ID: 977513980

View in Genome Browser
Species Human (GRCh38)
Location 4:97996995-97997017
Sequence TAAATTAGTTCAGCCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 24, 2: 173, 3: 250, 4: 400}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977513980 Original CRISPR TAAATTAGTTCAGCCATTGC TGG Intronic
900916399 1:5642206-5642228 TAAATTAGTTCAACCATTGTGGG + Intergenic
901579832 1:10232646-10232668 TAAATTAGTTCAGTTATTCAGGG - Intronic
903304824 1:22405897-22405919 TAAATCAGTACAGCCATTACGGG - Intergenic
904274708 1:29373026-29373048 TAAATTAGATCACCCATGGATGG + Intergenic
904414395 1:30348134-30348156 TAAATTAGTTCAACCATTGTGGG - Intergenic
904573927 1:31489816-31489838 TAAGTTAGTTCAACCATTGCGGG - Intergenic
904914291 1:33958784-33958806 GAACTTAGTTCAGCCATGCCTGG + Intronic
904956880 1:34292071-34292093 TAAATTTGTTCAACCTTTGTGGG - Intergenic
905330756 1:37195095-37195117 TAAATTAGTACAGCAATTTTGGG + Intergenic
905518978 1:38583212-38583234 TAAATTAGTTCAACCATCGTGGG + Intergenic
905757879 1:40527058-40527080 TAAACTAGTTCAACCATTGTGGG + Intergenic
905799050 1:40831822-40831844 TAAATGAGATAAGCCAGTGCTGG - Intronic
905982834 1:42246589-42246611 TAAATTAGTACAGCCATTTATGG + Intronic
906870409 1:49473227-49473249 TAAATTAGTTCAGCCCCTGTGGG - Intronic
907374564 1:54025298-54025320 TAAATTAGTTCAACTATTGTTGG - Intergenic
907566538 1:55440178-55440200 TGAATTAGTTCAACCATTGCGGG + Intergenic
908258983 1:62324892-62324914 TAAAATGGTACAGCCATGGCTGG - Intergenic
908314946 1:62923340-62923362 TAAATTAGTTCAACCATTGTGGG - Intergenic
908327498 1:63037534-63037556 TAAACTAGTTCAACCATTGTGGG - Intergenic
908570125 1:65400914-65400936 TAAATTAGTACAGCCATTATGGG - Intronic
909030888 1:70538245-70538267 TAAATTAGTTCAGACCCTGTGGG - Intergenic
909303816 1:74047008-74047030 TAAATTAGTTCAACCATTGTGGG + Intronic
909305438 1:74070032-74070054 TAAATTAGTTCACCCACTATGGG + Intronic
909540544 1:76787096-76787118 TAAATAATTTCAGTCAATGCTGG + Intergenic
909547628 1:76865616-76865638 TAGATTAATGCAGCCATTTCAGG - Intergenic
909878681 1:80845147-80845169 TAAATTAGTTCAGCCATTTTGGG - Intergenic
910311099 1:85825506-85825528 TAAACTAGTTCAACCATTGTGGG - Intronic
910385056 1:86673425-86673447 TAAACTAGTTCAACCATTGTGGG + Intergenic
910612623 1:89161356-89161378 TAAATTAGTTAAACCATTGTGGG - Intronic
910744294 1:90556703-90556725 TAAACTAGTTCAACCATTGTGGG + Intergenic
910979699 1:92947502-92947524 TAAATTAGTACAGCCATTATGGG + Intronic
911561463 1:99411125-99411147 TAAATTAGTTCAACCATTGTGGG - Intergenic
912827465 1:112918988-112919010 TAAATTAGTACATTCATTTCAGG - Intronic
912887792 1:113493929-113493951 TAAATTAGTTCAACCATTGTGGG + Intronic
916614357 1:166424039-166424061 TAAATTAGTTCAACCATTGTGGG - Intergenic
916621085 1:166498345-166498367 TAAATTAGTACAGCCATTATGGG + Intergenic
916733648 1:167588126-167588148 TAAATTAGTACATCTATTACAGG + Intergenic
917043907 1:170835326-170835348 TAAATTAGTTCAACCATTGTGGG - Intergenic
917234599 1:172877348-172877370 TAAATTAGTTCAGCCACTATGGG - Intergenic
917991493 1:180384556-180384578 TAAATTAGTACAGCCACTATGGG + Intronic
918280209 1:182996894-182996916 TAAATTACTTCAGCCACTATGGG - Intergenic
918537663 1:185591914-185591936 TAAACTAGTTCAACCATTGTGGG + Intergenic
918748221 1:188234353-188234375 TATGTTAGTTTAGCCATTCCAGG + Intergenic
918853983 1:189727115-189727137 TAAATTAGTTCAGCCATTATGGG - Intergenic
918919727 1:190692945-190692967 TAAATTAGTTCAACCATTGTGGG + Intergenic
919006675 1:191908325-191908347 GAAATTAGTTAAGACTTTGCGGG - Intergenic
919140981 1:193571324-193571346 TAAATTAGTTCAACCATTGTGGG - Intergenic
919245128 1:194973003-194973025 TAAATTGATTCAGCCACTGTAGG + Intergenic
919304986 1:195820853-195820875 TAAATTAGTTCAGCTACTAGGGG + Intergenic
920643550 1:207777871-207777893 TAATTTAGTTCCACCATTGTGGG - Intronic
920728214 1:208457424-208457446 TAAATTATTTCAACCATTGTGGG - Intergenic
920892197 1:209999311-209999333 TAAATTAGTACAGCCACTATGGG + Intronic
921029995 1:211328034-211328056 GAAATTAGTTGAACCATTTCTGG + Intronic
921677995 1:217998274-217998296 TAAATTAGTTCAAACATTGTTGG - Intergenic
922069522 1:222177742-222177764 TAAATTATTTCAACCATTTTGGG + Intergenic
922551843 1:226499830-226499852 TAAACTACTTCAACCATTGTGGG - Intergenic
922888513 1:229040925-229040947 CAAATTAGTTCAGCCACTGTAGG + Intergenic
923428875 1:233900758-233900780 TAAATTAATACAGCCATTATGGG + Intergenic
923663689 1:235980260-235980282 TAAATTATTTCAGGTTTTGCAGG + Intronic
923985149 1:239373469-239373491 TAAATTAGTTCAACCATTGTGGG - Intergenic
924283476 1:242461674-242461696 TAAGTTAGTTCAGCCACCGTGGG - Intronic
924850878 1:247829260-247829282 TAAATTAGTACAGCCATAATGGG + Intergenic
924865365 1:247973836-247973858 TAAATTAGTTCAACCATTGTGGG + Intronic
1062958419 10:1555299-1555321 TAAATTCGCTCAGCCACTGTGGG - Intronic
1063092902 10:2883919-2883941 TAAATTAGCTCAACCATTGTGGG + Intergenic
1063207094 10:3843128-3843150 TAAATTAGTACAGCCGTTATGGG - Intergenic
1063727209 10:8650826-8650848 TAAATTATTTAAGCCATTGTGGG + Intergenic
1063852057 10:10203291-10203313 TAAATTGGTACAGCCATTTTGGG - Intergenic
1064437152 10:15320552-15320574 TAAGTTAGTTCAGCCACTATTGG - Intronic
1064618175 10:17185478-17185500 TAAACTAGTTCAACCATTGTGGG + Intronic
1064872263 10:19951559-19951581 TAAGTTAGTTCAGCTATTGTGGG + Intronic
1065622101 10:27592844-27592866 TAAATTAATTCAACCATTGTGGG + Intergenic
1065973861 10:30825696-30825718 TACATTACATCAGCCAGTGCAGG + Intronic
1066162419 10:32747767-32747789 TAAATTAGTTCAGCCACTCTGGG + Intronic
1066314213 10:34227730-34227752 TAAATTATTTCAGCCACTGGTGG + Intronic
1068125660 10:52839286-52839308 TAAATTAGTTCAACCATTGTGGG - Intergenic
1068449750 10:57170860-57170882 TAAATTAGTTTAGTCATTGTGGG + Intergenic
1068494700 10:57772639-57772661 TAAATTAGTTCAGCTACTGTGGG + Intergenic
1068622195 10:59198637-59198659 TAAACTAGTTCAACCATTGTGGG - Intronic
1068622583 10:59203325-59203347 TAAACTAGTTCAACCATTGTGGG + Intronic
1068877652 10:62014187-62014209 TAAATTAGTACAGCCATTATGGG - Intronic
1071216045 10:83402738-83402760 CAAGTTAGTTCAGCCACTGTGGG - Intergenic
1071350153 10:84732628-84732650 TAAAGTAGTTCAACCATTGTGGG + Intergenic
1071380165 10:85051450-85051472 TAAATTAGTTCAACCATTGTGGG + Intergenic
1071408853 10:85366589-85366611 TAAATTAGTTCAAGCATTGTGGG - Intergenic
1071808285 10:89148473-89148495 TAAATTAGTTCAGCAAAAGTGGG - Intergenic
1072154527 10:92712628-92712650 GAAATTAGTTCAGCCGCTGTGGG - Intergenic
1072368679 10:94741869-94741891 AAAAGTAGTTCAACCATTGTAGG - Intronic
1072824671 10:98594887-98594909 TAAATTAGTACAGTCATTATTGG - Intronic
1072839756 10:98758743-98758765 CAAATTAGTTCAGCCATTGTGGG + Intronic
1072992649 10:100212224-100212246 TAAATTATTACAGCTATTGTGGG - Intronic
1073087656 10:100904249-100904271 TACATTAATTCAGCCATTTATGG + Intergenic
1073359981 10:102890392-102890414 TAAATTAGTACAGCCATTATGGG - Intronic
1073624248 10:105080142-105080164 TAAATTAGTTCAGCTGCTGTGGG - Intronic
1073697796 10:105890308-105890330 TAAATTAGTTCAACCATTGTGGG - Intergenic
1074142943 10:110691362-110691384 TAAAATGGTTCAGCCACTGTGGG - Intronic
1074335596 10:112571544-112571566 TAAATTAGTCTAGCCACTGTGGG + Intronic
1075160148 10:120016751-120016773 TAAATTGGTATAGCCATTGTGGG + Intergenic
1075892307 10:125963304-125963326 TAAACTAGTTCAACCATTGTGGG + Intronic
1076448231 10:130533502-130533524 TAAATTAGTTCAGCCATTGTGGG - Intergenic
1077971261 11:7193541-7193563 TAAATTTGTTCAACCATTGTGGG + Intergenic
1078638188 11:13072036-13072058 TAAATTGGTACAGCTATTGTGGG - Intergenic
1078981655 11:16541872-16541894 TAAATTAGTTCAACCATTGTGGG + Intronic
1079152878 11:17916974-17916996 TAAACTAGTACAGCCACTACAGG + Intronic
1079610520 11:22427596-22427618 TAAATTAGTTCAACCATTGTGGG - Intergenic
1079798261 11:24834677-24834699 CAAATTAGTTCAACCATTGTGGG - Intronic
1079878733 11:25895159-25895181 TAGATTAGTACAGCCATTATGGG - Intergenic
1080184861 11:29470431-29470453 TAAATTAGTACAGTCATTTTGGG + Intergenic
1080348900 11:31358992-31359014 TAAACTAGTTCCACCATTGTGGG + Intronic
1080590749 11:33721336-33721358 TAAATCCGTCCAGCCATTCCGGG - Intronic
1080965136 11:37205668-37205690 TCAATTAATTCAACCATTGTGGG - Intergenic
1081124631 11:39307792-39307814 TAAGTTAATTCAACCATTGTGGG - Intergenic
1081142641 11:39521533-39521555 TAAATTAGTTCAAACATTGTGGG + Intergenic
1081177755 11:39949550-39949572 TAAATTATTTCAATCATTGTGGG + Intergenic
1081251852 11:40845763-40845785 TAAATTAGTTCAACCATTGTGGG - Intronic
1081402527 11:42659710-42659732 TAAATTGGTACAGCCATTATGGG - Intergenic
1081425550 11:42922476-42922498 TAAATTAGTTCAACCATTGTGGG - Intergenic
1082560704 11:54617591-54617613 TAAACTAGTTCAACCATTGTGGG + Intergenic
1082664171 11:55952849-55952871 TGAAATAGTTCAGCTATGGCTGG - Intergenic
1083044816 11:59724700-59724722 TAAATTAGTACAACCACTGTGGG + Intronic
1083498994 11:63086093-63086115 TAAATTAGTTCAGCCATTCGTGG + Intronic
1085246520 11:75106248-75106270 TAAATTAGTTTAGCCACTGTGGG + Intronic
1085901648 11:80707417-80707439 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1086189774 11:84065623-84065645 TAAATTAGTTCAGCCATTGTGGG + Intronic
1086283495 11:85218623-85218645 TAAATTAGTCCAACCATTGTGGG + Intronic
1086538173 11:87874854-87874876 TAAATTAATACAACCATTGTGGG + Intergenic
1086659316 11:89395085-89395107 TAAACTAGTTCAACCATTGTGGG - Intronic
1086747221 11:90444129-90444151 TAAATTTGTTAAGCCATTTAAGG - Intergenic
1087113780 11:94500965-94500987 TAAATTCCTAGAGCCATTGCAGG - Intergenic
1087488029 11:98783367-98783389 AAAATTAGTTTATCCATTGATGG - Intergenic
1087503347 11:98988447-98988469 TAAATTAGTACAGCCATTATGGG - Intergenic
1087556023 11:99722039-99722061 TAAATTAGTTCACCCATTGTGGG + Intronic
1088163730 11:106906498-106906520 TAAATTAGTTCAACCATTGTGGG + Intronic
1088382503 11:109210199-109210221 TAAATTAGTATAACCATTACGGG - Intergenic
1088523454 11:110725391-110725413 TAAATTAGTTCAGTCATTGTGGG - Intergenic
1089900508 11:121978156-121978178 TAAACTAGTACAGCCACTGTGGG + Intergenic
1089940168 11:122407880-122407902 TAAATTAGTGCAACCATTTAGGG + Intergenic
1090024090 11:123152955-123152977 TAAAGTGGTTCAGCCACTGGCGG + Intronic
1090518713 11:127456211-127456233 TAAATTAGTACAGCCACTATGGG - Intergenic
1090524442 11:127516165-127516187 TAAATTAGTACAGCCATTATGGG - Intergenic
1090992360 11:131829764-131829786 TAAATTAGTTCAGCCACTGTAGG - Intronic
1092297807 12:7215305-7215327 TAAATCAGTTCAGCCACTGTGGG + Intronic
1092313891 12:7389188-7389210 TAAATTAGTACAACCACTGTGGG - Intronic
1092580956 12:9840857-9840879 TAAATTTGTTCAGCCGTTATGGG + Intronic
1093216873 12:16372584-16372606 TAAATTAGTGCAGCCACTTGTGG + Intronic
1093230446 12:16536976-16536998 AAAATGAGTTCAGCCTTTGGGGG - Intronic
1093303463 12:17480827-17480849 TAAATTAGTACAGGCATTATGGG - Intergenic
1093599800 12:21008233-21008255 TAAATTAGTCCAACCATTGTGGG + Intergenic
1093600383 12:21014474-21014496 TAAATTACTTCAATCATTGTGGG + Intergenic
1094217286 12:27956867-27956889 TAAATTAGATTAGCCACTGTGGG + Intergenic
1094481794 12:30889257-30889279 TAAATTAGTTCAACCATTGTGGG - Intergenic
1094657987 12:32439548-32439570 TAAATTAGTATAGCCATTATGGG - Intronic
1095217245 12:39564210-39564232 TAAACTAGTTTAACCATTGTGGG - Intronic
1095352687 12:41233346-41233368 TAAACTAGTTCAACCATTGTTGG + Intronic
1095920146 12:47521137-47521159 TAAATTAGTTCAACCAAAGATGG - Intergenic
1096016202 12:48277727-48277749 TAAACTAGTTCAACCCTTGTGGG - Intergenic
1096961099 12:55578448-55578470 TAAAGTAGTTCAACCATTGTGGG - Intergenic
1097419338 12:59354650-59354672 TAAATTAGTTCAACCACTGTGGG - Intergenic
1097431340 12:59511667-59511689 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1097459583 12:59844274-59844296 AATAAGAGTTCAGCCATTGCTGG + Intergenic
1097520751 12:60667425-60667447 TCAATTAGTTCAACCATTGTGGG - Intergenic
1097557610 12:61159169-61159191 TAAATTAGTTCTGCCATTGTGGG + Intergenic
1097740019 12:63230901-63230923 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1097749450 12:63336168-63336190 TAAATTAGTTCTACAATTGTGGG + Intergenic
1099307618 12:80977557-80977579 TAAATTAGTTCAAGCATTGTGGG + Intronic
1099559335 12:84153110-84153132 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1099565278 12:84235227-84235249 TAAATTAGTTCCACCATTGTGGG - Intergenic
1099825621 12:87773645-87773667 TAATTTAGTTCAGTCGTTGTGGG - Intergenic
1099853399 12:88133643-88133665 TAAATTAGTTCAACCATTGTGGG - Intronic
1099881945 12:88477783-88477805 TGAATTAGTTCAGTCATTGTGGG + Intergenic
1099927371 12:89034093-89034115 TAAATTAGTTCAACCATTGTGGG + Intergenic
1101117448 12:101546055-101546077 TAAATTAGTAAAACCATTACGGG + Intergenic
1102392741 12:112562714-112562736 TAAATTAAATGAGCTATTGCAGG - Intergenic
1103195818 12:119042949-119042971 TAAATTAGTTCCACCATTGTGGG + Intronic
1104403746 12:128499773-128499795 AAAATTTGTTCATCCATTGATGG + Intronic
1105649823 13:22364164-22364186 TAAATTAGTTCAACCATTGTGGG + Intergenic
1105651243 13:22380348-22380370 TAAACTAGTCCAACCATTGTGGG - Intergenic
1105901744 13:24761029-24761051 TAAATTAGTACAGCCATTATGGG + Intergenic
1107074597 13:36309326-36309348 TAAACTAGTTCAGCCACTTTTGG + Intronic
1108138455 13:47391865-47391887 TAAATTAGTACAGCCACTATGGG + Intergenic
1108143574 13:47452498-47452520 TAAATTAGTTCAACCATTGTGGG + Intergenic
1108545846 13:51492392-51492414 TAAATTAGTTCAACCTTTGCAGG - Intergenic
1108891999 13:55273112-55273134 TAAACTAGTTCAACCATTGTGGG - Intergenic
1109020177 13:57080913-57080935 TAAATTAGTTCAACCATTGTGGG - Intergenic
1109085246 13:57963000-57963022 TAAATTAATTCAACAATTGTGGG + Intergenic
1109393568 13:61725006-61725028 GAAATGAGTTCAGACATTGGGGG - Intergenic
1109402305 13:61850073-61850095 TAAATTAATTCAGCTGTTGAAGG - Intergenic
1109450482 13:62507581-62507603 TAAATTAATCCAGCCACTGTGGG - Intergenic
1109593054 13:64512513-64512535 TAAATTAGCTCAACCATTGTGGG - Intergenic
1109652381 13:65346294-65346316 TAAATTAGTTCAGCCACTATGGG + Intergenic
1110460781 13:75743267-75743289 TAAATTAGTTCAACCAGTGTGGG + Intronic
1110507545 13:76305646-76305668 TAAATTAGTTCAACCATAGTGGG + Intergenic
1110715911 13:78704021-78704043 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1111019167 13:82424028-82424050 TAAATCAGTTCAGCCATTGTGGG - Intergenic
1111038189 13:82706625-82706647 TAAATTAGGTCAACCATTGTGGG - Intergenic
1111084215 13:83352568-83352590 TAAATTAGTTGAATCATTGTGGG + Intergenic
1111144429 13:84161817-84161839 TAAATTAGTTCAACCATTGTGGG - Intergenic
1111219739 13:85188748-85188770 TAAATTAGTTCAACCACTGTGGG + Intergenic
1111326614 13:86705486-86705508 TAAATGAATTCAGCAATTTCAGG + Intergenic
1111981082 13:95016208-95016230 AAAATTATTTCATCCATTGATGG + Intergenic
1112277006 13:98030377-98030399 TAAATTAGTATGGCCAGTGCTGG + Intergenic
1113137408 13:107108007-107108029 TAAACTAGTACAGCCACTGTAGG - Intergenic
1113283648 13:108820140-108820162 CAAATTATTTCAGCCCTTTCTGG - Intronic
1113308159 13:109100933-109100955 TAAATGAGCTGAGTCATTGCAGG + Intronic
1114009596 14:18353131-18353153 TAAACTAGTTCAACCATTGTGGG + Intergenic
1114127950 14:19752579-19752601 TAAATTAGTTCAGCCCCTGTGGG + Intronic
1114959853 14:27872243-27872265 TAAAATAGTTCAATCATTGTGGG - Intergenic
1115008908 14:28520976-28520998 TAAATTAATACAGCCATTATGGG - Intergenic
1116148309 14:41103461-41103483 TAACTTAGTTCAGCCACTGTGGG - Intergenic
1116177639 14:41493164-41493186 TAAATTAGTACAGCCTCTACGGG + Intergenic
1116190522 14:41659634-41659656 TAAGTTAGTTCAAACATTGTGGG - Intronic
1116343486 14:43756813-43756835 TAAATTACCTCAACCATTGTGGG + Intergenic
1116346446 14:43801339-43801361 TAAATTAGTACAGCCACTATGGG + Intergenic
1116377215 14:44218167-44218189 TAAATTAGTTCAGCCAGTGTGGG + Intergenic
1117489679 14:56234159-56234181 TAAACTAGTTCAACCATTGTGGG + Intronic
1117646416 14:57858088-57858110 TAAACTAGTTCAACCATTGTGGG + Intronic
1118793133 14:69114138-69114160 TAAGTTAGTACAGCCTTTGGTGG + Intronic
1119594419 14:75920807-75920829 TAAATTAGTTCAACCATTCAAGG - Intronic
1120408169 14:84115612-84115634 TAAACTAGTTCAACCATTGTGGG - Intergenic
1120512828 14:85436280-85436302 TAGATTAGTTCAATCATTGTAGG - Intergenic
1120717856 14:87859567-87859589 TAAATTGGTTCAACCATTGTGGG + Intronic
1121775563 14:96588287-96588309 TAAATTGCTTCAGGCATGGCTGG - Intergenic
1122379545 14:101292314-101292336 TAAATTAATTCAGCCACTTTGGG - Intergenic
1123157210 14:106239524-106239546 TAAATTAGTACAGCCATCATGGG - Intergenic
1123188458 14:106543473-106543495 TAAATTAGTGCAGCCATCAAGGG - Intergenic
1123400941 15:19985798-19985820 TAAATTAGTTCAACCATTGTGGG + Intergenic
1123575132 15:21658166-21658188 TAAATTAGTTCAGCCATTATGGG - Intergenic
1123607522 15:22049386-22049408 TAAATTAGTTCAGCCTCTGTGGG + Intergenic
1123611748 15:22100655-22100677 TAAATTAGTTCAGCCATTATGGG - Intergenic
1125272830 15:37958677-37958699 TAAATTATTTCAACCATTGTGGG + Intronic
1125987444 15:44068148-44068170 TAAAATGGTTCAGCCATTTTGGG + Intronic
1126520423 15:49586937-49586959 TAAATTAGTTCAGCCACTGTGGG + Intronic
1126986606 15:54318309-54318331 TAAATTAGTACAGCCATTAAGGG - Intronic
1127231150 15:56997031-56997053 TAAATTATTTCAGCCATTGTGGG + Intronic
1127341126 15:58045302-58045324 TAAATTAGTTCAACCACTGTGGG + Intronic
1127759556 15:62125017-62125039 TAAATTTGTTTAGCCATTTCTGG - Intergenic
1128745739 15:70112990-70113012 TAAACTAGTTCAACCATTGTGGG - Intergenic
1129106333 15:73309996-73310018 TAGATTAGTTCAAGCAATGCTGG - Intergenic
1129979640 15:79856100-79856122 TAAATTAGTTCAGCCATTGTGGG - Intronic
1130177240 15:81586394-81586416 TAAATTAGTTCAACCATTGTGGG + Intergenic
1131453266 15:92563620-92563642 TTAATTGGGTCAGCCACTGCTGG + Intergenic
1131615814 15:94016397-94016419 TGAATTAGTTCAACCATTGTGGG + Intergenic
1132007653 15:98243989-98244011 ACAATTAGTTCAGCCACTGTGGG - Intergenic
1202979757 15_KI270727v1_random:341165-341187 TAAATTAGTTCAGCCTCTGTGGG + Intergenic
1202984000 15_KI270727v1_random:392410-392432 TAAATTAGTTCAGCCATTATGGG - Intergenic
1132661768 16:1064766-1064788 TGAAATAGTTCAGCCGGTGCAGG - Intergenic
1133458441 16:5964303-5964325 TAAATTGGTACAGCCATTATGGG + Intergenic
1134294016 16:12929197-12929219 TAAATTAGTTCAACCATTGTGGG + Intronic
1134907054 16:17988880-17988902 TAAATTAAATTAACCATTGCTGG - Intergenic
1135613315 16:23887780-23887802 TAAATTAGTTCAGCCCCTCTGGG - Intronic
1136772336 16:32852075-32852097 TAAATTACTTCAACCATTGTGGG + Intergenic
1136898277 16:34009442-34009464 TAAATTACTTCAACCATTGTGGG - Intergenic
1137318464 16:47352616-47352638 TAAACTAGTTCAACCATTGTGGG + Intronic
1138436394 16:57002977-57002999 TAAATTAGTACAGCCACTACAGG - Intronic
1138780072 16:59773449-59773471 TAAATTGGTACAGCCATTACAGG - Intergenic
1138899839 16:61255621-61255643 TAACTTAGAACAGCCATTGTTGG + Intergenic
1139113698 16:63923450-63923472 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1139173081 16:64654415-64654437 TAAATTGGTTCAGCCACAGTGGG + Intergenic
1140027640 16:71305064-71305086 TAAACTAGTTCAACCATTGTGGG - Intergenic
1140856543 16:78982848-78982870 GAAATTAGTTTAGCCATCACAGG - Intronic
1141080906 16:81051603-81051625 GAAATTAGTTCAGCCCCTGTGGG + Intergenic
1203074759 16_KI270728v1_random:1114173-1114195 TAAATTACTTCAACCATTGTGGG + Intergenic
1142927632 17:3254940-3254962 TAAATTAGTTCAACCATTGTAGG + Intergenic
1144183455 17:12773919-12773941 TACATTAGTTCAGCCACTGTGGG + Intergenic
1145188609 17:20818657-20818679 TAAATTAGATAAACCATTGTTGG + Intergenic
1146834731 17:36101257-36101279 TAAATTAGTTCAGCCATTGTGGG - Intergenic
1146849338 17:36208439-36208461 TAAATTAGTTCAGCCATTGTGGG - Intronic
1149090411 17:52771582-52771604 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1150078277 17:62213035-62213057 TAAATTAGATCAACCATTGCTGG - Intergenic
1150317682 17:64183369-64183391 TAAAATAGTCCAGCCACTGTGGG - Intronic
1150347204 17:64413471-64413493 TAATTTAGTTAAGTCATTCCAGG + Intronic
1152975530 18:214024-214046 TAAATTATTTCAGGCTTTGCAGG + Exonic
1153870419 18:9314284-9314306 TAAATTAGTTCAACCATTGTGGG + Intergenic
1155047947 18:22119801-22119823 TAAATTAGTACAGCCTTTATGGG - Intergenic
1156207334 18:34900323-34900345 TAAACTAGTTCAACCATTGTGGG + Intergenic
1156382287 18:36574227-36574249 TAAATAACTTCATGCATTGCTGG - Intronic
1156457983 18:37305412-37305434 TAATTTAGGTCAGCAAGTGCCGG + Intronic
1156845543 18:41661751-41661773 TTACTAAGTTCAGCCATTGATGG + Intergenic
1156931779 18:42653636-42653658 TAAATTAGTTTAGCCATTGTGGG + Intergenic
1156978846 18:43261157-43261179 TAAATTAGTTCAACCATTGTGGG - Intergenic
1157795993 18:50576049-50576071 TAAATTAGTTCAGCCATTGTGGG + Intronic
1158334560 18:56401904-56401926 TAAATAAGTACAGGCATTGGAGG + Intergenic
1159020621 18:63140205-63140227 TAAACTGGTGCAGCCATTGTGGG + Intronic
1159339969 18:67122016-67122038 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1159485144 18:69046183-69046205 TAAATTAGTTCAGCCATTCTGGG - Intronic
1163069275 19:14824806-14824828 TAAATTAGTCCAGCCACTGTGGG - Intronic
1163181078 19:15602599-15602621 TAAATTAGTTCAGGCATTGTGGG - Intergenic
1164600280 19:29558268-29558290 TAAATTAGTTCAACCATTTTGGG + Intronic
1165548720 19:36564654-36564676 TAAATTAGTTTAGCCACTGTGGG + Intronic
1165560984 19:36679406-36679428 TAAATTACTACAGCCATTTTGGG + Intergenic
1166335103 19:42101198-42101220 TAAATTAGTACAACCACTCCGGG + Intronic
1167202317 19:48074566-48074588 TAAATTAGTTCAACCATTGTAGG - Intronic
1167404743 19:49298611-49298633 TAAATTAGTTCAGCCACTGTGGG + Intronic
924966590 2:81996-82018 TAAAATAGATCACCCCTTGCAGG - Intergenic
925151201 2:1616553-1616575 GAAATTAGTCCAGCCACTGTGGG + Intergenic
925647408 2:6050703-6050725 TAAATTAGTTCAACTATTCTGGG + Intergenic
926347424 2:11960881-11960903 TACATTAGTTTAACCATTGTGGG + Intergenic
926432329 2:12800933-12800955 TACATTAGTTCAACCATTGTGGG + Intergenic
926871074 2:17417853-17417875 TAAATTAGTGTAGCCATTATGGG + Intergenic
927344403 2:22020687-22020709 TAACTTCATTCAGCCACTGCTGG - Intergenic
928061547 2:28118303-28118325 TAAATTAGTTCAACCATTGTGGG - Intronic
928271880 2:29863682-29863704 TAGATTAGTACAGCCATTTATGG + Intronic
928572827 2:32626333-32626355 CAAATTAGTTTAGACAGTGCTGG + Intergenic
928710025 2:33993895-33993917 TAAATTAGTTCAACCATAGTAGG + Intergenic
928823247 2:35388743-35388765 TAAATTATTTCAGAAATTGGGGG - Intergenic
929337642 2:40769681-40769703 TAATTTAGTGCAGCCATTTTGGG - Intergenic
929341577 2:40825308-40825330 AAAATTATTTCAGTCATTGCAGG + Intergenic
929373478 2:41255548-41255570 TAAAGTAGTTCAGCCACTGTGGG + Intergenic
930148493 2:48032606-48032628 TAAATTAGTTCAACCATTGTGGG - Intergenic
930638853 2:53834893-53834915 TAAACTAGTACAGCCATTATGGG + Intergenic
930947950 2:57098562-57098584 TAAATTAGTACAACCATTGGGGG - Intergenic
931051568 2:58421083-58421105 TAATTTAGTTCAGCCATGCCTGG - Intergenic
931362947 2:61594045-61594067 TAAATTAGTTCAACCATTGTGGG + Intergenic
931539017 2:63308301-63308323 CAAATTAGTTCAACCATTGTGGG + Intronic
931553121 2:63469254-63469276 TAAATTAGTTCAACCACTTGGGG + Intronic
932033441 2:68214688-68214710 TAAATTAGTTCAGCCGTTGTGGG + Intronic
933192574 2:79352007-79352029 CAAATTAGTTCAGCCACTGTGGG - Intronic
933360073 2:81270697-81270719 CAAATTAGTTCAACCATTGTGGG + Intergenic
933401722 2:81806975-81806997 TAAATTAGTTCAGCCATTTGTGG - Intergenic
933421295 2:82048624-82048646 TAAATTAGTACAGGCATTATGGG + Intergenic
933476300 2:82795615-82795637 TGAAATAGTTCAGCCATTGAAGG + Intergenic
933521810 2:83383359-83383381 TAAATTAGTTCAGCCAGTGTGGG + Intergenic
933679502 2:85087293-85087315 TAAATTAGTTCAACCATTGTGGG - Intergenic
934897488 2:98131532-98131554 TAAATTAGTACAGCCATTATAGG - Intronic
935004202 2:99054916-99054938 TAAATTAGTATAGCCATTATGGG + Intronic
935995175 2:108763551-108763573 TAATTTTGTTCAGCCCATGCCGG + Exonic
936785475 2:116089317-116089339 TGAATTAGTACAGCCACTGTGGG - Intergenic
936988531 2:118336147-118336169 TAAATTAGTGTAGCCATTATGGG - Intergenic
937754872 2:125525053-125525075 TAAAATAGTACAGCCATGTCTGG + Intergenic
938303955 2:130237493-130237515 TAAACTAGTTCAACCATTAGTGG + Intergenic
938800461 2:134758910-134758932 TAAATCAGTACAGCCACTACGGG + Intergenic
938843566 2:135185568-135185590 TAAATTAGTTCAGCCACTTTGGG - Intronic
939125264 2:138170711-138170733 TAAATCAGTTCAGCCACTGTGGG + Intergenic
939308907 2:140447217-140447239 TAAATTAGTACAGCTATTTTGGG + Intronic
939526750 2:143304884-143304906 TAAATTAGTTCAACCATTGTGGG + Intronic
939700931 2:145389543-145389565 TAAATTAGTTCAACTGTTGTGGG - Intergenic
940542468 2:155038840-155038862 TAAATTAGTACAACCATTATGGG + Intergenic
940669164 2:156646488-156646510 TAAATTAGCACAGCCATTATGGG + Intergenic
941278659 2:163522494-163522516 TAAATTAGGTCAACTATTGTGGG - Intergenic
941483145 2:166043635-166043657 TTAAATAGTTCAGGCATGGCTGG - Intronic
942406017 2:175656095-175656117 TAAATTGGTTTAACCATTGTGGG + Intergenic
943391441 2:187274191-187274213 TAAATTATTTCAGCCATCATGGG - Intergenic
943476104 2:188357605-188357627 TAAATTAGCACAGCTATTACAGG + Intronic
943963443 2:194298420-194298442 TAAATTAGTTCAACTATTGTGGG - Intergenic
944102407 2:196042121-196042143 TAAATTAGTACAGCCAATATAGG + Intronic
944185750 2:196946052-196946074 TAAATTAGTTCAACCATTGTGGG - Intergenic
945630925 2:212275355-212275377 TAAATGAGTTCAACCATTGTGGG - Intronic
945658473 2:212654825-212654847 TAAACTAGTTCAGCCACTATGGG - Intergenic
945690134 2:213023796-213023818 TAAACTACTTCAGTCATTTCCGG + Intronic
946064766 2:216976995-216977017 TAAATTAGTTCAACCATTGTGGG - Intergenic
946136761 2:217653908-217653930 TAAATCAGTTCAGCTATGTCTGG - Intronic
946530126 2:220561775-220561797 TAAATTAGTTCAACCATTGTGGG + Intergenic
947053251 2:226071174-226071196 GAAAGTAGTTCAGACATTGTGGG - Intergenic
947259754 2:228207719-228207741 TAAATTATTTTACACATTGCAGG - Intergenic
947320259 2:228909260-228909282 TAAATTAGATCAACCATTGTGGG - Intronic
949081831 2:242107087-242107109 TAAATCAGTCCAGCCATTGTGGG - Intergenic
1168994069 20:2119581-2119603 TAAATTACTTAATCCCTTGCAGG - Intronic
1169360284 20:4942867-4942889 TTAATTCATTCAGCCATTGGAGG - Intronic
1169418511 20:5439186-5439208 TAAATTAGTTCAACCATTGTGGG - Intergenic
1170486908 20:16827193-16827215 TAAATTAGTTCAGCCACTATGGG + Intergenic
1171130717 20:22650448-22650470 AAAATTAGTTCAGCCACTGTGGG - Intergenic
1171167855 20:22988174-22988196 TAAACTAGTTCAACCATTGTGGG - Intergenic
1171176680 20:23055829-23055851 TAAAGGAGTTCAGCAGTTGCAGG + Intergenic
1172930567 20:38583558-38583580 GAAAATAGTCCAGCCAATGCTGG + Intronic
1172983566 20:38963709-38963731 TTATTTAGTTCATCCATTGAGGG + Intronic
1173400978 20:42725725-42725747 TAAATTAGTTCAACCATTGTGGG + Intronic
1174205758 20:48837229-48837251 TAAATTAGTTTAACCACTGTGGG + Intergenic
1174788560 20:53456143-53456165 TAAACTAGTTCAACCATTGTGGG - Intronic
1174939616 20:54910946-54910968 TAAATTACTACAGCCATTATGGG - Intergenic
1175004099 20:55663958-55663980 TAAATTAGTTTAGCCACTGTGGG + Intergenic
1175017489 20:55807477-55807499 TAAACTAGTTCAACCATTGTGGG - Intergenic
1175513339 20:59550684-59550706 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1175701219 20:61138576-61138598 GCAGTTAGGTCAGCCATTGCTGG - Intergenic
1176961885 21:15168335-15168357 TAAATTAGTTCAACCATTGCGGG + Intergenic
1176994620 21:15541141-15541163 TAAATTAGTTCAACCATTGTGGG + Intergenic
1177618845 21:23560590-23560612 TAAATTAGTTCAACCATTGTGGG - Intergenic
1177734844 21:25076147-25076169 TAAATCAGCTCAGCCATTGTGGG + Intergenic
1178017606 21:28367972-28367994 TAAATTAGTACAACCACTACTGG - Intergenic
1178140976 21:29683187-29683209 TAAATTAGTTCAGCCACTGTGGG + Intronic
1179936271 21:44606429-44606451 TAAATTAGTACAACCACTACGGG + Intronic
1180434097 22:15283940-15283962 TAAACTAGTTCAACCATTGTGGG + Intergenic
1181445723 22:22972550-22972572 TAAATTAGTTCAACCATTGTGGG + Intergenic
1183000435 22:34853200-34853222 TAAATTAGTACAGTCTTTGAGGG + Intergenic
1183609408 22:38888489-38888511 TAAATTGGTACAGCCATTATAGG + Intergenic
1184401616 22:44277782-44277804 ACAATTAGCACAGCCATTGCAGG + Intronic
949225366 3:1687187-1687209 TAAACTAGTTCAACCATTTGTGG + Intergenic
949629541 3:5908596-5908618 TAAATTAATTCAGCCACTGTGGG - Intergenic
949659329 3:6259557-6259579 CAAATTAGTTCAGCCACTGTGGG - Intergenic
949729701 3:7094316-7094338 TAAATGAGTTCATGCATTCCAGG + Intronic
951098685 3:18661470-18661492 TAAATTAGTTCAGCCATTGTGGG - Intergenic
951687108 3:25357097-25357119 TAAATTAGTTCAACCATTGTGGG - Intronic
952093110 3:29915197-29915219 TAGATTATTTCAGGCTTTGCTGG + Intronic
952179091 3:30898838-30898860 TAAATTTGTTCAACATTTGCTGG + Intergenic
952511453 3:34060898-34060920 TAAATTTGTTCAACCATTGTGGG + Intergenic
952597230 3:35032629-35032651 TAAACTAGTTCAACCCTTGTGGG - Intergenic
953184188 3:40622896-40622918 TAAATTAGTTCAACCATTGATGG - Intergenic
954470867 3:50693908-50693930 TAAATGAATTCAGCAGTTGCAGG - Intronic
954653603 3:52180139-52180161 TAAATTAGTTCAGCCATTGTGGG - Intergenic
955121701 3:56066129-56066151 TAAATTAGTTCAACCACTGTGGG - Intronic
955659690 3:61284363-61284385 TAAATGAGTTAAGACATTTCGGG + Intergenic
956188979 3:66590311-66590333 TAAATTAGTACAGCCATTATGGG - Intergenic
956356202 3:68395349-68395371 TAAATTAGTTCAACCATTGTGGG + Intronic
956570724 3:70691331-70691353 TAAATTAGTTCAACTATTTGTGG - Intergenic
956656827 3:71560461-71560483 TAAAATAGTTCAGCCACTTTGGG + Intronic
956843699 3:73162897-73162919 TAAACTGGTGCAGCCACTGCAGG - Intergenic
957135931 3:76289078-76289100 TAAATTAATCCAGCCAGTGTGGG - Intronic
957170846 3:76734990-76735012 TAAATTAGTTAAACCACTGTAGG + Intronic
957279838 3:78136425-78136447 TAAAACAGTGCAGCCATTGTGGG - Intergenic
957489925 3:80910533-80910555 TAAATTAGTTCAACCATTGTGGG + Intergenic
957590397 3:82189696-82189718 TAAAATAGAGCAGCCATTTCTGG + Intergenic
958503245 3:94941489-94941511 TAAATTAGTTCAACCATTGTGGG - Intergenic
959097823 3:101974874-101974896 TAAATTAGTTCAACCATTGCGGG + Intergenic
959241800 3:103806496-103806518 TAAATTAGTTCAGACACTATGGG - Intergenic
959481465 3:106877678-106877700 TAAATTAGTTCAGCCACTGTGGG - Intergenic
959767968 3:110055972-110055994 TAAATTGGTACAGCCATTATGGG + Intergenic
960977731 3:123192064-123192086 CAAATTAATTCAGCCATTCTAGG - Intronic
961910579 3:130312180-130312202 TAAATTAGTTCAGCCATTGTGGG + Intergenic
962361677 3:134748349-134748371 TAAATTAGTACAACAATTCCTGG + Intronic
962911063 3:139850118-139850140 TAAATTAATTCAGCCTTTATGGG - Intergenic
963053444 3:141162515-141162537 TAAATTAGTTTAACCATTAGGGG + Intergenic
963393258 3:144696990-144697012 TAAATTAGTTCAGCCACTGTGGG - Intergenic
963464580 3:145663348-145663370 TAAATTAGTTCAACCACTATAGG - Intergenic
963579807 3:147111091-147111113 TAAATTAGTTCAACCATTGTGGG - Intergenic
964008940 3:151866269-151866291 TAAATTAGTTCAACCATTGTGGG - Intergenic
964242384 3:154611674-154611696 TAAATCAGTTCAGCCTCTGTGGG - Intergenic
964678303 3:159308570-159308592 TAAATTAGTTTAGCCACTGTGGG + Intronic
965084585 3:164078575-164078597 TAAATGAGTTCAGCCATTGTGGG + Intergenic
965116510 3:164496438-164496460 TAAACTAGTTCAACCACTGTGGG - Intergenic
965174220 3:165309850-165309872 TAAATTAGTACAGCCACTATGGG + Intergenic
965500125 3:169446099-169446121 GAAATTAGTTAAGACATTGGGGG + Intronic
966166158 3:177018677-177018699 TAAAATATTTCAACCATTTCAGG + Intergenic
966339701 3:178912077-178912099 TAAATTTTTTCAGTCATTGTGGG + Intergenic
966543979 3:181123678-181123700 AAAATTAGTTCAGCCACTGTGGG - Intergenic
967443506 3:189537258-189537280 TAAATTAGTTCAGCAACTGTAGG - Intergenic
967670822 3:192233136-192233158 TAAAGTAGTTCACCCATTGTGGG - Intronic
967737314 3:192966421-192966443 TAAACTAGTTCAACCATTGTGGG - Intergenic
967968349 3:194981263-194981285 TAAATTAGCACAGCCATTTGGGG + Intergenic
967974412 3:195024937-195024959 TAAATTAGTACAGCCATTATGGG - Intergenic
969120170 4:4902720-4902742 TTAATTAGTACAGCCATTAAAGG - Intergenic
969120495 4:4905708-4905730 TAAATTAGTACAGCCACTGTGGG - Intergenic
969144588 4:5111170-5111192 CAAATTAGTTCAGCCCTTATGGG + Intronic
969190029 4:5510715-5510737 TAAATTAGTACATCCACTGTGGG + Intergenic
970185160 4:13444589-13444611 TAAATTAGTACAGCCATTATGGG - Intronic
970555218 4:17225158-17225180 TAAATTAGTTCAACCATTGTGGG - Intergenic
970631652 4:17953329-17953351 TAAGTTAGCTCAGGCATTGTGGG - Intronic
970668916 4:18373405-18373427 TAAATTAGTTCAGCCACTGTGGG + Intergenic
970673756 4:18424604-18424626 TAAATTAGTTCAGCCACTGTGGG + Intergenic
970731272 4:19106655-19106677 TACATTATTTCAGACATTTCAGG + Intergenic
970797496 4:19931011-19931033 TAAATTAGTTCAGCCACTGTGGG + Intergenic
971023486 4:22564128-22564150 TAAATTAGTTCAACCATTGTGGG + Intergenic
971570030 4:28199557-28199579 TAAATTAGAACAGGCATTGCAGG - Intergenic
971661218 4:29418421-29418443 TAAATTAGGTCATCCATCCCTGG - Intergenic
972183612 4:36500436-36500458 TAAATTAGTCCAGCCATTATGGG - Intergenic
972214915 4:36886213-36886235 TAAATTAGTTCAGCCTCTATGGG - Intergenic
972681925 4:41314631-41314653 TAAATTAGTTAAACCATTGTGGG + Intergenic
972934050 4:44109500-44109522 TAAATTAATACAGCCACTGTGGG - Intergenic
973075686 4:45923049-45923071 TAAATTAATTTTGTCATTGCAGG - Intergenic
973117380 4:46478151-46478173 TAAATTAGTTCAACCATTGGGGG + Intergenic
973529708 4:51823675-51823697 TAAAATGGTTCAGCCACTGTGGG - Intergenic
973776698 4:54249141-54249163 TAAACTAGTTCAACCCTTGTGGG + Intronic
974216645 4:58855831-58855853 TAAATTAATTCAACCATTGTGGG - Intergenic
974330166 4:60467834-60467856 TAAACTAGTTCAACCATTGTGGG + Intergenic
974528322 4:63075119-63075141 TAAACTAGTTCAATCATTGTGGG - Intergenic
974942029 4:68481387-68481409 TAAATTAGGTCAGCCACTGTGGG - Intronic
975296090 4:72736146-72736168 TAAACTAGTTCCACCATTGTGGG + Intergenic
975739534 4:77415758-77415780 TAAATTAGTTCAGACACTAAGGG - Intronic
977051646 4:92135722-92135744 TAAATTAGTACAGCCATTATGGG + Intergenic
977226884 4:94402895-94402917 TAGATTAGTTCAACCATTGTAGG - Intergenic
977438774 4:97036422-97036444 TAAATTAGTTCAACCATTGTGGG - Intergenic
977513980 4:97996995-97997017 TAAATTAGTTCAGCCATTGCTGG + Intronic
977515048 4:98011543-98011565 TAAATTAGTTTAACCATTGTGGG - Intronic
977774938 4:100905988-100906010 TAAATTAGTTCAACCATGGTGGG + Intergenic
978305330 4:107322261-107322283 CAAATGAGTTCAACCATTGTGGG - Intergenic
978435348 4:108678067-108678089 TAAAATAGTGCAGACAGTGCTGG - Intergenic
978491043 4:109312733-109312755 TAAATTAGTTCAACCATTGTGGG - Intergenic
978605547 4:110475665-110475687 TAAATCAGTTCAGCTGGTGCTGG - Intronic
978657349 4:111080101-111080123 TAAATTAGTTCAACCATTGTGGG + Intergenic
978679691 4:111364937-111364959 TAAATTAGTTCAGCCACACTGGG + Intergenic
978695362 4:111570645-111570667 TAAACTAGTTCAACTATTGTGGG + Intergenic
979506563 4:121503699-121503721 TAAATTAGTACAACCATTATGGG - Intergenic
979605845 4:122637954-122637976 TAAATTAGTTCAGCCACTGTGGG + Intergenic
979644107 4:123047181-123047203 TAAATTAGTATAGCCATTTACGG - Intronic
979923855 4:126535305-126535327 TAAATTAGTACAGCCACTCTGGG + Intergenic
979950962 4:126892936-126892958 TAAATTAGTTCAGCCACTGTGGG - Intergenic
980096646 4:128498307-128498329 TAAATTAGTACAGCCATTATGGG - Intergenic
980593525 4:134923600-134923622 TAAATTAGTTCAACCATCCTGGG - Intergenic
980744204 4:136994097-136994119 TAAATTAGTTCAACCACTGTGGG - Intergenic
981256718 4:142669893-142669915 TAAATTAGTACAGCCTTTACTGG + Intronic
981406151 4:144371949-144371971 TAAATTAGGTCAGCTCTTGCAGG + Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
981589924 4:146349416-146349438 TAAATTATTTCAGCCACTGTGGG + Intronic
981664774 4:147211649-147211671 TAAATTAGTTAAACCATTGTGGG - Intergenic
982192257 4:152867888-152867910 TAAATTAGTTAAGCATTTGTTGG + Intronic
982373661 4:154662671-154662693 TAAACTAGTTCAACCATTGTGGG + Intronic
982600070 4:157437930-157437952 TAAATTAATTCAACCATTGTGGG + Intergenic
982613238 4:157604978-157605000 TAAATTAGTTCAGCCACTGTGGG + Intergenic
983001753 4:162423273-162423295 TAAATTAGTTCAGCCACTGTGGG - Intergenic
984071370 4:175117555-175117577 TAAATGAGTTCAGCCACTGTGGG + Intergenic
984106758 4:175557528-175557550 TAAATTGGTGCAGCCATTATGGG - Intergenic
984306130 4:177994195-177994217 CAAATTAATTCAGCCATTATGGG + Intergenic
984336161 4:178393971-178393993 TAAATTAGTTCAACCATTGTGGG - Intergenic
985180252 4:187252893-187252915 TAAGTTAGTTCAGCCATTGTGGG + Intergenic
985206715 4:187546025-187546047 CATAAGAGTTCAGCCATTGCAGG - Intergenic
986404172 5:7408787-7408809 TAAATTAGTTCAGGCATTGTGGG + Intronic
987468535 5:18301900-18301922 CAAATTAATTCAGCCACTGTGGG - Intergenic
988005755 5:25408129-25408151 TAAATAAGTTCAACCATTGTGGG - Intergenic
988091955 5:26554562-26554584 TGAATTAGTTTAGCCATTGTGGG + Intergenic
988206249 5:28139433-28139455 TGAATTAATACAGTCATTGCTGG + Intergenic
988218396 5:28307630-28307652 TAAATTAGTTCAGACACTCTGGG + Intergenic
988362194 5:30250928-30250950 TAAATTAGTTCACCCACTGTGGG - Intergenic
988614048 5:32756185-32756207 TAAACTAGTTCAACCATTCGTGG - Intronic
989126984 5:38064331-38064353 TAAATTAGTTCAACCATTGTGGG - Intergenic
989422112 5:41252340-41252362 AAAATTAGTTCAGGCCTTGTTGG + Intronic
989509205 5:42264420-42264442 TCAATTAGTTCAACCATTGTGGG - Intergenic
989745547 5:44825089-44825111 TAAACTAGTTCAACCATTGTAGG - Intergenic
989772026 5:45156448-45156470 TAAATTCATTCAACCATTGTGGG + Intergenic
989788146 5:45356980-45357002 TAAATGTGATCAGCAATTGCAGG - Intronic
990252622 5:53932045-53932067 GAAATTAGTTCACACTTTGCTGG + Intronic
990361100 5:55020821-55020843 CAAATTAGCTAAGCCATTACTGG + Intronic
990534887 5:56711490-56711512 TAATTCAGTTCAGCCACTGTGGG + Intergenic
990656454 5:57962181-57962203 TAAATTAGTTCAACCATTGTGGG + Intergenic
990826585 5:59906787-59906809 TAAATTAGTTCAACCATTGTAGG + Intronic
990867600 5:60397200-60397222 TAAATTAGTGCAGCCATTATGGG + Intronic
991002184 5:61793514-61793536 TAGATTAGTTCAACCACTGTGGG - Intergenic
991214157 5:64142659-64142681 TAAACTAGTACAGCCACTGTGGG + Intergenic
991524493 5:67541356-67541378 TAAACTAGTTCAACCATTGTGGG + Intergenic
991540526 5:67722712-67722734 TAAACTAGTTCAACCATTGTGGG - Intergenic
991651091 5:68854473-68854495 TAAATTAGTTCAACCATTGTGGG - Intergenic
993006885 5:82438045-82438067 TAAATTAGTTCAACCATTGTGGG + Intergenic
993208503 5:84918476-84918498 TAAATTAGTTCAGCCATTGTGGG + Intergenic
993211104 5:84952264-84952286 TAAATAAGTTCAGGCAGTGTTGG - Intergenic
993286598 5:86007178-86007200 TAAATTAGTTCAACCATTGCTGG - Intergenic
993553641 5:89307574-89307596 CAAATTAGTTCAATCATTGTGGG - Intergenic
994070395 5:95595241-95595263 TAAATTAGTTCAGCCACTGTGGG + Intronic
994309057 5:98245007-98245029 TAAACTAGTTCAACCATTGTGGG - Intergenic
994309724 5:98254805-98254827 TAAATTAGTTCAGCCACTGTGGG - Intergenic
994409165 5:99384563-99384585 TCAATTAGTTCAATCATTGTGGG + Intergenic
994619029 5:102140847-102140869 TAAATTAGTTCAGCTATTGAGGG - Intergenic
994802372 5:104395557-104395579 TAAATTAGTTCAACCATTGTGGG - Intergenic
995535077 5:113127434-113127456 TAAATGAGTTCAGTCATTGTGGG - Intronic
995682464 5:114735199-114735221 TAAATTACTTCAACCATTGTGGG - Intergenic
995828911 5:116332405-116332427 TAAACTAGTTCAACCATTGTGGG + Intronic
996004152 5:118401033-118401055 TAAATTAGTTCAGCCAACCTGGG - Intergenic
996195099 5:120595506-120595528 TAAATTAGTTCAACCATTGTCGG + Intronic
996204333 5:120712880-120712902 TAAATTGGTACAGCCATTATTGG + Intergenic
996242932 5:121225250-121225272 TAAATTAGTTGAACCATTGTGGG + Intergenic
997057632 5:130463273-130463295 TAAGTTAGTTCAGACACTGTGGG + Intergenic
997707973 5:135976597-135976619 TAAATGAGGTAAGCCATGGCAGG + Intergenic
998294530 5:140954367-140954389 TAAATTAGTTCACTCATTGTGGG - Intronic
998934513 5:147219891-147219913 TAAATTAGTTCAACCATTGTGGG + Intergenic
999034017 5:148327096-148327118 TTAACTAGTTCAACCATTGTGGG - Intronic
999552069 5:152700218-152700240 TAAACTAGTTCAACCATTGTGGG + Intergenic
999981414 5:156961288-156961310 TAAATTACTACAGCCATTATGGG + Intronic
1000091606 5:157934453-157934475 TAAATTAGTGCAGCCATTTTTGG + Intergenic
1000445070 5:161309415-161309437 TAAATTAGTTCAACCATTGTGGG + Intronic
1000447708 5:161344603-161344625 TAAATTAGATTAACCATTGTGGG + Intronic
1000798715 5:165697245-165697267 AAAATTAGTTCAACCATTATGGG + Intergenic
1000958060 5:167565436-167565458 TTAATTCTTTCAGCCAGTGCAGG + Intronic
1000982121 5:167827182-167827204 GAAAAAAGTTCAGCCAATGCCGG - Intronic
1001179150 5:169502417-169502439 TGAAGGAGTTCTGCCATTGCTGG - Intergenic
1001719586 5:173845991-173846013 TAATTTTGTTCAGGCATTGGAGG - Intergenic
1001795611 5:174499626-174499648 AAAATGAGTTAAGACATTGCGGG + Intergenic
1001898944 5:175406602-175406624 TAAATTTGTTCAACCATTGTGGG - Intergenic
1001918053 5:175578016-175578038 TAAATTAGTCCAGCCACTGTGGG + Intergenic
1002080934 5:176737057-176737079 TAAATTAGTTCACACATTCATGG - Intergenic
1003013300 6:2446947-2446969 TTTATTTGTTCATCCATTGCTGG + Intergenic
1003028965 6:2584129-2584151 TAAACTAGTACAGCCACTGTGGG - Intergenic
1003476666 6:6490007-6490029 TAAATTAGTTCAATCATCGTAGG - Intergenic
1003667589 6:8126199-8126221 TAAATTAGTTCAGCCTTTGTGGG + Intergenic
1003700279 6:8456759-8456781 TAGATTAGTTAAACCATTGTGGG - Intergenic
1004037337 6:11936126-11936148 TAAATTAGTTCATTCATGCCTGG - Intergenic
1004784359 6:18950028-18950050 TAAATTAGTGCATCCATTATTGG + Intergenic
1004875651 6:19950514-19950536 TTAATTCATTCATCCATTGCTGG + Intergenic
1004923283 6:20396783-20396805 TAATTTAGTTCAGCCAAATCTGG - Intergenic
1005003527 6:21266011-21266033 TAAATGAGTTCAGCCACTGTGGG + Intergenic
1005552668 6:26939340-26939362 TAAACTAGTTCAACCATTGTGGG - Intergenic
1005873046 6:29991083-29991105 TAAATTAGTGCAGCCATTATGGG + Intergenic
1005942816 6:30573541-30573563 TAAAGAACTTCAGCAATTGCAGG + Intronic
1006203429 6:32317863-32317885 TAAATTAGTTCAACCATTGTGGG + Intronic
1007188109 6:39989887-39989909 TAAATAAGTTCAACCATTGTGGG - Intergenic
1008688539 6:53951327-53951349 TAAATTAGTTCAACCATCATGGG + Intronic
1008719631 6:54333026-54333048 TAAATTAGCTCAACCATTGTGGG + Intronic
1008745237 6:54661794-54661816 TAAATTAGTATAGCCATTATAGG - Intergenic
1009475927 6:64092334-64092356 TAAACTAGTTCAACCATTGTAGG - Intronic
1009771401 6:68146685-68146707 TAAATTAGTTCAGCCATTGTGGG - Intergenic
1010571688 6:77480902-77480924 TAAATTATTTCTGACATAGCTGG - Intergenic
1010805788 6:80234595-80234617 TAAATTAGTACAGCTATTATGGG + Intronic
1011138713 6:84129274-84129296 TAAATTAGTTCAACCACTGTGGG - Intronic
1011313460 6:86005286-86005308 TAAACTAGTTCAACCATTGTGGG - Intergenic
1011568177 6:88703108-88703130 TAAAGTAGCTCAGCCACTGTAGG + Intronic
1011862443 6:91776645-91776667 TAAATTAGTTCAGCCATTATGGG + Intergenic
1012256057 6:97033610-97033632 TAAATTGGTACAGCCATTATGGG - Intronic
1012354978 6:98302871-98302893 TAAATTAGCTCAGCCATTGTGGG - Intergenic
1012402298 6:98851722-98851744 TAAATTAGTACAGCTATTATGGG + Intergenic
1012490191 6:99774499-99774521 TAAATTAGTTCAACCATTGTGGG - Intergenic
1012571739 6:100737811-100737833 TAAATTAGTTTAACCATTGTGGG - Intronic
1012577111 6:100816316-100816338 TAAATTAGTTCAACCATTTGTGG + Intronic
1012636395 6:101547902-101547924 TAAACTAGTTCAACCATTGTGGG - Intronic
1012693410 6:102347317-102347339 TAAATTAGTCAAACCATTGTGGG + Intergenic
1012946909 6:105476120-105476142 TAAATTAGTACAGCCATTTTGGG - Intergenic
1013578906 6:111512527-111512549 GAAAATAGTTCAGTGATTGCTGG + Intergenic
1013670957 6:112401959-112401981 TAAATTAGTTAAACCATTGTGGG - Intergenic
1013675074 6:112450170-112450192 TAAATCAGTTCAACAATTACAGG - Intergenic
1013711756 6:112909254-112909276 TAAACTAGTTCAACCATTGTGGG + Intergenic
1013848743 6:114487387-114487409 TAAATTAGTACAGCCATTATGGG - Intergenic
1014288453 6:119530223-119530245 TAAATTAGTTCAGCCACTGTGGG - Intergenic
1014326964 6:120009620-120009642 TAAATTAGTTCAGCCACTGTTGG + Intergenic
1014770983 6:125457974-125457996 GAAATTAGTTAAGACTTTGCGGG - Intergenic
1014934317 6:127368646-127368668 TAAATTAGTATAGCCATTATGGG - Intergenic
1015076273 6:129162084-129162106 TAAATTAGTTCAGACACTGTGGG - Intronic
1015357728 6:132298829-132298851 TAAATTAGTTCAGCCAACTGTGG + Intronic
1015598034 6:134884694-134884716 TAAAGTAGTACAGCCATTATGGG + Intergenic
1015652724 6:135480664-135480686 TAAATTGGTTAACCCATTGATGG - Intronic
1016154220 6:140783735-140783757 TAAATTAGTTCAACCCTTTTGGG + Intergenic
1016810327 6:148254764-148254786 TAAAATGGTGCAGCCATTTCAGG + Intergenic
1017384230 6:153864318-153864340 GAAATTAGTACAGCCACTACGGG + Intergenic
1018943025 6:168322325-168322347 TAAATTTGTTTACCTATTGCAGG + Intergenic
1018959391 6:168436789-168436811 TAAATTATTTCAGCCACTGTGGG + Intergenic
1019880960 7:3860562-3860584 TAAATTAATACAGCCATTTTTGG + Intronic
1020496495 7:8859442-8859464 TAAACTAGTTCAACCCTTGTGGG + Intergenic
1021160364 7:17265007-17265029 TAAATTGGTACAGCCATTATAGG - Intergenic
1021200550 7:17724203-17724225 TAAATTAGTTTAACCATTGTGGG - Intergenic
1021591274 7:22265660-22265682 TAAATTAGTACAGCCACTATGGG - Intronic
1022448355 7:30489662-30489684 TAAAATGGTTCAGCCAATGTGGG + Intergenic
1022723388 7:32960021-32960043 TAAAATGGTGCAGCCATTGTGGG - Intronic
1022765713 7:33408794-33408816 TAAATTAGTTCATCCACTGTGGG - Intronic
1022897431 7:34765482-34765504 TAAATTAGTTCTTCCACTGTTGG + Intronic
1022899719 7:34793824-34793846 TAAATTCATTCATCCATTGATGG - Intronic
1023099702 7:36703892-36703914 TAAATTAGTACAACCATTGTGGG - Intronic
1023211840 7:37814280-37814302 CAAATTAGTTCAGCCACTGTGGG + Intronic
1024493570 7:50015970-50015992 TAAATTAGTTTAGCCACTGTGGG + Intronic
1024694724 7:51844030-51844052 TAAATTAGTACAACCATTACAGG + Intergenic
1024961816 7:54984570-54984592 TAAATTAGTGCAACCACTACAGG - Intergenic
1025677433 7:63654416-63654438 TAAATTGGTACAGCCATTATGGG + Intergenic
1026167505 7:67923261-67923283 GGAATGCGTTCAGCCATTGCTGG + Intergenic
1026617045 7:71914631-71914653 TAAATTAGTTCAATCATTGTGGG - Intronic
1027646633 7:80809507-80809529 TAAATTAGTACAGCTATTTTGGG - Intronic
1027946981 7:84759340-84759362 TAAATTACTGCAGCCACTGTGGG - Intergenic
1028080146 7:86565636-86565658 TAAGTTAGCTCAACCATTGTGGG - Intergenic
1028083434 7:86605246-86605268 TAAATTAGTTCAACCATTGTGGG + Intergenic
1028300785 7:89197026-89197048 TAAATTAGTTCAACCATTATGGG + Intronic
1028343498 7:89752006-89752028 TAAATTAGTTCAGCCACTGTAGG + Intergenic
1028865639 7:95708348-95708370 TAAATTAGTCCAACCATTGTTGG + Intergenic
1029306167 7:99621648-99621670 TAACTTAGTTGCTCCATTGCTGG - Intronic
1029341688 7:99950218-99950240 TAAATTAGTTCAATCATTGTGGG + Intergenic
1029672541 7:102043783-102043805 TAAATTGGTACAGCCATTATGGG - Intronic
1030133921 7:106227956-106227978 TAAATTAATTCGACCATTGTGGG - Intergenic
1030728314 7:112953204-112953226 TAAATTAGTTCAACCATTGTGGG - Intergenic
1030756836 7:113295779-113295801 TAAATAAATTCAGTAATTGCAGG + Intergenic
1030769423 7:113456164-113456186 TAAAGTAGTACAGCCACTTCAGG + Intergenic
1030990198 7:116290660-116290682 TAAACTAGTTCAACCATTGTGGG - Intronic
1031167585 7:118247971-118247993 TAAATTAGTTCAACCATTGTGGG - Intergenic
1031267405 7:119598771-119598793 TAAATTAGTTCAACCATTGTGGG - Intergenic
1031626750 7:124000979-124001001 AAAATTAGTTCAGACTTTGAGGG - Intergenic
1031663908 7:124461306-124461328 TAAATTAGTTCAACCATTGTGGG - Intergenic
1031868388 7:127064923-127064945 CAAATTAGTTCAACCATTGTGGG + Intronic
1031950797 7:127890111-127890133 TAAATTAGTACAACCACTACGGG - Intronic
1032408822 7:131677610-131677632 TAAATTAGTTCAACCATGCTGGG - Intergenic
1032541116 7:132703928-132703950 TGAATTCCTTCAGCCATTGCTGG + Intronic
1032987701 7:137357045-137357067 AAAATTAGCTCAACCATTGCAGG - Intergenic
1033421350 7:141207370-141207392 TAAATCAGTGCAGCCACTGTGGG - Intronic
1033587089 7:142781993-142782015 AAAGTTAGTTCAGCCTATGCTGG - Intergenic
1033642397 7:143274296-143274318 GGAATTAGTACAGCCATTGTGGG + Intergenic
1033835777 7:145310173-145310195 TAAATTAGTTCAACCATTGTGGG + Intergenic
1033869774 7:145737773-145737795 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1033901825 7:146151921-146151943 TAAATTAGCTCAGCCATTGAGGG + Intronic
1035172440 7:157025145-157025167 GGAATTAGTGCAGCCATTACGGG - Intergenic
1035539749 8:423876-423898 TAAATCAGTCCAGCCATTGTGGG - Intronic
1035555065 8:561733-561755 TAAATTAATTCAACCATTGTGGG + Intergenic
1037125325 8:15341209-15341231 TACATTAGTTCAGCCACTTATGG - Intergenic
1037370801 8:18175797-18175819 TAAATTAGTACAGTCATTTTGGG - Intronic
1037376198 8:18232394-18232416 TAAATTACTTCAGCCATTATAGG + Intergenic
1038414213 8:27381741-27381763 TAAATTAGTATAACCATTACGGG - Intronic
1038659577 8:29485825-29485847 TGAATTAGGACAGCCTTTGCTGG - Intergenic
1038877200 8:31564655-31564677 TAAATTAGTTCAACCATTGTTGG + Intergenic
1038904231 8:31880090-31880112 TAAATTAGTTCAACCATTGTGGG + Intronic
1038990787 8:32865437-32865459 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1039170103 8:34734867-34734889 AAAATTAGTACAGCCATTTTGGG + Intergenic
1039356647 8:36824876-36824898 TTAATTCATTCAGCCATTGGTGG + Intronic
1040024100 8:42765975-42765997 TAAATTAGTTCAACCATTGTGGG + Intronic
1040067112 8:43155161-43155183 TAAATTAGTACAGCCATTGTGGG - Intronic
1040096909 8:43454480-43454502 TAAACTAGTTCAACCATTTTGGG - Intergenic
1040921189 8:52619857-52619879 TAAAATGGTTCAGCCACTGTTGG + Intergenic
1040961682 8:53040475-53040497 TAAATTAGTTCAGCCATTGTGGG - Intergenic
1040963396 8:53059641-53059663 TAAATTAGTTCAACCATTGTAGG + Intergenic
1041051351 8:53937942-53937964 TAAATTAGTTCAATCATTGTGGG + Intronic
1041586097 8:59521640-59521662 CAAATTATTTCAGCCATTGTGGG + Intergenic
1042128570 8:65563754-65563776 TAAACTAGATCAACCATTGTGGG - Intergenic
1042270381 8:66949688-66949710 TAAACTAGTTCAACCATTGTGGG - Intronic
1042300732 8:67277816-67277838 CAAATTAGTTCAGGAAATGCTGG + Intronic
1042613847 8:70627255-70627277 TAAATTAGTTCAACCATTGTGGG - Intronic
1042764332 8:72303683-72303705 TAAATCAGTTCAGCCATTGTGGG - Intergenic
1042854095 8:73247525-73247547 TAAATTAGTTCAATCATTGTAGG - Intronic
1043088778 8:75871844-75871866 TAAATTAGTTCAACCATTGTGGG - Intergenic
1043321736 8:78995333-78995355 TAAATTACTACAGCCATTAAGGG + Intergenic
1043343247 8:79267635-79267657 TAAATTAGTTCAACAAATGTGGG - Intergenic
1043659207 8:82714417-82714439 TAAATTAGCACAGCCGTTACAGG - Intergenic
1043731023 8:83681785-83681807 TAAATTAGTTCAACCATTGTGGG - Intergenic
1044254231 8:90041056-90041078 TAAATTAGTTCAGCCATTGTGGG - Intronic
1044381316 8:91537301-91537323 TAAATTAGTACAGCCATTTATGG - Intergenic
1044736889 8:95287971-95287993 TAAATTAGTTCAACCATTTGTGG - Intergenic
1044767733 8:95594471-95594493 AAAATTAGTTCAAACATTGTTGG - Intergenic
1045207857 8:100061705-100061727 TAAATTAGTTCAACCACTGTGGG + Intronic
1045267062 8:100628148-100628170 TAAACTAGTTCAACCATTGTGGG + Intronic
1045576218 8:103423305-103423327 AAAATTCATTCATCCATTGCTGG - Intronic
1045817207 8:106290851-106290873 TAAATTAGTTCAGCCATAGTGGG + Intronic
1045884200 8:107077031-107077053 TAGATTAGTACAGCCATTATGGG - Intergenic
1046236904 8:111436112-111436134 TAAATTAGTTCAGCCACAGTGGG - Intergenic
1046346256 8:112932003-112932025 TAAATTAGTACAGTCATTATGGG + Intronic
1046453220 8:114421324-114421346 TAAATTAGTTCAACCATTGTAGG + Intergenic
1046492964 8:114977145-114977167 TCAATCATTTCAGCCATTGCTGG + Intergenic
1046673266 8:117080919-117080941 TAAATTAGTCCAACCACTGTGGG - Intronic
1047016484 8:120728893-120728915 TAAATTAGTTCAGCTGCTGTGGG - Intronic
1047316146 8:123735352-123735374 CAAATAAGTTAAGCCATTACTGG + Intronic
1047328873 8:123866574-123866596 TAAATTAGCACAGACATTTCAGG - Intronic
1047440723 8:124875650-124875672 TAAACTAGTTCAACCATTTGTGG - Intergenic
1047525512 8:125630645-125630667 TAAATTGGTACAGCCATTATGGG + Intergenic
1047579264 8:126194811-126194833 TAAACTAGTTCAACCATTGTGGG + Intergenic
1047939057 8:129810008-129810030 TAAAGTAGTTCAACCACTGTAGG - Intergenic
1048400487 8:134063409-134063431 TAAATTGGTACAGCCATTTGTGG + Intergenic
1048545498 8:135382913-135382935 CAAATTAGTTCAGTCATTGTGGG - Intergenic
1048599289 8:135902027-135902049 TAAACTAGTACAGCCACTGTGGG - Intergenic
1048641004 8:136361484-136361506 TCAATTTGTTCATCCATTCCTGG + Intergenic
1048885686 8:138907480-138907502 CAAATTTGATCAGCCATTCCTGG - Intronic
1049064711 8:140304075-140304097 AAAATTAAGTCAGGCATTGCAGG - Intronic
1050359113 9:4811782-4811804 TAAATTAGTATAGCCATTATGGG - Intronic
1050682422 9:8128029-8128051 GAAATTAGTTCAGCCACTGTGGG - Intergenic
1050789368 9:9447072-9447094 TAATTTAGTTCAACCATTTGTGG + Intronic
1050813541 9:9779813-9779835 TAAATTAGTTCAGCCACTTGGGG + Intronic
1050894387 9:10868651-10868673 TAAATTAGTTCAACCATTGTGGG + Intergenic
1051625977 9:19100490-19100512 TAAAGTAGTACAGCCATTATGGG + Intronic
1051884482 9:21875959-21875981 GAAATTAGTTTAACCATTGTGGG - Intronic
1051899208 9:22020460-22020482 TAAATTGGTTCAACCATTGTGGG - Intronic
1051923284 9:22292908-22292930 TAAATTAGTTCAACCATGCTGGG - Intergenic
1051939680 9:22490706-22490728 TAAATTAGTTCAACCATTGTGGG - Intergenic
1052053687 9:23879931-23879953 TAAATTAGTACAGCCATTATGGG - Intergenic
1052166994 9:25343114-25343136 TAAACTAGTACAGCCACTACTGG + Intergenic
1052393498 9:27909355-27909377 TAAATTAGTTCAACCATTGGAGG + Intergenic
1053806987 9:41812823-41812845 CAAATTAGTTCAACCATTGTGGG - Intergenic
1054623605 9:67374604-67374626 CAAATTAGTTCAACCATTGTGGG + Intergenic
1054884437 9:70180446-70180468 TAAATTAGTTCAACCATTGTGGG - Intronic
1054985678 9:71259474-71259496 CAAATTAGTTCAACCATTGTGGG - Intronic
1055177427 9:73337000-73337022 TAAATTAGTTCAACCATTGTGGG + Intergenic
1058262482 9:102852961-102852983 TAAATTAGTTCAACTATTGTGGG - Intergenic
1058669995 9:107352865-107352887 TAAATTAGTTCAACCATTGTGGG - Intergenic
1059022737 9:110594109-110594131 TAAATTAGCTTAACCATTGTGGG - Intergenic
1059028639 9:110665460-110665482 TAAATTAGTTCAACCATTGTGGG - Intergenic
1059955502 9:119511583-119511605 TAAATTATTCAAGCCATTGTTGG - Intronic
1062714972 9:138005039-138005061 TAAATTAGTCCAGCCACTCTGGG + Intronic
1185820078 X:3194434-3194456 TAAATTGGTTCAGCCACTGGTGG - Intergenic
1185882465 X:3753739-3753761 TAAATTAGTTCAACCATTGTGGG + Intergenic
1186065506 X:5759292-5759314 TAAACTAGTTCAATCATTGTGGG - Intergenic
1186907629 X:14128496-14128518 TAAATTAGTTCAGCCACTGTGGG - Intergenic
1187012738 X:15296775-15296797 TAAATTAGTACAACCATTATGGG + Intronic
1187210123 X:17221828-17221850 TAAACTAGTTCAACCATTGTGGG - Intergenic
1187210913 X:17230603-17230625 TAAACTAGTTCAACCATTGTGGG - Intergenic
1188322845 X:28761170-28761192 TAAATTATTTCAGGCATTGTGGG + Intronic
1188710806 X:33395268-33395290 TAAATTAGTTCAACCATTTTGGG + Intergenic
1188849952 X:35119809-35119831 TGAATAATTTCAGACATTGCAGG + Intergenic
1188928886 X:36080337-36080359 TAAACTAGTTCAACCATTAGTGG + Intronic
1188941788 X:36246833-36246855 TAAATTGGTTCAGCCACTTTGGG + Intronic
1189855475 X:45220258-45220280 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1190437887 X:50444876-50444898 TAAATTACTTCAACCATTGTGGG - Intronic
1190500280 X:51069154-51069176 TAAATTAGTACAGCCATTTTGGG + Intergenic
1190812178 X:53895470-53895492 AACATAAGTTCAGCCATTGTGGG + Intergenic
1190944854 X:55082081-55082103 TAAATTAGTTCAACCATTGTAGG - Intergenic
1190945214 X:55086115-55086137 TAAATTAGTTCAACCATTGTAGG - Intergenic
1190964638 X:55287395-55287417 GAAATTAGTTCAACCATTGTGGG - Intronic
1190965112 X:55292311-55292333 GAAATTAGTTCAACCATGGTGGG - Intergenic
1190993434 X:55578549-55578571 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1191185255 X:57604723-57604745 TAAATTAGGTCAACCATTGTAGG - Intergenic
1191591779 X:62893636-62893658 TAAATTAGTTCATCTATTGTGGG + Intergenic
1191666853 X:63712087-63712109 TAAATTATTACAGCCATTCTAGG - Intronic
1191732623 X:64353645-64353667 TAAATTAGTACAGCCACTATTGG + Intronic
1191743253 X:64458180-64458202 TAAACCAGTTCAGCCATTGTGGG - Intergenic
1191747706 X:64508115-64508137 TAATCTAGTTCAACCATTGTGGG + Intergenic
1191752218 X:64555255-64555277 TAAATTATTTCAGCCACTGTGGG + Intergenic
1191776411 X:64819333-64819355 TAAATTAGTTCAACCATTGTGGG + Intergenic
1191777557 X:64832845-64832867 TAAATTAGTTCAGCTATTGTGGG - Intergenic
1191968468 X:66787229-66787251 TAAATTAGTTCAACCATTGTGGG + Intergenic
1192702415 X:73489116-73489138 TAAATTAGTTCAACCATTGTGGG - Intergenic
1192769896 X:74177933-74177955 TAAATTAGTACAGTCATTTTAGG + Intergenic
1192854493 X:74994616-74994638 TAAACTAGTTCAACCATTGTGGG - Intergenic
1192939173 X:75894539-75894561 TAAAGTAGTTCGACCATTGTGGG - Intergenic
1192973899 X:76262365-76262387 TAAATTAGTTTAACCATTGTGGG - Intergenic
1192975758 X:76282790-76282812 TAAATTAGTACAGCCACTATGGG - Intergenic
1193026035 X:76847117-76847139 TAAACTAGTTCAACCACTGTGGG + Intergenic
1193032290 X:76911770-76911792 TTAATTAGTTTAACCATTGTGGG - Intergenic
1193032556 X:76915051-76915073 TAAATTAGTTCAGTCACTGTGGG + Intergenic
1193163757 X:78258548-78258570 TGAATTAGTTCAACCAGTGTAGG - Intergenic
1193200960 X:78690036-78690058 TAAATTAGTTCAGCCACTGTGGG - Intergenic
1193217793 X:78885052-78885074 TAAATTAGTTCAACCATTGTGGG + Intergenic
1193263380 X:79437522-79437544 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1193299552 X:79873370-79873392 TAAATTAGTTCATCCATTATGGG + Intergenic
1193365511 X:80627603-80627625 TAAATTAGTACAGCCATTCGAGG - Intergenic
1193401751 X:81053971-81053993 TAAATTAGTTCAATCATTGTGGG - Intergenic
1193410324 X:81154928-81154950 TAAATTAGTACAACCACTGTAGG + Intronic
1193609603 X:83613349-83613371 TAAATTAATTCAGCCACTGTGGG - Intergenic
1193718602 X:84960844-84960866 TAAATTAGTTCAGCCATTGTGGG + Intergenic
1193733379 X:85128229-85128251 TAAATTAGTTCAACCATTGTGGG - Intergenic
1193883477 X:86956139-86956161 TAAATTAGTACATCCATTACAGG - Intergenic
1194031336 X:88819783-88819805 TAAATTGGGTCAACCATTGTGGG + Intergenic
1194070872 X:89324599-89324621 TAAATTAGTTCAACCATTGTAGG + Intergenic
1194116531 X:89905859-89905881 TAAATTATGTCAACCATTGTGGG + Intergenic
1194118432 X:89932079-89932101 TAAATTAGTTCAACCATTGTGGG - Intergenic
1194175234 X:90638280-90638302 TAAATTAGTCCAGTCACTGTGGG + Intergenic
1194252533 X:91594831-91594853 TAAATTAGTATAGTCATTGTGGG + Intergenic
1194271992 X:91827046-91827068 TAAATTAGTTCAACTATAGTGGG - Intronic
1194442060 X:93945298-93945320 TAAACTAGTTCAACCATTGTGGG + Intergenic
1194636047 X:96345953-96345975 TAAACTAGTTCACCCATTGTGGG - Intergenic
1195653360 X:107310506-107310528 TAAATTAGTTCAACCTTTATGGG - Intergenic
1195881361 X:109595987-109596009 TAAATTAGTTCTACCATTGTGGG - Intergenic
1196139099 X:112241275-112241297 TAAACTAGTTCAAACATTGTGGG - Intergenic
1196521871 X:116683297-116683319 TACATTCGATCAGCCATTGTGGG - Intergenic
1197013870 X:121600379-121600401 TAAATCAGTTCAGCCATTGTGGG - Intergenic
1197396631 X:125935738-125935760 TAAATTAGTTCAACCATTGTGGG - Intergenic
1197453295 X:126644684-126644706 TAAATTAGTTCAGCCACTGTGGG + Intergenic
1197491637 X:127124112-127124134 TGCATTAGTTCAGCCATTGTGGG + Intergenic
1197504294 X:127282441-127282463 TAAAATAATTCAGCAATGGCTGG + Intergenic
1198001755 X:132446378-132446400 TAAATTAGTTCAACCATTGTGGG - Intronic
1198293197 X:135258378-135258400 TAAATTGGTTCAACCATTGTGGG - Intronic
1198616178 X:138461388-138461410 TAAACTAGTTCAACCATTGTGGG + Intergenic
1198660404 X:138962403-138962425 TAAACTGGTTCAACCATTGTGGG + Intronic
1198843365 X:140882474-140882496 TAAATCAGTTTAACCATTGTGGG + Intergenic
1198989660 X:142497143-142497165 CAAATTAGTTCAACCATTGTGGG - Intergenic
1199300854 X:146212205-146212227 TAAACTAGTTCAACCACTGTGGG + Intergenic
1199398687 X:147371145-147371167 TAAATGAGTTCAGTGATTGTGGG - Intergenic
1199410680 X:147518955-147518977 CAAATTAGTTCAACCACTGTGGG - Intergenic
1199829370 X:151534042-151534064 TAAGTCAGTTCAGAAATTGCAGG - Intergenic
1199925694 X:152461391-152461413 TAAATTGGTCCATCCATTGTGGG + Intergenic
1200361202 X:155608947-155608969 TCAGTTAGTTCAGCCACTGTGGG + Intronic
1200362784 X:155628240-155628262 TAAATTAGTTCAACCATTGTGGG - Intronic
1200469330 Y:3563042-3563064 TAAATTATGTCAACCATTGTGGG + Intergenic
1200471316 Y:3589645-3589667 TAAATTAGTTCAACCATTGTGGG - Intergenic
1200521883 Y:4219254-4219276 TAAATTAGTCCAGTCACTGTGGG + Intergenic
1200589241 Y:5048484-5048506 TAAATTAGTTCAACTATAGTGGG - Intronic
1200725103 Y:6660339-6660361 TAAATTAGTTCAACCATTGTAGG + Intergenic
1200782530 Y:7229575-7229597 TAAATTAGTTCAACCATTGTGGG - Intergenic
1200819279 Y:7565637-7565659 TAAATTAGTTAAGCCCTGGTGGG + Intergenic
1201582331 Y:15523166-15523188 TAAACTAGTTCAACCATGGTGGG - Intergenic
1201633454 Y:16095734-16095756 TAAATTTGCTCGGGCATTGCAGG + Intergenic
1201699037 Y:16859701-16859723 TAAACTAGTTCAACCATTGTGGG + Intergenic
1201783787 Y:17751314-17751336 TAAATTAGTTCAACCACTGTAGG + Intergenic
1201817766 Y:18154673-18154695 TAAATTAGTTCAACCACTGTAGG - Intergenic
1202273411 Y:23092159-23092181 TAATATGGTTCAGCCACTGCAGG + Intergenic
1202292615 Y:23328523-23328545 TAATATGGTTCAGCCACTGCAGG - Intergenic
1202426408 Y:24725903-24725925 TAATATGGTTCAGCCACTGCAGG + Intergenic
1202444381 Y:24944183-24944205 TAATATGGTTCAGCCACTGCAGG - Intergenic