTATATCCTAGGGGG + Intronic
914040810 1:144048137-144048159 TGGTATTTCTATATCCTAGGGGG + Intergenic
914137280 1:144912340-144912362 TGGTATTTCTATATCCTAGGGGG - Intronic
914396808 1:147277547-147277569 TGTTCTTTGTTTATCTTAGGGGG + Intronic
915879157 1:159647402-159647424 TTTTCTTTATCTATCTAAAGAGG + Intergenic
916015090 1:160742638-160742660 TGTTATTTATTTCTCGTATGAGG + Intronic
916685196 1:167137934-167137956 TGTTATTAATATATTTTAACTGG + Intergenic
916833387 1:168515870-168515892 TGTTATTTGTATATATTCATGGG + Intergenic
916919121 1:169443732-169443754 TACTATTTATATACCTTAAATGG - Intronic
917043168 1:170828924-170828946 TTTTCTTCAGATATCTTAAGTGG - Intergenic
917361375 1:174180149-174180171 TGTTGTTTATAGATCTGAATTGG - Intronic
917661510 1:177181579-177181601 AGTTATTTCTATGTCTCAAGGGG - Intronic
918555337 1:185792660-185792682 TGTCATTTCTATATCTTAGTAGG - Intronic
918678852 1:187325892-187325914 TGTTATTTTTATATATTTAGGGG - Intergenic
919345598 1:196373091-196373113 TGTTTTTTATATAATTTAAAAGG + Intronic
919416075 1:197311804-197311826 TATTATTTATATCTTTTAATGGG + Intronic
919461948 1:197888032-197888054 AGTAATTTTTATATTTTAAGAGG + Intergenic
919485226 1:198137827-198137849 AGTGATATATATATCATAAGTGG - Intergenic
919541234 1:198847686-198847708 TATTATTTACATCTGTTAAGTGG + Intergenic
920487675 1:206386405-206386427 TGGTATTTCTATATCCTAGGGGG + Intronic
920899314 1:210091098-210091120 TGATATTTAAAGATGTTAAGTGG - Intronic
921374163 1:214456307-214456329 TGTAATTCATATATTTTATGTGG - Intronic
921734429 1:218610906-218610928 TGTTTTTAATATATTTTTAGTGG + Intergenic
922114572 1:222600077-222600099 AATTATTTATATAACATAAGTGG + Intergenic
922427459 1:225512478-225512500 TGTTATTTATAAATTTTTAATGG - Intronic
923030045 1:230242172-230242194 TGTTATTTTCTTATTTTAAGGGG + Intronic
923123643 1:231017013-231017035 GGTTATTTACATGTTTTAAGTGG + Intergenic
923166548 1:231369349-231369371 TGTTATTTATTCATCTAAAAAGG + Intronic
923651083 1:235874696-235874718 TGTTATTTCTGTATCATAAAAGG - Intronic
923795137 1:237146464-237146486 TGTTATCTACATATTTGAAGTGG - Intronic
923937068 1:238774331-238774353 TGGAATTTTTATATATTAAGAGG + Intergenic
1062870316 10:896585-896607 TGTTATTTATATTACCTAATGGG + Intronic
1063288518 10:4715987-4716009 TATTATTTACATAGCTTTAGGGG + Intergenic
1063752613 10:8968290-8968312 TGTTAGTTATATATTTTTAAAGG - Intergenic
1063852009 10:10202611-10202633 TGATAATTGTATATCTTTAGGGG + Intergenic
1064681542 10:17815406-17815428 TTTTGTTTATTTATCTTAAGGGG + Intronic
1064719600 10:18215569-18215591 TTTCATTTTTATTTCTTAAGAGG - Intronic
1065311275 10:24417873-24417895 GGTTATTAACATAACTTAAGTGG + Intronic
1067486981 10:46659794-46659816 TGTTATTTAAATATTTTAACAGG - Intergenic
1067491313 10:46706605-46706627 TGTTAGGTATAAATCTAAAGTGG + Intergenic
1067603351 10:47633773-47633795 TGTTAGGTATAAATCTAAAGTGG - Intergenic
1067607823 10:47682179-47682201 TGTTATTTAAATATTTTAACAGG + Intergenic
1067841817 10:49687140-49687162 TGTTTTTTATGTATCTGCAGAGG + Intronic
1068100897 10:52551692-52551714 TGTTATTTGTATAGATTTAGGGG + Intergenic
1069086331 10:64143903-64143925 TTCTATTTATATTTTTTAAGTGG - Intergenic
1069433673 10:68360271-68360293 TTTTATTTATATATTTTATATGG - Intronic
1071410711 10:85391020-85391042 TGTTATTTAAATATTTTTAGAGG + Intergenic
1071623379 10:87143578-87143600 TGTTATTTAAATATTTTAACAGG + Intronic
1071726854 10:88207385-88207407 TGCTATTCATATATCTTGATTGG - Intergenic
1072596685 10:96879110-96879132 TGTTATATACACATCTTAAATGG - Intronic
1073320230 10:102611742-102611764 TGTTATTTATTCTTGTTAAGAGG + Intronic
1073579282 10:104649454-104649476 TGTTATTTTTATATCTGGAAGGG + Intronic
1074008351 10:109451676-109451698 TTTTATTTATATTTCTTATTAGG - Intergenic
1074136654 10:110633294-110633316 TTTTATTTATTTATTTTGAGGGG - Intergenic
1074642420 10:115401977-115401999 TTTTGTTTTTATCTCTTAAGAGG + Intronic
1074694610 10:116038249-116038271 TTTTTTATATATATCTTATGGGG + Intergenic
1075151941 10:119941092-119941114 GGTCATTTATATTTGTTAAGAGG + Exonic
1076263287 10:129089300-129089322 TCTTTTATATATAACTTAAGGGG + Intergenic
1076274803 10:129189006-129189028 TTTTATTTTTATTTCTTCAGAGG - Intergenic
1077781883 11:5339173-5339195 TGGTACTTATTTATCTTAATAGG + Intronic
1077830189 11:5859749-5859771 TTTCATTTTTATATCCTAAGTGG - Intronic
1077954732 11:7003930-7003952 TTTAATTTATATATTTAAAGTGG - Intronic
1078027191 11:7708129-7708151 TGTTACTTTCATCTCTTAAGGGG + Intergenic
1078740973 11:14065958-14065980 TGTTGTTTATAGATGTGAAGAGG + Intronic
1078747756 11:14131681-14131703 TATTATTTCTATTTCTTAAAGGG + Intronic
1079046819 11:17112032-17112054 TATTATATATATATCAAAAGTGG + Intronic
1079748956 11:24170658-24170680 TGTTATTTATTATTCTAAAGTGG + Intergenic
1079765240 11:24384042-24384064 TATTATTTTTATATCATCAGTGG + Intergenic
1079821288 11:25133667-25133689 TTTTATTTATTTATTTTAATTGG + Intergenic
1080135821 11:28853384-28853406 TATTAATTTTATTTCTTAAGAGG - Intergenic
1080427636 11:32170838-32170860 TGTAATTTTTAACTCTTAAGAGG - Intergenic
1081242324 11:40721939-40721961 TTTTATTTATTTATTTTGAGAGG - Intronic
1082639707 11:55642989-55643011 TTTTACTTATATATTTTAATTGG - Intergenic
1085187761 11:74590900-74590922 TTTTATTTATTTATTTTGAGGGG + Intronic
1085473879 11:76776323-76776345 TGTTTTCTACATAACTTAAGAGG - Intergenic
1086011353 11:82107582-82107604 TGCTAATTTTAAATCTTAAGAGG - Intergenic
1086022840 11:82252615-82252637 TATTATTTATTTATTTTGAGAGG - Intergenic
1086387302 11:86322313-86322335 TGCTATTTATATATCTTCTCTGG + Intronic
1087572132 11:99942341-99942363 TATTATTTATATATATTATATGG - Intronic
1087855222 11:103084589-103084611 TGTTAATTTTATAACTTAAAAGG + Intronic
1088429302 11:109741300-109741322 TGTTTTTTAAATTTCCTAAGAGG + Intergenic
1088438578 11:109842847-109842869 TGTCATTTATATATCTTCTTTGG - Intergenic
1088936245 11:114403055-114403077 TGTTATGTATCTATTCTAAGGGG + Intronic
1089030724 11:115325536-115325558 TGTTGTTTAAAAATTTTAAGAGG - Intronic
1089265630 11:117258699-117258721 TGTATTTTATATATCTTGATGGG - Intronic
1090533604 11:127616543-127616565 AGTTATTTATATTTTTTAATGGG + Intergenic
1090543295 11:127732796-127732818 ATTAATTTATATATCTTAACAGG - Intergenic
1091089059 11:132752247-132752269 TTTTTTTTATTTATTTTAAGGGG - Intronic
1091906255 12:4191698-4191720 TGTTTTTTATTTACCTAAAGGGG + Intergenic
1092148953 12:6233850-6233872 TGTTATTTATAGATCAGAGGAGG - Intronic
1094647805 12:32343822-32343844 TGTTGACTATATATCTCAAGGGG - Intronic
1095350087 12:41199999-41200021 TGTTATTTTTATAGATTTAGGGG - Intronic
1095355648 12:41270687-41270709 TGATATTTTTATATCCTAACAGG + Intronic
1095454281 12:42365854-42365876 TGTTATTTATATTTCTTCAAAGG + Intronic
1095599351 12:43997562-43997584 TCTTATTTTTAGAACTTAAGGGG - Intronic
1097596572 12:61640335-61640357 TTTTATTTATTTATCTTACTTGG + Intergenic
1098279001 12:68844314-68844336 TGATATTTGTATTTCTAAAGTGG - Exonic
1099567105 12:84265387-84265409 TTTTATTTATTTTTCTTAAGTGG - Intergenic
1099646861 12:85368430-85368452 TATTATTTATATGTCATAAAAGG - Intergenic
1100285307 12:93160305-93160327 TGTTATTTCTATATATGAATAGG + Intergenic
1100360955 12:93878808-93878830 TGTTTTTTCTATCTCTTCAGTGG + Intronic
1100967798 12:100031819-100031841 TGGTATTTATATATTCTAAAAGG + Intronic
1102442837 12:112976771-112976793 TGCTATTTATACATTTTAGGAGG - Intergenic
1103425942 12:120833853-120833875 TTTAATTTATATAACTGAAGTGG + Intronic
1103771168 12:123326332-123326354 TGTTGATTATGTATCTTCAGTGG - Exonic
1105648224 13:22344375-22344397 TAATATGTATATATTTTAAGAGG + Intergenic
1106876008 13:34073831-34073853 TGTTTCATATATAACTTAAGAGG - Intergenic
1107542160 13:41399048-41399070 TGTTTTTTATTTTTCTTGAGAGG + Intergenic
1108909939 13:55535840-55535862 TTATATTTATATATCTTTTGTGG - Intergenic
1108927779 13:55774532-55774554 TTTTATATATATATGTAAAGGGG - Intergenic
1108948680 13:56059134-56059156 TATTATTTATATATATAAAGGGG + Intergenic
1108999386 13:56778756-56778778 TGGTATTTATATTTCCTGAGAGG + Intergenic
1109570049 13:64176340-64176362 TTTTATTGATATATCTGAATTGG - Intergenic
1109800730 13:67374807-67374829 GGTTATTTTAATATTTTAAGTGG + Intergenic
1109878673 13:68441017-68441039 TGTTATTGATATACATTAACAGG + Intergenic
1110316141 13:74109756-74109778 TGCTCTTTATATTTCTTAAGTGG - Intronic
1110417695 13:75270139-75270161 TTTTATTTATTTATTTTGAGAGG + Intergenic
1110674105 13:78219325-78219347 TCTCTTTTATATATCCTAAGTGG - Intergenic
1111240474 13:85466708-85466730 TATTATTTCTTTATCTTCAGTGG - Intergenic
1111298973 13:86321755-86321777 TTTTATTTATATATTTTTAAAGG + Intergenic
1111500319 13:89110541-89110563 TTTTATTTGTACATCTTAAATGG - Intergenic
1111633554 13:90874391-90874413 TGTCCTTTTTATATCTGAAGTGG - Intergenic
1112095358 13:96126735-96126757 TGTTGTTTATTTATCTTATTAGG + Intronic
1112935301 13:104790116-104790138 TTTTATTTATAAATTTCAAGTGG - Intergenic
1113357578 13:109597021-109597043 AGTTATTTATGTATCCTAACTGG + Intergenic
1113554531 13:111221638-111221660 TGTTATATATATATATAAAGGGG - Intronic
1115584470 14:34797130-34797152 TGTTATTAAATAATCTTAAGTGG - Intronic
1115871417 14:37807856-37807878 TGGTATTTATATAACTTGTGTGG + Intronic
1115959328 14:38817224-38817246 TCTTCTTAATATATCATAAGAGG - Intergenic
1116075021 14:40100621-40100643 TATTTTCTAAATATCTTAAGGGG - Intergenic
1116149560 14:41122424-41122446 AGTATTTTATATATCTTAATGGG - Intergenic
1116246305 14:42417680-42417702 TGTTAGTCACATATTTTAAGTGG + Intergenic
1117155620 14:52937296-52937318 TCTCATTTATAAATATTAAGTGG + Intronic
1117941446 14:60971098-60971120 TCTTATTTATACATGTAAAGTGG - Intergenic
1118078849 14:62334722-62334744 TGTTCATTAAATGTCTTAAGGGG + Intergenic
1119413220 14:74450844-74450866 TGTCATTTCTATATCTTAGTTGG - Intergenic
1120154415 14:81076761-81076783 TGATAATTTTATATCTTAACTGG + Intronic
1120330406 14:83085616-83085638 TATTATTTACAGATCTTGAGGGG - Intergenic
1120952613 14:90056170-90056192 TGTAGTTTATGTATTTTAAGTGG - Intergenic
1124546414 15:30631757-30631779 GGTTATTTATAAATAGTAAGTGG - Intronic
1124779940 15:32621153-32621175 GGTTATTTATAAATAGTAAGTGG - Intronic
1124834235 15:33180335-33180357 TGTTTCTTATATATATTAGGTGG + Intronic
1124876169 15:33596520-33596542 TTTTATTTATTTATTTTAAGTGG + Intronic
1125069966 15:35542903-35542925 TATTATATATATTCCTTAAGTGG - Intronic
1125251288 15:37707850-37707872 TGTTAATTACATTTCTTATGGGG + Intergenic
1125336316 15:38630033-38630055 GGTTAATGATATATTTTAAGAGG + Intergenic
1125545495 15:40500970-40500992 TGTCATTTATATATTTGAACGGG - Intergenic
1126259542 15:46672218-46672240 AGGTATTTATTTAGCTTAAGGGG - Intergenic
1126805433 15:52343879-52343901 TATTATTTTTATATTCTAAGTGG - Intronic
1127181458 15:56423552-56423574 ACTTATTTGTATATTTTAAGTGG - Intronic
1127232521 15:57012428-57012450 TTCTACTTATATATCTTAATAGG - Intronic
1128869755 15:71145372-71145394 TGATTTTTATAGATCTTATGAGG + Intronic
1129087871 15:73115472-73115494 TGTGTTTTATATTTCTTTAGAGG + Intronic
1129195870 15:73965865-73965887 TGGTTTTTCTATATCCTAAGAGG + Intergenic
1129864044 15:78889039-78889061 TATTATATAGAAATCTTAAGTGG + Intronic
1130781491 15:87044700-87044722 GATTATTTATTTATTTTAAGAGG - Intergenic
1130874609 15:88002480-88002502 TGTTAGTTAGATATATTAATTGG - Intronic
1130989056 15:88864744-88864766 TTTTATCTGTATTTCTTAAGAGG + Intronic
1131016948 15:89065771-89065793 TGTTATTTCTATATCATGGGGGG - Intergenic
1131534165 15:93220525-93220547 TCCTATTTCTATATCTTATGGGG + Intergenic
1131721669 15:95175444-95175466 TGTTAATCATATTTATTAAGAGG - Intergenic
1131767549 15:95695893-95695915 TGTTGTTTTTATATCCTAAGTGG + Intergenic
1132410098 15:101571086-101571108 TTTTATTAATCTATCTTAAATGG - Intergenic
1133523221 16:6579033-6579055 TGTTATTTTTATATTTTCATAGG - Intronic
1133707743 16:8371284-8371306 TTTTATTTATTTATTTTCAGAGG + Intergenic
1133712348 16:8413561-8413583 TTTTATTTATTTATTTTAAGTGG - Intergenic
1134211170 16:12278609-12278631 TGCTATTTATATTTCCTGAGAGG + Intronic
1135193312 16:20373173-20373195 TGCTATTTATATTTATTAAGTGG - Intronic
1137316540 16:47330268-47330290 TCTTTTTTATATATGGTAAGAGG - Intronic
1137911903 16:52385912-52385934 TGTTGTTTATTTGACTTAAGGGG + Intergenic
1138032870 16:53574633-53574655 TTTTATTTATTTATTTTGAGAGG + Intergenic
1138142871 16:54583508-54583530 GGTTAATTAAATATCTAAAGAGG + Intergenic
1138786479 16:59852423-59852445 TGTTAATTCTATATCCTCAGTGG + Intergenic
1139297369 16:65913770-65913792 GGTTATTTATATCTCTTATTTGG + Intergenic
1139412098 16:66771224-66771246 TAATATTTATTTATCTTAAGTGG - Intronic
1140336794 16:74114697-74114719 TGGAATATATATATATTAAGGGG - Intergenic
1140653140 16:77110291-77110313 TATTATTTTTATATATTATGGGG - Intergenic
1141815059 16:86404241-86404263 TATTATTTATTTATTTTGAGAGG + Intergenic
1142924436 17:3222116-3222138 ATTTATTTATTTATTTTAAGAGG - Intergenic
1143934050 17:10463641-10463663 TCTTATTCATTTCTCTTAAGGGG - Exonic
1144414147 17:15030451-15030473 GGTTATATATATATATAAAGTGG - Intergenic
1145054513 17:19691878-19691900 GGTTGTTTATTTATCTTAATAGG - Intronic
1145199242 17:20926425-20926447 TATCATTTATATATCTTCAGTGG - Intergenic
1146418767 17:32662877-32662899 TGTTCTTTATTTACCTTTAGTGG + Intronic
1148399027 17:47337465-47337487 TTTTATTTTTATATATTTAGAGG - Intronic
1149133991 17:53342759-53342781 TTTTATTGATATATCTGAAAAGG + Intergenic
1149416328 17:56463763-56463785 TGTTCTTTACATTTGTTAAGGGG + Intronic
1149484579 17:57032329-57032351 TGTTATTTAGTAATCTCAAGAGG + Intergenic
1149902705 17:60495305-60495327 TGGCATTTATATATCTTTTGTGG - Intronic
1150533335 17:66009331-66009353 TGTTATTTGTATATCTTCTTTGG + Intronic
1150553760 17:66234955-66234977 TGCTATTAATATATTTTAACAGG + Intronic
1150853544 17:68729012-68729034 TGTAATTTATATATATGACGAGG + Intergenic
1153077869 18:1186004-1186026 TGTTATTAATGTATTTTTAGGGG + Intergenic
1153497462 18:5714292-5714314 TGAAATTCATAGATCTTAAGTGG + Intergenic
1153715564 18:7844298-7844320 TAAGATTTATAGATCTTAAGGGG - Intronic
1155046988 18:22111398-22111420 TGATATGTAAATATCTTATGTGG + Intergenic
1156058654 18:33045151-33045173 TTTTATTTTTATATATTTAGGGG - Intronic
1156106511 18:33669256-33669278 TGTTATTAATATATTTAATGAGG - Intronic
1156663044 18:39371047-39371069 TGTTATTTTTCTTTCTAAAGAGG - Intergenic
1156874878 18:41997610-41997632 TATTATTATTATACCTTAAGAGG - Intronic
1157647423 18:49289819-49289841 ATTTATTTATATATTTTAAACGG + Intronic
1158702080 18:59757235-59757257 TGTAATTTGTATATATTTAGGGG + Intergenic
1158744241 18:60179630-60179652 TGTTATTTATAATTCTGAACTGG - Intergenic
1159518880 18:69494164-69494186 TCTTCTTTAAAAATCTTAAGTGG - Intronic
1159667401 18:71178774-71178796 TGTTATTTGTATATGTTTAGGGG + Intergenic
1162611487 19:11758117-11758139 TGTTTTTTATATATATTAATAGG + Intergenic
1162699858 19:12506234-12506256 TGTTCATTTTATTTCTTAAGGGG - Intronic
1163188270 19:15655804-15655826 TTTTAATTATATATGTTTAGAGG + Intronic
1163532307 19:17857469-17857491 TGCTTTTTAAATATGTTAAGAGG - Intergenic
1165291881 19:34892219-34892241 TGTTTTGTATATATGTTAAAGGG + Intergenic
1165690788 19:37861716-37861738 TGTGTTTTATATTTCTTAAGTGG - Intergenic
1166177265 19:41083159-41083181 TTTTATTTTTATTTTTTAAGAGG - Intergenic
1168046283 19:53796546-53796568 CGTAATTTTTATATCTTTAGTGG + Intronic
924964853 2:66486-66508 TGTTATTTAAAGCTCTTAAGGGG + Intergenic
925382921 2:3439223-3439245 TGTTATTGATAAATCTTTATTGG + Intronic
925486793 2:4343374-4343396 TGTTATTTTTATATATGGAGAGG + Intergenic
925753558 2:7111173-7111195 TGTCCTTTAGATATCTTGAGGGG + Intergenic
926486751 2:13471483-13471505 TAATATATATATATTTTAAGGGG - Intergenic
927722252 2:25391459-25391481 GGATATTTATATATCTTTGGAGG - Intronic
928323118 2:30299300-30299322 TGCCATTTCTATATCTTAATTGG + Intronic
928488888 2:31760249-31760271 ATTTATTTATTTATTTTAAGAGG - Intergenic
928720010 2:34109421-34109443 TGTCATTTGTATATCTTTTGTGG + Intergenic
928808411 2:35190898-35190920 TATTATATATTTATTTTAAGTGG - Intergenic
929077355 2:38089032-38089054 TGATAGTTAAATAACTTAAGTGG + Intronic
930413021 2:51050975-51050997 TGTTATTTTTATATGTTGAATGG - Intergenic
931171676 2:59809987-59810009 TGTTTTTTACATTTTTTAAGAGG + Intergenic
931514284 2:63035042-63035064 TGTTACTTATAAAGCTAAAGGGG + Intronic
931946540 2:67315117-67315139 TGTTATTTTATTAACTTAAGAGG + Intergenic
933083258 2:78021445-78021467 TGTTATTTTTATATTTTCATTGG + Intergenic
933192883 2:79356132-79356154 TTTTATATATCTATCTTAATGGG + Intronic
933212808 2:79590853-79590875 AGTTATTTTTATATGTTAAAAGG - Intronic
933433874 2:82219724-82219746 TGTTTTTTTTTTTTCTTAAGAGG + Intergenic
934533370 2:95111517-95111539 TTTTATATATATATAGTAAGAGG + Intronic
934957712 2:98637423-98637445 TGATATTCAGATATTTTAAGAGG - Intronic
935838752 2:107085102-107085124 TGTTATTTGTATAACTTAGTTGG - Intergenic
935997015 2:108785799-108785821 CATTATTTGTACATCTTAAGTGG + Exonic
936747625 2:115597783-115597805 TGATATTTCTAGATCTTATGAGG - Intronic
937205464 2:120233849-120233871 TATTATTATTTTATCTTAAGAGG + Intergenic
937964313 2:127490250-127490272 TTTTATTTATTTATTTTAAAAGG + Intronic
938681850 2:133700133-133700155 TGTTATGTATAAATTTTAAGGGG - Intergenic
938881314 2:135592755-135592777 TTTTATTTTTATTTTTTAAGAGG + Intronic
938916790 2:135949575-135949597 TCTTAATTATATATCTGAAATGG - Intronic
939332519 2:140783169-140783191 TTTTAATGATACATCTTAAGAGG - Intronic
939351693 2:141046117-141046139 TGTTGTTTTTATTTCTTAAGAGG + Intronic
940183480 2:150958948-150958970 GATTATTTATTTATTTTAAGAGG - Intergenic
940428574 2:153559297-153559319 TGACATTTATGTCTCTTAAGTGG + Intergenic
940894974 2:159072628-159072650 TTTTATTTATATATTTTTAAGGG - Intronic
941130531 2:161644129-161644151 AGTGAGTTAAATATCTTAAGTGG + Intronic
941218357 2:162741660-162741682 AGTTATTCATATTTCTTAAAAGG - Intronic
941454504 2:165699096-165699118 TTATATTTATTTATCTTCAGTGG + Intergenic
941479588 2:165989919-165989941 GGTTATTTTTACATTTTAAGTGG - Exonic
941507936 2:166370686-166370708 TCTTATTTATCTTTCTTTAGAGG + Intronic
941794381 2:169583826-169583848 TATTATTTAATTATTTTAAGGGG - Intergenic
941974520 2:171388310-171388332 TGTCATTTATTTATCTTCAGTGG + Intronic
942782099 2:179656006-179656028 TGTTTTTTATTTATGTTAATAGG + Intronic
944366942 2:198932116-198932138 TATTATATATATATTTAAAGAGG - Intergenic
944934029 2:204548714-204548736 TCTTAATTATATATTTTATGAGG + Intronic
945616532 2:212076007-212076029 TTTTACTTAAATATCTTAATAGG - Intronic
945648046 2:212525488-212525510 TGTTATTTATATATCTGTTAAGG - Intronic
945712685 2:213318622-213318644 TTTTATTTTTATAGATTAAGGGG - Intronic
946039558 2:216772077-216772099 TTTTATTTATTTTTCTAAAGTGG + Intergenic
947450818 2:230206971-230206993 AGGTATTTATATATCACAAGGGG + Intronic
947897024 2:233684607-233684629 GGTTATTTGTATATCTTCAGTGG + Intronic
1168870933 20:1127656-1127678 TGTTTTTTATGTATTTGAAGAGG + Intronic
1169232612 20:3901945-3901967 TGTGATTTATGTATCTTTATAGG + Intronic
1173195161 20:40908190-40908212 TCTTATTTAAATACCTTGAGGGG - Intergenic
1173592535 20:44236180-44236202 TGTTGTTTATTTTTCTTAATTGG - Intergenic
1173881548 20:46416799-46416821 TGTTATTTCTAGATATTTAGGGG - Intronic
1174239400 20:49121096-49121118 TGTTTTTTATTTATGTTAATAGG - Intronic
1174785874 20:53431988-53432010 TTTTATTTAAATAGCTTTAGGGG + Intronic
1177365459 21:20129518-20129540 TTGTATTTATATGTCTTAGGAGG + Intergenic
1177647733 21:23921035-23921057 TTGTATTTATATATATTTAGGGG - Intergenic
1177772916 21:25537062-25537084 TGTTTTTTAAGTAACTTAAGAGG + Intergenic
1177784749 21:25659421-25659443 AGTTATTTATTTATTTTAAAAGG - Intronic
1177867420 21:26528754-26528776 AATTATTTATATATTTAAAGAGG + Intronic
1178220724 21:30656083-30656105 TGTTATTTATATATTATTGGTGG - Intergenic
1178240244 21:30891337-30891359 TGTAATATATATAACTAAAGAGG - Intergenic
1178859928 21:36280183-36280205 AGTTTTTAATATATCTTAAGAGG + Intronic
1178946627 21:36953613-36953635 TGTTAATTATATGTCTTTATGGG - Intronic
1179060857 21:37977813-37977835 TGTTCTTTAAATAAATTAAGAGG - Intronic
1180653607 22:17399999-17400021 TTTTATTTATATATCATAGTTGG + Intronic
1180836673 22:18933160-18933182 TTTTATTTATTTATTTTTAGAGG + Intronic
1181404290 22:22671488-22671510 TGTGATTTATCTTTCTTAATAGG + Intergenic
1181412884 22:22737058-22737080 TGTGATTTATCTTTCTTAATAGG + Intronic
1182177056 22:28301648-28301670 TGTCACTTTTATATCTAAAGGGG + Intronic
1183214419 22:36469957-36469979 TTTTATTTATTTATTTTGAGGGG - Intronic
1183887604 22:40897867-40897889 GGTTATTTGTATATCTTATTTGG + Intronic
1184053228 22:42024615-42024637 TGCTTTTTATATACCTTAATTGG + Intronic
1184620079 22:45670737-45670759 ATGTATTTATATATTTTAAGTGG + Intergenic
1185025326 22:48406070-48406092 TCTTATTTATCAATTTTAAGAGG + Intergenic
1203286765 22_KI270734v1_random:158459-158481 TTTTATTTATTTATTTTTAGAGG + Intergenic
950177003 3:10881915-10881937 TGTCATTTACATTTCTAAAGGGG + Intronic
950222897 3:11210078-11210100 TGGTTTTTATATCTCTTATGTGG + Intronic
951032370 3:17896301-17896323 TGTTTTTTCTATCTCTTTAGTGG + Intronic
951355602 3:21663309-21663331 TGTTATTAATATTTCCCAAGAGG + Intronic
951452334 3:22853432-22853454 AGATATTTATATATATAAAGGGG - Intergenic
952249153 3:31632403-31632425 TGTTAATAATATATGTTATGGGG + Intronic
952717258 3:36492604-36492626 TGTTATTTCTGTAACCTAAGTGG + Intronic
954015601 3:47687511-47687533 AGTCGTTTATATATCTTAAAAGG - Intronic
955174038 3:56595030-56595052 TATTATTTATATAAGTGAAGTGG - Intronic
955198885 3:56831532-56831554 TGTTATTTATTTATTGTCAGTGG - Intronic
955293014 3:57710245-57710267 TGTTTTTCATATATGTTAAAAGG - Intergenic
956517624 3:70066916-70066938 GGTTATTTAAATATGTTCAGTGG + Intergenic
956943064 3:74186510-74186532 TGTAATTAATAAATCTGAAGAGG + Intergenic
957551962 3:81717920-81717942 TGTCTTTTATATTTCATAAGTGG - Intronic
957946989 3:87077357-87077379 TGTTATTAAAATACTTTAAGAGG - Intergenic
957948970 3:87099329-87099351 TTTTATTATTATATTTTAAGTGG - Intergenic
958721340 3:97847560-97847582 TGTTATTTTTATGTTTTAATAGG - Intronic
958914158 3:100029398-100029420 TTTTATTTATGTAACTAAAGTGG - Intronic
959083604 3:101828206-101828228 TTTTATTAAAATATCTTAAATGG + Exonic
959826269 3:110800237-110800259 AGTTCTTTATATATTTTAACAGG + Intergenic
960694678 3:120384558-120384580 TGTTATTCAAATCTCTTAATAGG - Intergenic
961184439 3:124902295-124902317 TTTTATTTTTATTTTTTAAGTGG - Intergenic
963448945 3:145452696-145452718 TGCTGTTTATAAATCTTTAGTGG + Intergenic
963897195 3:150699585-150699607 TGCTATTGATTTTTCTTAAGTGG - Intronic
963971493 3:151435036-151435058 TGTTAATTCTGTATCTTGAGAGG + Exonic
964095690 3:152928822-152928844 TTTTATTTCTATGTTTTAAGTGG + Intergenic
964299779 3:155275233-155275255 GATTATTTATTTATTTTAAGAGG + Intergenic
965068862 3:163890784-163890806 TGTTATTTTCTTAACTTAAGTGG + Intergenic
965135227 3:164757354-164757376 TATTTTTTATATAATTTAAGTGG + Intergenic
965153087 3:165007854-165007876 TGTTATTATTATATATTAATAGG - Intronic
965753778 3:172004703-172004725 TGTTATTCATATAGCTTATTTGG - Intergenic
966179516 3:177175429-177175451 TATTTTTTAGATATCTGAAGAGG - Intronic
966509270 3:180743475-180743497 TGTTATCCATGTATCCTAAGTGG - Intronic
966573169 3:181470155-181470177 TTTTATTTTTATATATTTAGGGG + Intergenic
967544419 3:190707529-190707551 TGATATATATATATAGTAAGTGG - Intergenic
968321295 3:197771303-197771325 TATTATTTATTTATCTTTCGTGG + Intronic
969383918 4:6830204-6830226 TATTATTTGTATTTCATAAGTGG + Intronic
970093990 4:12441856-12441878 TTTTATCTCTATATGTTAAGAGG + Intergenic
970231845 4:13919129-13919151 AATTATTTATATATTTTAGGCGG + Intergenic
971178381 4:24303993-24304015 TTTTATTGACAAATCTTAAGAGG + Intergenic
971758340 4:30732022-30732044 ATTTATTTATTTTTCTTAAGTGG - Exonic
971781811 4:31044998-31045020 TTTTATTTATATTTCTTTTGTGG + Intronic
972175309 4:36397444-36397466 AGTTATAAATATATCTTAACAGG - Intergenic
973041315 4:45472944-45472966 AGTTATTTGTGTATGTTAAGTGG - Intergenic
973201769 4:47511792-47511814 TGTTATTTATGTATTTATAGAGG + Intronic
973941809 4:55918779-55918801 TGCAAATTATATATCTGAAGAGG - Intergenic
973977602 4:56278847-56278869 TGATATTTTTATATCTTTTGTGG - Intronic
974164018 4:58177156-58177178 TGTTATACATATATCTTCATTGG + Intergenic
974270758 4:59648840-59648862 TATTATTTTCATATCTTAAAAGG + Intergenic
975052808 4:69886852-69886874 AGTTATATATATATATTAAAAGG + Intergenic
975559139 4:75693238-75693260 TTTTATTTATTTATTTTGAGAGG - Intronic
976949273 4:90809667-90809689 TATTATTTCTATAGCTTTAGGGG - Intronic
977141968 4:93384645-93384667 TCTTAATTATAAATTTTAAGTGG + Intronic
977253742 4:94717253-94717275 TGTTAATTATTTTTATTAAGTGG + Intergenic
977387537 4:96361704-96361726 TGTTATTTATATATATATAAAGG - Intergenic
977512266 4:97976292-97976314 TGTTATTTATATATCTTAAGTGG - Intronic
977993899 4:103479003-103479025 TGCTATTTATGTAACTTAGGTGG + Intergenic
978659914 4:111113241-111113263 CGTTCTTTATAGATCTTTAGAGG + Intergenic
978865417 4:113503236-113503258 TGATATTTAGAGATCTGAAGAGG + Intronic
979353229 4:119670631-119670653 TGTGATTTATGCATTTTAAGTGG + Intergenic
980146516 4:128992113-128992135 TGTTAATTATTTTTCTTCAGGGG - Intronic
980420662 4:132555934-132555956 TGTTATCTATTTATCTTACAAGG + Intergenic
980460781 4:133108748-133108770 AGTTATTTATTTATTTTAATAGG - Intergenic
980746565 4:137025180-137025202 TGTGCTTTATATATTATAAGTGG - Intergenic
980765598 4:137299869-137299891 TATTATTTATATTTATTATGAGG - Intergenic
981218528 4:142202754-142202776 TGTTTTTCAGATATCTCAAGTGG - Intronic
981428962 4:144638733-144638755 GGTTATTTATATCTCTGAATAGG - Intergenic
982587277 4:157258502-157258524 TGTCATTGATATATCTTATCAGG - Intronic
984306359 4:177997008-177997030 TATGATTTATATATATAAAGGGG + Intergenic
984575863 4:181447393-181447415 TGTTTTTTCTATATCTTGAGTGG + Intergenic
985361675 4:189182416-189182438 AGTTATTTATATATTCTAAGTGG + Intergenic
986666524 5:10109345-10109367 TTTTATTTATTTTTCTTAATAGG + Intergenic
986953917 5:13126775-13126797 GGTTATTTGTATGTCTTAATTGG + Intergenic
987181273 5:15371134-15371156 TGTAGTTTATATATCTCAATTGG - Intergenic
987661059 5:20876755-20876777 TGGTATTTATATATGTTGAAAGG - Intergenic
988012050 5:25501512-25501534 TGTTATTGTTAAATTTTAAGTGG + Intergenic
990153978 5:52853410-52853432 TGTTATTTAATTATCTCTAGAGG + Intronic
990288335 5:54323522-54323544 TGTTATTTACTAATATTAAGTGG + Intergenic
990924433 5:61004138-61004160 TGTTATTTATTTATCCTATGTGG + Intronic
991925921 5:71704841-71704863 TGACATTTGTATATCTAAAGAGG + Intergenic
991993470 5:72364559-72364581 TATTATTTATACATCTAATGAGG + Intergenic
992151120 5:73904203-73904225 TGTTTTTTATGTATTTTAGGTGG + Exonic
993063723 5:83073497-83073519 TTTTATTAATCTTTCTTAAGTGG - Intronic
993516632 5:88844169-88844191 TGTTATTTCTATATTTCAATTGG + Intronic
994402468 5:99298548-99298570 ACTTATTTGTATATTTTAAGTGG + Intergenic
995403629 5:111769108-111769130 TGTTAATCCTATATCTTAAATGG + Intronic
995940152 5:117571897-117571919 TGTTATCTCTATAAATTAAGAGG + Intergenic
997731379 5:136181187-136181209 GGATATTTATATATTTTAAGTGG - Exonic
998924514 5:147107065-147107087 TGTTATTTATAAATCCCCAGTGG + Intergenic
999003727 5:147952898-147952920 TTTTATTTTTATAGCTTTAGAGG - Intergenic
999211615 5:149894460-149894482 CTTTATTTATTTATTTTAAGTGG + Intronic
999406795 5:151313733-151313755 TGATATTAAAATTTCTTAAGTGG - Intergenic
999528389 5:152434015-152434037 TATTATTTTTATATATTTAGGGG + Intergenic
1000218910 5:159192695-159192717 TGGTAATAAAATATCTTAAGGGG - Intronic
1000456998 5:161461936-161461958 TGAGATTTATACATCTTAATTGG + Intronic
1000508171 5:162147801-162147823 TGTTATTTATATTTCTTACGGGG - Intronic
1000567654 5:162869338-162869360 TGTATTTTATATATCTCTAGTGG + Intergenic
1000947767 5:167442623-167442645 TTTTATTTAAATATATAAAGTGG + Intronic
1001002540 5:168021210-168021232 TAATATTTATACATCTAAAGAGG - Intronic
1001077331 5:168639819-168639841 TGTTAAGTATATATTCTAAGTGG + Intergenic
1001510348 5:172316550-172316572 TGTTATATATATATATTTTGAGG + Intergenic
1001713932 5:173799365-173799387 TGTAGTTTATGTAGCTTAAGAGG + Intergenic
1003724839 6:8749389-8749411 TTTTATTTTTATATCCTTAGTGG - Intergenic
1004306728 6:14507883-14507905 TGTTATTTTTATTTATTTAGAGG - Intergenic
1004757556 6:18629266-18629288 TGTTTATTAGATAACTTAAGAGG + Intergenic
1005646206 6:27840736-27840758 ATTTATTTATTTATTTTAAGAGG - Intronic
1006325289 6:33349092-33349114 TATTATTTATTTACTTTAAGAGG - Intergenic
1006453112 6:34116653-34116675 TCTCATATATATATATTAAGTGG - Intronic
1006678897 6:35782955-35782977 TGTTATGTATATAACATATGTGG + Intronic
1007906750 6:45469209-45469231 TGTTATTTACATGTTATAAGAGG + Intronic
1008103517 6:47418132-47418154 TGTTATTGTTATATCATAGGAGG + Intergenic
1008343112 6:50391380-50391402 ATTTATTTATTTATTTTAAGAGG - Intergenic
1008786927 6:55179274-55179296 TATTATTTCTATATCTAAAAAGG - Intronic
1008791367 6:55239238-55239260 TGTTATTAATAGATCTTCACAGG - Intronic
1009275264 6:61669967-61669989 TGTTATTTATTTATTTGAAGTGG - Intergenic
1009539541 6:64935079-64935101 TGTAATTGCTTTATCTTAAGAGG + Intronic
1009785265 6:68329223-68329245 TGTTATTTATAAATATTATGTGG + Intergenic
1011037970 6:82998591-82998613 TTTTCTTAATATATTTTAAGGGG + Intronic
1011060601 6:83262087-83262109 TGTTATTTTTACATTTTAATAGG + Intronic
1011128369 6:84030275-84030297 TGATTTTTATATATATTAAGCGG + Intergenic
1011684012 6:89809770-89809792 TTTTATTTATTTATTTTGAGAGG - Intronic
1011757985 6:90525095-90525117 TTTTTTTTAAATATCTTAACTGG - Intronic
1012264963 6:97130608-97130630 TGTTGTTTATATATATTGAAAGG - Intronic
1012323537 6:97883821-97883843 TGTTGTTTATATATTTTTGGTGG + Intergenic
1012368686 6:98476095-98476117 TGTCATTTTTATGTCTTAATTGG - Intergenic
1013557560 6:111272040-111272062 AGTTATTTTTATTTTTTAAGTGG + Intergenic
1014860645 6:126463631-126463653 TGTGATTTACAGATCTTAATAGG + Intergenic
1015033838 6:128628772-128628794 TATCTTTTATATAACTTAAGAGG - Intergenic
1015682025 6:135818858-135818880 TGTTATTTAATCTTCTTAAGGGG - Intergenic
1016314086 6:142767525-142767547 TATTATTTACATATCTTCATGGG - Intronic
1016914967 6:149236220-149236242 TTTTATTTTTATATATTTAGGGG - Intronic
1017381078 6:153831001-153831023 TATTTTTTATATGTCTTGAGAGG + Intergenic
1017692248 6:156978382-156978404 TTTTATTTCTATTTTTTAAGGGG + Intronic
1017725978 6:157276093-157276115 TTTTATTTATTTATTTTGAGAGG - Intergenic
1017960683 6:159218186-159218208 TGTTGTTTTTATTTCTTCAGTGG + Intronic
1018543128 6:164905225-164905247 TGTTATTTATATGTCATCACAGG - Intergenic
1019032961 6:169029149-169029171 TGTTCTTTATATCACATAAGTGG + Intergenic
1020628825 7:10615773-10615795 TGATATCTATATGTCTGAAGGGG - Intergenic
1020808091 7:12815548-12815570 TGTTATTTCAATAGCTTTAGGGG - Intergenic
1020873257 7:13661299-13661321 TGTTATTTGTATATCTTTTTTGG - Intergenic
1020935050 7:14452829-14452851 TTTTATTTATATATATTATATGG + Intronic
1021155172 7:17201071-17201093 TAATTTTTATATATCGTAAGAGG + Intergenic
1021453886 7:20808105-20808127 TGTTATTTTTATTTTTTGAGAGG - Intergenic
1021505884 7:21384752-21384774 TGTTATTTATTTATGTTTACTGG + Intergenic
1022770940 7:33472178-33472200 TGATATTTTTATTTCTTCAGAGG + Intronic
1023623001 7:42091612-42091634 TGTGATTTATATATGTGTAGAGG - Intronic
1024136066 7:46410273-46410295 TGTCATTCATATATCTTCTGTGG + Intergenic
1025005332 7:55349761-55349783 TGTTTTTTATAGAACTTAAAAGG - Intergenic
1025156205 7:56608082-56608104 TGTTTTCTACATATCTTGAGGGG + Intergenic
1026098534 7:67366059-67366081 TTTTATTATTATAACTTAAGAGG + Intergenic
1026333827 7:69376873-69376895 TTTTGCTTATATATCTTAAGTGG - Intergenic
1027436850 7:78173604-78173626 TGTTATTTGTATTTCTTAATGGG + Intronic
1027449426 7:78313329-78313351 TTTTATTTTTATATATTTAGGGG - Intronic
1027515972 7:79142239-79142261 TGTTATTTGGATATCTTGATTGG + Intronic
1027937236 7:84623068-84623090 TGTTATATATGTATCTTCTGGGG + Intergenic
1029252454 7:99246699-99246721 TTTTATTTATATATATTTTGTGG - Intergenic
1029325645 7:99806396-99806418 TGCTATTTGTATATCTTCATTGG - Intergenic
1030758739 7:113323840-113323862 TTTTATTTTTATTTTTTAAGTGG - Intergenic
1031439912 7:121781290-121781312 TGTTCATTATATATATTATGTGG - Intergenic
1031639188 7:124140788-124140810 TGTTTTTTCTATCTCTTCAGTGG + Intergenic
1032108985 7:129059075-129059097 TGTTTTTTATATGTTTTAAAAGG + Intergenic
1032660070 7:133973262-133973284 TATGATGTATACATCTTAAGGGG + Intronic
1032684906 7:134223447-134223469 TCTTATTTATAGATGTTTAGTGG - Intronic
1033567577 7:142594253-142594275 TTTTATTTATCTTTGTTAAGGGG - Intergenic
1033846245 7:145435527-145435549 TATCATTTATAGATCTTAAGAGG + Intergenic
1033866967 7:145701263-145701285 TGTCATTTATATATCATTATTGG + Intergenic
1033899682 7:146120985-146121007 TGTTTTTTGTCTATTTTAAGTGG + Intronic
1035402931 7:158579207-158579229 TATCATTTATATTTCTTAATAGG - Intronic
1035968875 8:4225341-4225363 TGTTAATTACATATTTTAGGTGG - Intronic
1036949780 8:13130125-13130147 TGGTATTTTTATGACTTAAGCGG - Intronic
1036972316 8:13368825-13368847 GGTTATTTATTTATTTTAAGAGG + Intronic
1037979519 8:23241166-23241188 TTTTATTTTTATTACTTAAGGGG + Intergenic
1038133619 8:24761319-24761341 TATTATTTGTATATCTTCTGTGG - Intergenic
1038170890 8:25130597-25130619 TGATTTTTATATATTTTAAAAGG - Intergenic
1038709423 8:29927876-29927898 TGTGCTTTCTATATCCTAAGTGG - Intergenic
1039066077 8:33608662-33608684 TTTTATTTATTTATCTTTTGGGG + Intergenic
1039101037 8:33942495-33942517 TGTTATTTTTATAGATTTAGGGG - Intergenic
1039645623 8:39279291-39279313 TTTTATTTATTTTTTTTAAGCGG + Intronic
1040780570 8:51103118-51103140 TGTTATTTGTATATCTTCTGTGG - Intergenic
1041057663 8:54003996-54004018 GGTTATTTTTATATCTTATTCGG - Intronic
1041161437 8:55049260-55049282 TGATATTTATATAGCATGAGAGG - Intergenic
1041547761 8:59065437-59065459 TGTTATTAATGTTTTTTAAGAGG + Intronic
1041857834 8:62478440-62478462 TGTGAATTATATATTTTATGGGG - Intronic
1041972310 8:63757872-63757894 TGTTATTTTTATTTCTTGTGGGG + Intergenic
1042952261 8:74213133-74213155 TCTTTTTTATATAACTTAACGGG + Intergenic
1043079859 8:75753030-75753052 TTTTATTTGTATATGTTGAGAGG + Intergenic
1043153100 8:76743219-76743241 TGTGATTTGTATCTCTTATGAGG + Intronic
1043158465 8:76816211-76816233 TGCTATTTATATAGGTTGAGTGG + Intronic
1043217552 8:77612654-77612676 TTTTATTAATATATTTTAATGGG - Intergenic
1043590117 8:81821617-81821639 TGTAATATATATATATAAAGTGG + Intronic
1043677573 8:82977068-82977090 TGACATTTATATATCTTATTTGG + Intergenic
1043739734 8:83795797-83795819 TATTATGTATATATATTTAGGGG + Intergenic
1044133094 8:88550880-88550902 TGTTAGTTTTATTTCTTAACAGG - Intergenic
1044249971 8:89994215-89994237 TGTTATATATATATATTAGACGG - Intronic
1044910648 8:97054906-97054928 TGTTATTTCAATAACTTTAGGGG - Intronic
1044944349 8:97376834-97376856 TGTTATATATTTGTTTTAAGTGG - Intergenic
1045226574 8:100252737-100252759 TAGTATTTATATATATGAAGAGG - Intronic
1045273017 8:100677984-100678006 TTTTATTTATATTTTTTAATTGG - Intergenic
1045613358 8:103875122-103875144 TTTTATTTCTATAGCTTTAGGGG + Intronic
1045745628 8:105417386-105417408 TTTTATTTGTATAATTTAAGGGG - Intronic
1045940586 8:107734050-107734072 TGTTTTTTGTATTTTTTAAGGGG + Intergenic
1046113387 8:109754438-109754460 TTTTATTTTTATATCTTCAAAGG - Intergenic
1046334749 8:112771019-112771041 TTTTATTTATAGATTTTTAGAGG - Intronic
1046421015 8:113982186-113982208 TGTTGTTTATATAGCTCATGGGG + Intergenic
1046502952 8:115101873-115101895 TTTTATTTATTTATTTTAATCGG - Intergenic
1046536101 8:115512794-115512816 TCTTAAATATATATCTTAATGGG + Intronic
1047962458 8:130020794-130020816 TGTTATTATTATAACTTAATTGG + Intergenic
1050571499 9:6944048-6944070 TTAAATTTATATATCTTAAATGG + Intronic
1050813599 9:9780463-9780485 TGTTATCTATATATCTTCTTTGG - Intronic
1050922233 9:11218227-11218249 TGTTATTTTTATAACTGATGTGG - Intergenic
1052131166 9:24848830-24848852 AGTCATTTATATTTTTTAAGGGG - Intergenic
1052394099 9:27916641-27916663 AGATATATATATATATTAAGAGG - Intergenic
1052394675 9:27924488-27924510 AGTTATTTATATGTCTGAGGTGG + Intergenic
1052590441 9:30486541-30486563 TTTTATGTATAAATCTTAATAGG + Intergenic
1053623030 9:39840298-39840320 TATTATTTCAATAGCTTAAGGGG + Intergenic
1053881841 9:42602929-42602951 TATTATTTCAATAGCTTAAGGGG - Intergenic
1053890832 9:42691361-42691383 TGTTATTTCAATAGCTTAAGGGG + Intergenic
1054220865 9:62410393-62410415 TGTTATTTCAATAGCTTAAGGGG - Intergenic
1054229849 9:62498779-62498801 TGTTATTTCAATAGCTTAAGGGG + Intergenic
1054919913 9:70532362-70532384 TCTTATATATATATTTTAAAAGG + Exonic
1055025522 9:71715617-71715639 ATATATATATATATCTTAAGAGG - Intronic
1055362376 9:75506772-75506794 TGCTGTTTATATATCTTATTTGG + Intergenic
1055811242 9:80150526-80150548 TAATTTTTATATATCATAAGAGG + Intergenic
1056049318 9:82751667-82751689 TGTCATTTATTTATCTTCGGTGG + Intergenic
1056463723 9:86833438-86833460 TCTTATTTATTTATTTTCAGTGG + Intergenic
1056577372 9:87866833-87866855 TATTGTTTATATTTCTTGAGGGG - Intergenic
1058113882 9:101063018-101063040 TGTTTTTCATATATCACAAGGGG + Intronic
1059359248 9:113727320-113727342 TTTTATTTATATTTCTTTAGTGG + Intergenic
1059706780 9:116831340-116831362 TTTTATTTTTATATATTTAGGGG - Intronic
1060364672 9:122998863-122998885 TGTATTTTAAATATATTAAGAGG + Intronic
1061085495 9:128395778-128395800 ATTTATTTATTTATTTTAAGAGG + Intergenic
1061223835 9:129268736-129268758 TGTTTTTTATACATATTAACTGG + Intergenic
1061426344 9:130500773-130500795 TGTAATTAATTTATCTTAGGGGG - Intronic
1203769627 EBV:42631-42653 AGTTATTTATTTATCTCCAGAGG + Intergenic
1186338861 X:8622055-8622077 TGTTTTTTCTACATCTCAAGGGG + Intronic
1187452031 X:19406703-19406725 TGTTATTTATTTTTTTGAAGTGG + Intronic
1187567671 X:20468237-20468259 TGTTATTTCTAATTCTTAATTGG - Intergenic
1187769090 X:22675477-22675499 TTTTATTCTTAGATCTTAAGTGG + Intergenic
1187770302 X:22688154-22688176 TGTTATTTATTTATTTTTATTGG + Intergenic
1187862156 X:23693115-23693137 TTTTATTTATTTATTTTGAGAGG + Intergenic
1188116299 X:26248128-26248150 AGTTATTTATCTATTTTAATGGG - Intergenic
1188204320 X:27334386-27334408 TTTTTTTTAAATCTCTTAAGTGG - Intergenic
1188867400 X:35330059-35330081 TTTTATTTATATAAATTAATGGG + Intergenic
1189240118 X:39518424-39518446 TGTTATTTTTATAGCTTACAAGG - Intergenic
1190153948 X:47972690-47972712 TGTTACTTATATATACTCAGAGG - Intronic
1190450631 X:50576959-50576981 TGTAATTTAGAAAACTTAAGTGG + Intergenic
1191816971 X:65256051-65256073 GGTTATGTATATATCTTCATAGG - Intergenic
1192602910 X:72483564-72483586 AGTTATTTATAAATAATAAGAGG - Intronic
1193113066 X:77748964-77748986 TTTTATTTGTATATATTTAGGGG + Intronic
1193224805 X:78969921-78969943 TATTCTTTATATATGGTAAGAGG + Intergenic
1193936227 X:87625529-87625551 TTGTATTTATATAACTTTAGAGG - Intronic
1194013680 X:88592508-88592530 TGTTATTTCAATAGCTTTAGTGG - Intergenic
1194124981 X:90005791-90005813 TGCTATCTATGTCTCTTAAGTGG + Intergenic
1194293070 X:92099266-92099288 TGTCATTTGTATTTCTTAATTGG - Intronic
1194354555 X:92866543-92866565 TGTCATTTATATATATAAAAAGG + Intergenic
1194501987 X:94692454-94692476 TTTTATATATATATATTTAGAGG - Intergenic
1195334544 X:103838130-103838152 TGTTAGTTAAATTTATTAAGGGG + Intergenic
1195437541 X:104862727-104862749 TTTTATTTATTTATTTTAAAAGG - Intronic
1195459830 X:105111937-105111959 TGTTATTTAACTATTATAAGAGG + Intronic
1195483141 X:105371399-105371421 TGATTTTTATATATCGTAAAAGG + Intronic
1195711999 X:107780342-107780364 TGTTATTAATATATATAAGGAGG - Intronic
1196093544 X:111773576-111773598 TGTTATATATAGATGTGAAGTGG - Intergenic
1196527902 X:116748868-116748890 GGTTATTGGTATCTCTTAAGAGG + Intergenic
1197103933 X:122690474-122690496 TTTTATTTAAATAGCTTTAGTGG - Intergenic
1197218083 X:123885527-123885549 AGTTATTTTTATGTCATAAGTGG + Intronic
1197485605 X:127046492-127046514 TGTTATGTATATATCTTCTTTGG + Intergenic
1197511038 X:127369608-127369630 TATTATTTAAATAACTTATGGGG + Intergenic
1197559847 X:128006220-128006242 TTTTATTTTTATATATTTAGGGG + Intergenic
1197577459 X:128233621-128233643 TTTTATTTGTATATATTCAGGGG - Intergenic
1198008407 X:132523447-132523469 TTTTATTTTTATATTTTTAGAGG + Intergenic
1198540399 X:137632713-137632735 TTTTATATATATATATAAAGGGG + Intergenic
1198896002 X:141455161-141455183 TTTTATTTTTATACATTAAGGGG - Intergenic
1199517859 X:148698732-148698754 TGTTTTATTTATATCTTAAGAGG - Intronic
1199963521 X:152799184-152799206 TGTTGTTTATATAGCTCATGTGG - Intergenic
1200096175 X:153664265-153664287 TATTATTTATATATCTTATTTGG - Intergenic
1200477871 Y:3663439-3663461 TGCTATCTATGTCTCTTAAGTGG + Intergenic
1200559574 Y:4684791-4684813 TGTTATTTATATATTGTACATGG - Intergenic
1200610580 Y:5323814-5323836 TGTCATTTGTATTTCTTAATTGG - Intronic
1200662918 Y:5983573-5983595 TGTCATTTATATATATAAACAGG + Intergenic
1200871445 Y:8103003-8103025 TGTTATTTAAATATGGTAACAGG + Intergenic
1201055337 Y:9983838-9983860 TGTTATTTGTATTTAATAAGTGG + Intergenic
1201351694 Y:13050682-13050704 TGTTATTTGTATATTTTATTTGG - Intergenic
1201478346 Y:14409288-14409310 CTATATTTATATATCTCAAGTGG - Intergenic