ID: 977512849

View in Genome Browser
Species Human (GRCh38)
Location 4:97983403-97983425
Sequence CAGATTTTCAAATGCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977512844_977512849 18 Left 977512844 4:97983362-97983384 CCAATTTGTAGCTAAGTTTGGGA 0: 1
1: 1
2: 2
3: 28
4: 224
Right 977512849 4:97983403-97983425 CAGATTTTCAAATGCTTGGAGGG 0: 1
1: 0
2: 3
3: 27
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977512849 Original CRISPR CAGATTTTCAAATGCTTGGA GGG Intronic
901179099 1:7327962-7327984 AATATTTTCAAGTGCTGGGAGGG - Intronic
901373488 1:8820095-8820117 CAGCTTCTCAGATCCTTGGAAGG - Intergenic
901945395 1:12698576-12698598 CAGATGTTAAAATTATTGGAAGG - Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906018916 1:42609445-42609467 CAGATTTTCAACTGTGTGGGGGG + Intronic
908951463 1:69567773-69567795 GAGATTTTCCAATGATAGGAGGG - Intergenic
909248747 1:73325635-73325657 CAGAATATAAAATGCTTGGCTGG + Intergenic
909418971 1:75441361-75441383 CAGATTTCCAAATGTTTGCAGGG + Intronic
909552781 1:76917922-76917944 CAGGTCTTCAACTGATTGGATGG + Intronic
909596037 1:77407176-77407198 CAGATGTTCAAAAGCTTAAATGG + Intronic
910688803 1:89945124-89945146 CAGATTTTCAAATAGCTGCAAGG + Intergenic
911227474 1:95322571-95322593 AAGATTTTCATATTCTTGGTAGG + Intergenic
913037533 1:114986097-114986119 CAGATTTTGGCATGCATGGAGGG + Intronic
913617411 1:120575661-120575683 CAGATTTTCAAGGACCTGGAAGG - Intergenic
914572863 1:148935259-148935281 CAGATTTTCAAGGACCTGGAAGG + Intronic
916704821 1:167338430-167338452 CAGATTTTCAACTGTTTGTGGGG + Intronic
916846687 1:168658309-168658331 CAGACTGTCACATGCTTGAATGG + Intergenic
917599680 1:176561678-176561700 CAGATTTTCAAAAGGTTTTATGG - Intronic
918529236 1:185499843-185499865 CAGATATTCAGATATTTGGAAGG - Intergenic
918942683 1:191022262-191022284 CAGATTTTCACAGGCTGAGATGG + Intergenic
919863733 1:201762454-201762476 CACATTTTTAAATGATTGGAAGG + Intronic
919985874 1:202674444-202674466 CAGATGTTCATATGCTCAGATGG - Intronic
920618946 1:207525036-207525058 CATATCTTCATATGCTTGGCAGG + Intronic
920620726 1:207543592-207543614 CATATCTTCATATGCTTGGCAGG + Intronic
920622508 1:207562149-207562171 CATATCTTCATATGCTTGGCAGG + Intronic
923508772 1:234630841-234630863 CAGATTTTCGACTGCATGGAGGG - Intergenic
923754429 1:236777825-236777847 TAGATTTTCAACTGCATGGGAGG + Intergenic
1063342342 10:5278243-5278265 TAAATTTTAAAATGCTTTGAAGG + Intergenic
1063763749 10:9113044-9113066 CAGATGTTCACATGCTTAGTAGG + Intergenic
1064933209 10:20650556-20650578 ATGATTTTTAAAGGCTTGGAAGG - Intergenic
1065075398 10:22073913-22073935 CAGTTTTTGAAAGGCTTTGAAGG + Intergenic
1065653290 10:27916838-27916860 CAGATTTTCGACTGCATGGAGGG + Intronic
1066433393 10:35373855-35373877 CAGATTTTCAACTCCATGAAGGG + Intronic
1067547225 10:47201686-47201708 CAGGTCTTCAAATGTTTGGATGG + Intergenic
1068794752 10:61067343-61067365 CAGATTTTAAAATGCTACAAAGG - Intergenic
1069357759 10:67607178-67607200 CAGATTTTCAACTGCACGGTGGG - Intronic
1069941728 10:71961344-71961366 TAGATTTTCAGATGTTTGGTGGG - Intergenic
1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG + Intronic
1071194204 10:83138524-83138546 CTGATTTTAAAATGCATGGAAGG + Intergenic
1071288869 10:84173819-84173841 CAGATTTTCACGTCCTGGGAAGG - Exonic
1071604505 10:86975748-86975770 CTGATTTTTAAATGTTTGGTTGG + Intronic
1072500069 10:96006437-96006459 CGCATTTTCAAATGTTTGAAAGG + Intronic
1073092894 10:100958345-100958367 CTGATTTTCAAATACATGTAGGG + Intronic
1073618561 10:105023414-105023436 GAGAGTTTCCAATGGTTGGAGGG + Intronic
1075589713 10:123682691-123682713 CAGATTTTCAAGTGCCTCAAAGG - Intronic
1075619902 10:123918757-123918779 CAGAATTTTACATGCTTGTATGG - Intronic
1076190523 10:128480059-128480081 GAGATTTTGGAGTGCTTGGAAGG + Intergenic
1077764858 11:5147414-5147436 CAGGCCTTCAACTGCTTGGAAGG - Intergenic
1078257576 11:9673169-9673191 CAGATTTGCAACTGGTAGGAAGG - Intronic
1080068683 11:28052074-28052096 CAGATTCTAAAATGTTTTGAAGG - Intronic
1080320522 11:31004044-31004066 CAGTTTTTGAAATGCTGAGATGG + Intronic
1081382919 11:42437828-42437850 CAGATTTTCAAAGGCAGGTACGG - Intergenic
1081394380 11:42568115-42568137 CAGAATTTCAAATGCCTACATGG - Intergenic
1081804515 11:45883158-45883180 GAGATTTTCTATTGCTGGGAAGG + Exonic
1082730886 11:56796091-56796113 TGGATTTTCAACTGCTTAGAGGG - Intergenic
1083877672 11:65532837-65532859 CTGGTTTTCCAAGGCTTGGAGGG + Intronic
1084883576 11:72189175-72189197 CAGATCTTCAATTGTTTGAAGGG - Intergenic
1087264366 11:96044264-96044286 CAGTTTTTCACATGGTTGCATGG + Intronic
1088528462 11:110782641-110782663 CAGATTATTAAATGATTGTATGG - Intergenic
1089140340 11:116279158-116279180 AAGATTCTCATCTGCTTGGATGG + Intergenic
1091370728 11:135056068-135056090 CACACTTTCAGAGGCTTGGAAGG + Intergenic
1093588207 12:20868313-20868335 CAGATTGTCAACTGTTTGGGGGG + Intronic
1093896683 12:24582739-24582761 CAAATTTTCAACTGCATGCAGGG - Intergenic
1098760857 12:74423304-74423326 CATATTTTCCAATGTGTGGAAGG - Intergenic
1099395447 12:82132815-82132837 CAGATATTCCAATATTTGGAGGG - Intergenic
1103037984 12:117671868-117671890 CAGATTTTCAGAATCCTGGAAGG + Intronic
1104582893 12:130023746-130023768 AGGATTTGCAAATGCTTGGGGGG - Intergenic
1104949899 12:132434977-132434999 CGGATGTTCAAATGGTAGGAAGG - Intergenic
1105224708 13:18420920-18420942 CAGATTTTCAGCTGCATGGGGGG - Intronic
1106249474 13:27972593-27972615 GAGTTTTTCATCTGCTTGGAGGG - Intergenic
1106724251 13:32468507-32468529 CAGATTTTCAAATGAGAGAAAGG + Intronic
1107053548 13:36078425-36078447 CAGATCATCAAGGGCTTGGAGGG - Intronic
1107972738 13:45659845-45659867 TAGTTTTTCAAATGCTAGCATGG + Intergenic
1108051424 13:46444618-46444640 AAGATTATCAAATACATGGAGGG - Intergenic
1109033044 13:57218351-57218373 CAGAATTTAAAAAGCTTGGCTGG - Intergenic
1109584000 13:64374276-64374298 GAAATTCTCAAATACTTGGAGGG - Intergenic
1109793031 13:67274547-67274569 CATATTTTCATATGGTTGGTTGG + Intergenic
1111436422 13:88215713-88215735 TAGATTTTCAACTGTGTGGAGGG - Intergenic
1111806326 13:93043552-93043574 CAGATCTTCAGATGTTTGGTGGG - Intergenic
1112025509 13:95407527-95407549 CAGTTTTTCCAGGGCTTGGAAGG - Intergenic
1112835970 13:103514413-103514435 CTGAGTTTTAAATGTTTGGATGG + Intergenic
1114008808 14:18345312-18345334 CAGATTTTCAGTTGCATGGGGGG - Intergenic
1115514406 14:34171038-34171060 TACATTTGGAAATGCTTGGAGGG + Intronic
1115544451 14:34453177-34453199 CAGATTTTCAACTGCCTGCAGGG + Intronic
1115962236 14:38848319-38848341 CTGACTTTCATATGTTTGGAAGG - Intergenic
1117950077 14:61074135-61074157 CAGATTTTCAACTGTGTGGTGGG + Intronic
1118616050 14:67575116-67575138 CCTATTTTCATATGCCTGGAGGG + Intronic
1120336640 14:83165616-83165638 CAGATTTTATTATTCTTGGAAGG - Intergenic
1122092586 14:99350053-99350075 CAGGTTTTCTAGTGTTTGGATGG + Intergenic
1123392012 15:19885886-19885908 CAGATTTTCAGCTGCATGGGGGG - Intergenic
1123811189 15:23927968-23927990 AAAATTTTCAAATTCTAGGAAGG - Intergenic
1125994485 15:44144806-44144828 CACATTTTAAAACGCTTGGAAGG - Intronic
1126354277 15:47778502-47778524 CTGATTTGCAAATGCTAAGAAGG - Intergenic
1127185180 15:56472021-56472043 CTGAGTTGCAAATGCTGGGATGG + Intergenic
1127262496 15:57336550-57336572 AAGTTTTTCATAAGCTTGGAGGG - Intergenic
1128530748 15:68445534-68445556 CAGATTTGCAAATGCCTCCAGGG + Intergenic
1128992927 15:72275399-72275421 GAGAGATTCAAATGTTTGGAGGG - Intronic
1129006782 15:72380491-72380513 CAGATTTTGGTATCCTTGGAAGG + Intergenic
1130177393 15:81588641-81588663 CAGAATTTCAAAGTCTAGGAAGG - Intergenic
1130350903 15:83090891-83090913 CAGATTTTCAAATGTCTTCATGG + Intergenic
1133648495 16:7787146-7787168 CACAGTTTCAAATGATTGCATGG - Intergenic
1134677887 16:16103267-16103289 CAGTTTTTTAAAAGCTAGGATGG - Intronic
1135293411 16:21259622-21259644 TAGATTTTCAAATGAATGGGGGG - Intronic
1135513748 16:23112114-23112136 CAAAGTTTCAAATACCTGGAAGG + Intronic
1135893522 16:26377929-26377951 CAGTTTTTTAAATGCTTGGCAGG + Intergenic
1137323843 16:47413228-47413250 CAGAATATCAAATTCTTGGTTGG - Intronic
1137756349 16:50905503-50905525 CAGATTCTCAAAAGCCTTGATGG - Intergenic
1138113833 16:54344720-54344742 CAGATTTTCACAGCCTTGAAAGG + Intergenic
1138903956 16:61307721-61307743 CACATTTTCATATGACTGGAGGG + Intergenic
1140076534 16:71704951-71704973 CAGATCTTCAAATGTTCAGACGG + Intronic
1140254828 16:73326240-73326262 CAGATTTCCAAATTCTTAAATGG - Intergenic
1140909837 16:79441263-79441285 CACATTTTCCTATGCTGGGAAGG + Intergenic
1141785021 16:86193663-86193685 CATGTTCTCAAATGCCTGGATGG - Intergenic
1146483755 17:33227021-33227043 CTGGATTTCAAATGCTTGAAAGG - Intronic
1148544960 17:48511063-48511085 GTTATTTTGAAATGCTTGGATGG + Intergenic
1148591825 17:48822123-48822145 CAGATTTTCAACTGCCTAGGGGG - Intergenic
1148685533 17:49498445-49498467 GAGATTTTCAAACACCTGGAGGG - Intronic
1149162326 17:53709168-53709190 CAGATTTTCATTTGTTTGGTTGG + Intergenic
1149313302 17:55417022-55417044 CAGAATTTCAAAACCATGGAGGG + Intronic
1149749699 17:59133668-59133690 CAGAAATTCAAATGCTTCTAAGG + Intronic
1150597712 17:66621345-66621367 CACATTTTTAAATGCTTCAATGG - Intronic
1151838248 17:76598479-76598501 CAGATTTTGGAAGACTTGGAGGG + Intergenic
1152997519 18:421799-421821 GATATTTTAAAATGCTTGAATGG - Intronic
1153135746 18:1915867-1915889 CAGTTTTGCAATTGCGTGGATGG + Intergenic
1153280470 18:3409969-3409991 CAGCTTTACAAATGGTCGGATGG + Intergenic
1153440719 18:5116496-5116518 CACATCTTCACATGCCTGGAAGG - Intergenic
1154300492 18:13186968-13186990 GAGCTTTTCAAATGCCTGAAAGG + Intergenic
1154528648 18:15318586-15318608 CAGATTTTCAGCTGCATGGGGGG + Intergenic
1156172942 18:34507863-34507885 CATATTTTTCAATGGTTGGAGGG - Intronic
1160213544 18:76905883-76905905 TATATTTTCACATGATTGGAAGG + Intronic
1160951278 19:1668844-1668866 CAGAGTTTCAAATGCCTGTAAGG - Intergenic
1162641681 19:12015121-12015143 CACACCTTCAAATGCATGGAAGG - Exonic
1162645160 19:12043736-12043758 CAGAACTTCAAATGCACGGAAGG - Intronic
1162649523 19:12076501-12076523 CACACCTTCAAATGCATGGAAGG + Exonic
1162653653 19:12111671-12111693 CAGAACTTCAAATGCATGCAAGG + Intronic
1167968630 19:53170818-53170840 CAGATTTTCAACTGAGTGGAGGG - Intronic
1168562990 19:57398738-57398760 GAGATCTTCACATGCATGGAGGG + Exonic
925067886 2:943215-943237 CAGATTCCCAAACGCATGGATGG - Intergenic
926017096 2:9463092-9463114 CAGAATGTCAGATCCTTGGAGGG - Intronic
926480957 2:13393356-13393378 CAAATTTTCAATTGCATGGATGG - Intergenic
928284587 2:29978468-29978490 TAGGTTTTCAACTGATTGGATGG - Intergenic
928782755 2:34845019-34845041 CTGATCTTCAACTGATTGGATGG + Intergenic
928861191 2:35858890-35858912 CAGATTTTCAAATAGGTGCAGGG + Intergenic
929017249 2:37510781-37510803 CAAATTTTCAACTGCATGGGGGG + Intergenic
929312680 2:40443949-40443971 CATCTTTTCTAATGCTTTGATGG + Intronic
929850646 2:45586367-45586389 CAGATTCTTAAATGCTTGCATGG - Intronic
931081302 2:58774871-58774893 CAGACTGTCAAATGTTTGCAGGG + Intergenic
931162628 2:59710120-59710142 CAGATTTTCAACTGTGTGGGAGG + Intergenic
931213999 2:60224727-60224749 AAGATCTTCAACTGATTGGATGG - Intergenic
931873177 2:66483406-66483428 TAGATTCTCAATTTCTTGGAAGG - Intronic
932288636 2:70556317-70556339 CAGCTTTTGAAAATCTTGGAGGG - Intergenic
932564558 2:72897423-72897445 CAGCTTTTCTTATGCATGGAGGG + Intergenic
932964240 2:76452875-76452897 CAGATATTGAAATGATGGGAGGG + Intergenic
933122105 2:78551577-78551599 CAGATTTAGAAATACTTGAAAGG + Intergenic
933221723 2:79697657-79697679 CAAAGTTTCAAATGCTTTGGAGG - Intronic
933492561 2:83006623-83006645 CAGATTATCAAATGAGTGTAAGG - Intergenic
935475274 2:103513323-103513345 CATATTTTCAAGTGCTTATAAGG - Intergenic
935610712 2:105022314-105022336 GTCATTTTCAAATGCTTTGAGGG - Intergenic
936992639 2:118382600-118382622 CAGATTTTCAACTGCATGGAAGG + Intergenic
937555609 2:123151583-123151605 GAAATTTTTAACTGCTTGGAAGG - Intergenic
938527756 2:132150055-132150077 CAGATTTTCAGCTGCATGGGGGG + Intronic
940330110 2:152465377-152465399 CAGATTTGGAAATACTTGGCTGG + Intronic
942939557 2:181600075-181600097 CAGATTATGAAATTCTTGGCTGG - Intronic
945148403 2:206762825-206762847 CAGTGTTTCAAAAGCCTGGAAGG - Intronic
946448485 2:219760066-219760088 CAGATGTGCAAGTTCTTGGAAGG - Intergenic
946982998 2:225238854-225238876 CAGCTTTTCAAATGTCTGGCTGG + Intergenic
947241163 2:227995922-227995944 CTGTTTTTCAAATGATTGGAGGG - Intronic
1169272989 20:4215118-4215140 TACATTTTTAAATGATTGGAGGG - Intergenic
1170242242 20:14180252-14180274 CTGAATTTCTACTGCTTGGATGG + Intronic
1170303704 20:14914596-14914618 CAAATATTAAAATGCATGGATGG - Intronic
1170861496 20:20108175-20108197 CAGATTTTCTGATGCTCTGAAGG + Intronic
1171369170 20:24649685-24649707 CTGAGTTTCTAATGCTTTGAGGG - Intronic
1173155572 20:40605832-40605854 CAGACTTTCAACAGCTGGGAGGG - Intergenic
1175016707 20:55799209-55799231 CAGATTTTCAAATCTGTGGTAGG - Intergenic
1176013727 20:62916401-62916423 CTGACTTCCAAATGCTTGAATGG + Intronic
1176768761 21:13049950-13049972 CAGATTTTCAGCTGCATGGGGGG - Intergenic
1177229704 21:18303950-18303972 AATATTTTCAAATGCTTAGTAGG + Intronic
1177285908 21:19049502-19049524 CAAATTTTGATAAGCTTGGAAGG - Intergenic
1177323699 21:19556183-19556205 CCTATTATCAAATGCTTGGAGGG - Intergenic
1180433311 22:15276129-15276151 CAGATTTTCAGTTGCATGGGGGG - Intergenic
1180515880 22:16144039-16144061 CAGATTTTCAGCTGCATGGGGGG - Intergenic
1180635073 22:17257619-17257641 CAGATTCTCAAGTGCTGAGATGG + Intergenic
1183954847 22:41373327-41373349 CAGATTTTCTACTGCATGGCGGG - Intronic
1184919282 22:47594251-47594273 CAGAATTCCAAGTGATTGGAAGG + Intergenic
949309532 3:2681141-2681163 CAGGTTTTAAAATCCTTGGGTGG - Intronic
951618398 3:24574032-24574054 CAGATGTTCAACTGCATGGAGGG + Intergenic
951708126 3:25564718-25564740 CAGATATTCACAGACTTGGAGGG + Intronic
953181643 3:40600582-40600604 CATAATTTTAAATGCATGGATGG + Intergenic
953339517 3:42121749-42121771 CAAATTTTCAGATGCTTTAAAGG - Intronic
953862294 3:46555001-46555023 CATATTTTCATATGCTTGTTAGG + Intronic
954057219 3:48037163-48037185 CAGCTTTTCCTATTCTTGGAGGG - Intronic
954884784 3:53863246-53863268 GAGATTTTCAACTGCATGCAGGG + Intronic
954922392 3:54203192-54203214 CAGGCTTTCAAAGGATTGGATGG - Intronic
954984852 3:54780856-54780878 CAGATTGTCAAGTGCTATGATGG - Intronic
955988341 3:64598705-64598727 CAGAATTTTAAATGTTAGGAAGG + Intronic
957124828 3:76145413-76145435 CAGATATGCAAAAGCTTGGGAGG + Intronic
957402243 3:79731398-79731420 CAAATTCTCCAAGGCTTGGATGG + Intronic
958683247 3:97357646-97357668 CAAATTTTCAACTGCATGGGGGG - Intronic
958712010 3:97728503-97728525 CAGAGTTCCAAGTGCTTAGATGG - Intronic
959963399 3:112327449-112327471 TATATTTTCAAATGCTTAGTTGG - Intergenic
960341151 3:116476848-116476870 CAGTTTTCCAAAGGCTTGAAGGG + Intronic
960749178 3:120927388-120927410 CAGAATTTCCAAGGCTAGGATGG + Intronic
961433409 3:126899341-126899363 CAAATTTTCCAAAGCTTGAATGG + Intronic
961912731 3:130337358-130337380 CAGATTATCAGAAGCTGGGAAGG + Intergenic
961965625 3:130899224-130899246 CAGATTTTCAACTGCATGGTGGG - Intronic
962708905 3:138069421-138069443 CAAATTTTCAACTGCATGGGGGG + Intronic
965312831 3:167152719-167152741 CAGAGTTTTATATGCATGGAAGG + Intergenic
965993458 3:174848584-174848606 AAGATTTTCAGAAGCTTGAAAGG - Intronic
966269840 3:178091194-178091216 CAGATTTTCCAGTACCTGGAGGG - Intergenic
966457011 3:180128651-180128673 CAGATTTTCAATTGCATGGGGGG + Intergenic
967507273 3:190267017-190267039 CAGTTTTCCAAATGTTTGCAAGG + Intergenic
968840847 4:3004484-3004506 CAGATTTTCAACTGCGCAGAAGG - Intronic
970998687 4:22297598-22297620 CAGATTTTCAAATACATAAATGG + Intergenic
971166760 4:24191511-24191533 GTGATTTTCAGCTGCTTGGATGG + Intergenic
971174106 4:24264216-24264238 CAGATTTTCAATGGTGTGGAGGG + Intergenic
971862798 4:32129803-32129825 TAGATTTTCAAATGCATAGGAGG - Intergenic
972897491 4:43641564-43641586 CAAGTTTTCAAATTCTTGGGTGG + Intergenic
974168695 4:58238251-58238273 TAGGTTTTCATATGTTTGGAAGG + Intergenic
974365120 4:60936946-60936968 CAGATATTCAAAAGTTTGAATGG - Intergenic
974595572 4:64011315-64011337 CAGATTGTGAAAAGCTTCGAAGG + Intergenic
974706514 4:65524023-65524045 CATATTTTCAACTGCTTGGAAGG - Intronic
975396573 4:73881124-73881146 GAGATTTTCTAATGCCTAGAAGG - Intergenic
975776013 4:77788193-77788215 CAGTTTTTTAAAAACTTGGATGG + Intronic
977512849 4:97983403-97983425 CAGATTTTCAAATGCTTGGAGGG + Intronic
978386315 4:108178985-108179007 CAGACTTTCAACTTATTGGAGGG + Intergenic
978712274 4:111798703-111798725 TAGATTTTCAAAAGCTTTGTAGG - Intergenic
979690395 4:123553203-123553225 CAAATTTTAAAATGCTTGCTTGG + Intergenic
982328174 4:154151229-154151251 CAGGTTTTAAAATGCTTGTTAGG - Intergenic
983644651 4:169977532-169977554 CATATTTTCAAATAGCTGGAAGG + Intergenic
986280747 5:6320277-6320299 CAGATTCTCTATTGCTTAGAGGG + Intergenic
986320662 5:6630268-6630290 TAGATTTTTAAAAGCTTGAAGGG - Intronic
986892130 5:12321497-12321519 CAAATTTTCAACTGCATGGCTGG + Intergenic
987733226 5:21804478-21804500 CACATTTTCAAATACTTGAAGGG + Intronic
987923130 5:24309170-24309192 CAGATCTTCACATGTTTGGTGGG + Intergenic
990651696 5:57907319-57907341 CAGATTTTCAGATTCTTGGATGG + Intergenic
991475621 5:67015773-67015795 TACATTTACAAATACTTGGAGGG + Intronic
992262302 5:74983563-74983585 CAGAAATTCAGAAGCTTGGAGGG + Intergenic
992539406 5:77748695-77748717 CAGATTTTCAAACATTAGGAGGG - Intronic
992760553 5:79947746-79947768 CTGAATTTGAAATGCTTGGATGG + Intergenic
993425589 5:87760385-87760407 CAGACCTACAAATGCATGGAAGG - Intergenic
994607710 5:101990769-101990791 CAGATTTTCAATTGCATAGGGGG + Intergenic
994762431 5:103872783-103872805 CATATTTTCACATTCCTGGATGG + Intergenic
995791546 5:115893521-115893543 TGGATTTTCAACTGCCTGGAAGG + Intronic
996003892 5:118397820-118397842 GAGATTTTTAAAAGGTTGGATGG + Intergenic
999679736 5:154045481-154045503 AAGATTTTTAAATGGTTGCATGG + Intronic
999803875 5:155063824-155063846 CATTTTTCCATATGCTTGGAAGG - Intergenic
1001350587 5:170959572-170959594 CAGATTTTCAACTGTGTGGAAGG - Intronic
1001779874 5:174358753-174358775 CAGTTTTACAAAGGCATGGATGG + Intergenic
1001836141 5:174834336-174834358 GAGATTTTGAAATTCTTGGTGGG + Intergenic
1001865538 5:175101111-175101133 TGGATTTTCAACTGCATGGAGGG - Intergenic
1003288483 6:4756632-4756654 CAGATTTTAAAATTCCTAGAGGG + Intronic
1003886676 6:10527889-10527911 CAGATTTACAAATGCTTTAAAGG - Intronic
1004483472 6:16043227-16043249 CAGATTTTCAAATAACTGGTGGG - Intergenic
1004601233 6:17151877-17151899 CAGATTTTAGCAAGCTTGGAGGG - Intergenic
1006851704 6:37103189-37103211 AATATTTTCAAATTCTTGCAGGG + Intergenic
1009704064 6:67221783-67221805 CAGATTATGAAATTCTTGGTTGG - Intergenic
1010706339 6:79115994-79116016 CTGATCTGCAAATGCATGGAAGG + Intergenic
1010733831 6:79419295-79419317 CAGACTTTAAAATGCTTTTATGG - Intergenic
1013089467 6:106886960-106886982 CAGAGTTTCAGTTGCTTTGATGG - Intergenic
1013297231 6:108768542-108768564 CAGTTATTGAAATGCTTGGGGGG + Intergenic
1013329944 6:109090376-109090398 CAGATTTTCAACTGTGTGGAGGG - Intronic
1013343007 6:109233684-109233706 CAGATTATCATCTGCTTAGATGG - Intergenic
1014529706 6:122544432-122544454 CATATTTTCAAATGATTGTGGGG - Intronic
1014946276 6:127502414-127502436 CACATTTGCAAATGTTTTGATGG - Intronic
1015218087 6:130773288-130773310 CAAATTTTGAAATGCTAGTACGG - Intergenic
1015347383 6:132175724-132175746 CAGAGGTTCAAAAGTTTGGAGGG - Intergenic
1015904186 6:138099748-138099770 CTTAGTTTCAAGTGCTTGGAAGG + Intronic
1016582451 6:145644805-145644827 CTGATTTTCACATCCTTGGTAGG - Intronic
1018461322 6:164002019-164002041 CTTATTTTAAAATGCTTGGATGG + Intergenic
1019345525 7:528179-528201 CTTATTTTCAAATGGTTGGGAGG + Intergenic
1019959431 7:4446665-4446687 TACATTTTTAAATGCTTGGGGGG - Intergenic
1020388226 7:7631195-7631217 CAGAGTTTGAAATAGTTGGAGGG + Intergenic
1023115736 7:36860231-36860253 CAGATTTTCAACTGTGTGGGGGG + Intronic
1024022941 7:45387624-45387646 CAGATTTGCTGATGCTTGGCTGG + Intergenic
1026107307 7:67431409-67431431 CTGATTTTCAACTGCATGGGGGG + Intergenic
1026600647 7:71774681-71774703 CAGAGGTTCAAATACATGGAGGG + Intergenic
1027136443 7:75627739-75627761 CAGATTTTCTAGTAGTTGGAGGG - Intronic
1029963550 7:104713793-104713815 TAGATTTTTAAATGCCAGGAAGG + Intronic
1030005531 7:105115027-105115049 AAGAATTTAAAATGCTTAGAAGG - Intronic
1030356928 7:108553516-108553538 CAAAATTTCAAATCCATGGAAGG - Intronic
1031321839 7:120339918-120339940 CAGATATACACATGCTTTGAAGG - Intronic
1031652584 7:124308738-124308760 AAGATTTCCAAATATTTGGAAGG + Intergenic
1033278279 7:139988783-139988805 CAGATTTTCAAGTGGCTGGCTGG - Intronic
1035318049 7:158009791-158009813 CAGAAATTTAAATGCTTGGTTGG - Intronic
1035424631 7:158761138-158761160 GAGATTTTCAGGTGTTTGGAGGG - Intronic
1035544502 8:469021-469043 CACATTTTAATATGCTTAGAAGG - Exonic
1036596893 8:10221249-10221271 CAGCTTTTCAATTGCTGTGAAGG + Intronic
1040823671 8:51593478-51593500 TAGATTTTTAAAAGCTTTGAGGG - Intronic
1041193164 8:55373931-55373953 CAAGTGTACAAATGCTTGGAGGG + Intronic
1041420328 8:57660820-57660842 CAGATTTTCAAAGGCTCTTATGG + Intergenic
1041834114 8:62192469-62192491 CAGATTTTTAAATGCCTCCAAGG + Intergenic
1042470447 8:69181585-69181607 CAGATTTTCAAATGCTTCTGTGG - Intergenic
1043601602 8:81945708-81945730 CAGATTTTGAAATGTTAGGTTGG + Intergenic
1046570188 8:115953580-115953602 CATATTTTAAAATATTTGGAAGG + Intergenic
1047868038 8:129050594-129050616 TGGATTTTCAAATGCATGGAAGG + Intergenic
1048593958 8:135846814-135846836 TAGATTTTAACATACTTGGAGGG + Intergenic
1049012826 8:139898775-139898797 CAGATTTTTAAATTCACGGAAGG - Intronic
1049380496 8:142312255-142312277 CAGATATTCAAATAGTTGGTTGG - Intronic
1050096598 9:2073763-2073785 AGGATTTACAAATGCTTTGATGG + Intronic
1050961326 9:11736828-11736850 GAGATTTTCAAATTGTTGGTAGG - Intergenic
1050977181 9:11953892-11953914 AAGATGTTCAAATTCTTAGATGG - Intergenic
1053038921 9:34852320-34852342 CAGATTTTCAACTGCATGGGGGG + Intergenic
1057002340 9:91522855-91522877 CAGGTCTTCAATTGATTGGATGG + Intergenic
1057021880 9:91705776-91705798 CAGATTTTCATATCCATGGGAGG - Intronic
1059181973 9:112224593-112224615 CATATTTTCAACTGTTTGCAGGG + Intronic
1060184541 9:121556159-121556181 CACATTTTTAAATGGTTGGGGGG + Intergenic
1060630955 9:125158096-125158118 AAGATTTTCAATTGTTTGGGAGG + Intronic
1061958628 9:133976793-133976815 CAGATATTCTACTGCATGGACGG + Intronic
1187020179 X:15373442-15373464 CAGCTTTTTAAAGCCTTGGAAGG - Intronic
1187271106 X:17780505-17780527 CAGATTTTCCAATGTTTAAAAGG + Intergenic
1188345258 X:29056843-29056865 CAGATTTTAAAATGCTCTTACGG - Intronic
1190821964 X:53981924-53981946 CAGCTTTTCAAAGGATTGCATGG - Intronic
1191588384 X:62853591-62853613 CACATTTTCAACTGTTTTGATGG - Intergenic
1191672667 X:63763119-63763141 TTGATTTTCAACTGCATGGAGGG + Intronic
1191673787 X:63773742-63773764 CATATCTTCAACTGATTGGATGG - Intronic
1191853277 X:65601920-65601942 CAGAATGTCAGATGCTTGGGAGG + Intronic
1192247395 X:69385045-69385067 CAGATTGTCAGATGACTGGAAGG - Intergenic
1193775282 X:85634303-85634325 CATAGTTTCAAATGCCTAGAAGG + Intergenic
1195467299 X:105194002-105194024 CAGATTTTCAAAGGGTTTTATGG - Intronic
1197494887 X:127166536-127166558 CAGTTTTTTAAAAGCTTGCATGG + Intergenic
1197675549 X:129326104-129326126 CAGGTGTTCAACTGATTGGATGG + Intergenic
1197823135 X:130561668-130561690 CAGATTATCAAAGGCTTTGTAGG + Intergenic
1198277912 X:135113453-135113475 CACATTTTCACATGCCTGGCAGG + Intergenic
1198842178 X:140869453-140869475 CATTTTTTCAAATGCTTGTTGGG - Intergenic