ID: 977517866

View in Genome Browser
Species Human (GRCh38)
Location 4:98044958-98044980
Sequence GGTCTGCCTCACCATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977517861_977517866 13 Left 977517861 4:98044922-98044944 CCCATAAGCATTCCTTTTATTCT 0: 4
1: 1
2: 3
3: 59
4: 505
Right 977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG 0: 1
1: 0
2: 0
3: 14
4: 119
977517862_977517866 12 Left 977517862 4:98044923-98044945 CCATAAGCATTCCTTTTATTCTC 0: 1
1: 0
2: 0
3: 33
4: 440
Right 977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG 0: 1
1: 0
2: 0
3: 14
4: 119
977517863_977517866 1 Left 977517863 4:98044934-98044956 CCTTTTATTCTCTATTCTATCCT 0: 4
1: 1
2: 1
3: 59
4: 796
Right 977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG 0: 1
1: 0
2: 0
3: 14
4: 119
977517860_977517866 29 Left 977517860 4:98044906-98044928 CCACACAAAATTGTTTCCCATAA 0: 1
1: 0
2: 4
3: 28
4: 571
Right 977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG 0: 1
1: 0
2: 0
3: 14
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977517866 Original CRISPR GGTCTGCCTCACCATGAGAC AGG Intronic
900434743 1:2624092-2624114 GGCCTGCCTAAGCCTGAGACTGG + Intronic
900731447 1:4263949-4263971 GGTATGACTCACAGTGAGACAGG + Intergenic
901059233 1:6464469-6464491 GGCATGCGTCACCATGGGACAGG + Intronic
905768126 1:40620146-40620168 GTTCTGCTCCACCAGGAGACAGG + Intergenic
906842339 1:49152953-49152975 TGTCTGCCTCACAATCAGAATGG + Intronic
908003145 1:59701343-59701365 TGTCTGCCTCTCCACTAGACTGG + Intronic
912722652 1:112033057-112033079 TGCCTGCCTCCCCATCAGACTGG + Intergenic
918799406 1:188953414-188953436 GGCCTGCTTCTCCATGGGACTGG + Intergenic
922164313 1:223102185-223102207 GGTGTCCCTCAACAGGAGACTGG + Intergenic
923524434 1:234761277-234761299 TGTCTGGCGAACCATGAGACAGG - Intergenic
1068777031 10:60878886-60878908 GGTCTGTAACTCCATGAGACAGG + Intronic
1069833327 10:71294100-71294122 GGCCTGCCTCACCAAGATCCAGG + Intronic
1075274441 10:121080598-121080620 GGGCTGCCCCACCCTGGGACAGG - Intergenic
1075705157 10:124496226-124496248 GGTCTGGCCCACCATGTGTCTGG + Intronic
1076082037 10:127591039-127591061 GGTCTTCCCCACCTTGAGAATGG - Intergenic
1076412549 10:130262310-130262332 GGTCAGCGGCACTATGAGACTGG - Intergenic
1084013262 11:66364232-66364254 GGTGTCCCTCACCATGTGCCTGG - Exonic
1084357820 11:68651472-68651494 GAGCTGCCTCTCCATGAGAAGGG + Intergenic
1085132016 11:74048261-74048283 GGTCTGCCTTGCCATGTGGCTGG + Exonic
1085442086 11:76574711-76574733 GGCCTGCCTAACACTGAGACTGG - Intergenic
1088742850 11:112780988-112781010 AATCTGCCTGACCATGAGCCGGG + Intergenic
1089756088 11:120688458-120688480 GGGCTGCCTCACCATGAAGAAGG + Intronic
1092160454 12:6312719-6312741 GATCTGCCTCTCCCTGAGTCAGG + Intronic
1093139097 12:15487172-15487194 GGTCTGCCTAAGCCTGAGGCTGG - Intronic
1095241057 12:39859426-39859448 GGTCAGCCTCACCAGGACAGTGG - Intronic
1095946451 12:47756464-47756486 GGTCTTCCTTATCATGAGCCTGG - Intronic
1096532247 12:52249364-52249386 GGCCTGGCTGACCATGAGCCTGG - Intronic
1100187565 12:92154124-92154146 TGTCTCTGTCACCATGAGACAGG - Intergenic
1102011989 12:109624458-109624480 GCTGTGCCTCACCCTGAGGCTGG + Intergenic
1104143006 12:126006404-126006426 GGGCAGCCTCACCTTGGGACAGG + Intergenic
1105962385 13:25354048-25354070 GCTCTGCATGTCCATGAGACAGG + Intergenic
1107126975 13:36856544-36856566 GGCCTCCCTCACCCTGAGGCTGG - Intronic
1108642218 13:52393928-52393950 GGTCTGCCACACCAAGAGCCAGG + Intronic
1109074804 13:57821370-57821392 GGTCTCCCTCCCCATGTGACGGG + Intergenic
1111874051 13:93870789-93870811 GTTTTGCCTCAAAATGAGACGGG + Intronic
1113864388 13:113511652-113511674 GGTCAGCCCCATCGTGAGACTGG + Intronic
1122028806 14:98897672-98897694 GGTCTGCCTCTCCCTGAGGCTGG + Intergenic
1124198273 15:27653232-27653254 GGACAGCCTCAACATTAGACTGG + Intergenic
1131296176 15:91151079-91151101 GAGCTGCCTCACCATGAGCGTGG + Intronic
1132271469 15:100530170-100530192 GGTCTGCCTCACCTTCTGCCAGG + Intronic
1134459134 16:14416672-14416694 GCTCTGTCGCACCATGATACTGG + Intergenic
1136277485 16:29187475-29187497 GGTCAACCTCACCCTGTGACGGG - Intergenic
1141729174 16:85810315-85810337 GGTCTGCCTCCCTGTGAGCCTGG - Intergenic
1142081863 16:88153517-88153539 GGTCAACCTCACCCTGTGACGGG - Intergenic
1143916370 17:10296319-10296341 GGTCTTCCACACCATAAGATAGG - Intergenic
1146411442 17:32589185-32589207 GGTCTGCCTCCCCACGAGGCCGG - Intronic
1152678397 17:81653296-81653318 CGTCAGCCTCACCATGAACCTGG - Exonic
1159108801 18:64032469-64032491 GGGCTGCCTCCCCAGGACACAGG - Intergenic
1159365196 18:67456308-67456330 AGTCTGTCTCAGAATGAGACAGG - Intergenic
1161479955 19:4505473-4505495 GGGCTGCCACACCATGGGCCAGG - Intronic
1163523992 19:17809159-17809181 GTTCTGTCTCCCCATGAGGCTGG + Intronic
1164469068 19:28513290-28513312 TGCCAGCCTCACCAAGAGACAGG + Intergenic
1165289443 19:34871269-34871291 GTGCTTCCTTACCATGAGACTGG + Intergenic
1166779554 19:45333999-45334021 TCTCAGCATCACCATGAGACGGG - Intronic
1167878142 19:52431208-52431230 TGTGTCGCTCACCATGAGACAGG + Intronic
927326264 2:21809352-21809374 AGCCTGCCTCACCATGAAAATGG - Intergenic
928061824 2:28121353-28121375 GGTCTGTCTCATAATGACACTGG - Intronic
929428647 2:41869081-41869103 CTCCTGCCTCAACATGAGACTGG + Intergenic
931431918 2:62215324-62215346 GGACTCCCTCACCAAGAGGCTGG - Intronic
932477408 2:72014874-72014896 GTTCTGCCTCACCATCAGAGGGG - Intergenic
935606471 2:104976438-104976460 GGTCTTCATCACCGTGAAACTGG + Intergenic
936616762 2:114055989-114056011 AGCCTGGCTCACCATGAGTCCGG - Intergenic
938114863 2:128596074-128596096 GCTCTGCCTCACCATCAGTAGGG - Intergenic
939893429 2:147764187-147764209 GCTCTGCCTCACCATGCTGCAGG - Intergenic
940465962 2:154026866-154026888 GGTATGCCTCATCATGAGAATGG + Intronic
942480608 2:176384265-176384287 TGTCTGGCTCAGCATGAGACTGG + Intergenic
944373430 2:199012052-199012074 GGTCAGCCTGGCCATGGGACAGG + Intergenic
947062278 2:226180393-226180415 GGGCTGCCTCAGCATGTCACAGG + Intergenic
947558244 2:231118646-231118668 AGTCTGCCTCATCAAGATACGGG - Intronic
948278538 2:236728663-236728685 GGTCTCCCTCTCCCTGACACCGG + Intergenic
1169199866 20:3703665-3703687 GCCCTGCCTTACCATGAGACAGG - Intronic
1171869081 20:30511839-30511861 GGTGTGCCCCACCATGTGCCAGG - Intergenic
1172449173 20:35009747-35009769 GGTTTGCCTCACCTGGAGCCAGG - Intronic
1174443338 20:50573666-50573688 GGTCAGCCTGACCATGTGCCTGG - Intronic
1174989680 20:55496365-55496387 TGTGTGCCTCTACATGAGACAGG + Intergenic
1177876058 21:26633139-26633161 GGACTGCCTCAGCACCAGACTGG - Intergenic
1178189975 21:30268965-30268987 GGTCTGGCTCACCATTCCACAGG + Intergenic
1178694547 21:34781595-34781617 GGTCTGCCTCCCCATTAGGAGGG + Intergenic
1180099295 21:45576984-45577006 GGTCCTCCTCACCGTGAGAAGGG - Intergenic
1181625371 22:24119158-24119180 GGTCTCCCGCTCCATGAAACAGG - Intronic
1181810273 22:25399970-25399992 GCTCTGGCACACCATGAGCCAGG + Intronic
1183038883 22:35161474-35161496 GGACTGCCTGTCCATGAGAAAGG + Intergenic
1183988809 22:41584407-41584429 GGGCTGCCTGACCCTGAGACAGG + Intronic
1184230523 22:43156061-43156083 GGTCTGCCCCACCAGAAAACAGG - Intronic
1184256903 22:43292265-43292287 GGTCTGCCTCTCCCCGAGAGTGG - Intronic
951855639 3:27193827-27193849 GGTCTGTTTCACCACTAGACTGG + Intronic
955786964 3:62551037-62551059 GGTTGGCATCACCATGAGAGAGG - Intronic
961732094 3:128973274-128973296 GCTCAGCCTCACCAGGAGTCAGG + Intronic
962235118 3:133700717-133700739 GCTTTCCCTCACCATGAGCCAGG + Intergenic
967510505 3:190305612-190305634 GATCTGACTCACCATGATCCTGG - Intergenic
968236297 3:197031779-197031801 AGTCTGCCTCAGCTTGAGCCAGG + Intergenic
968853434 4:3100732-3100754 GGTCTGTCTTTGCATGAGACAGG + Intronic
969055697 4:4401350-4401372 TGTCTGCCACACCAAGACACTGG - Intronic
971364684 4:25968270-25968292 TGTCTGCCTCATCAAGAGAGAGG - Intergenic
971706915 4:30057033-30057055 GGACTTCCTCTCCATGAGACAGG + Intergenic
975428065 4:74253844-74253866 GGTCTACCTCACCACCAGCCTGG + Intronic
975871075 4:78778791-78778813 GGTCTGCCTGATCATAAGATTGG + Intronic
977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG + Intronic
982931029 4:161407707-161407729 GGCCTGCTTCCCCATGGGACTGG + Intronic
986222046 5:5776632-5776654 GGTCTGTCTCACCCTGAGCAGGG + Intergenic
986695486 5:10351542-10351564 CTTCTGCCTCATCATCAGACAGG - Intergenic
991912472 5:71575329-71575351 GCTCTGCCTTACCATTAGAATGG + Intergenic
992665566 5:79005320-79005342 GGTCTGCCTCACCTTGGCAACGG - Exonic
992850058 5:80797854-80797876 GGGCTGCCTCACAAGGTGACAGG - Intronic
995945851 5:117644964-117644986 GGTCTGCCTCAATCTGAGCCTGG + Intergenic
998181996 5:139952418-139952440 GGGCGGCCTCAGCCTGAGACAGG + Intronic
999470269 5:151848941-151848963 GGACTTTCTCACCCTGAGACAGG - Intronic
999518838 5:152329686-152329708 GCTCTGCCTCACCATTTCACTGG - Intergenic
1001690753 5:173631021-173631043 TGCCTGCCTCACCATGATGCAGG - Intergenic
1001875256 5:175194811-175194833 GGGCTGCCTGACCAGGAGACTGG - Intergenic
1002501138 5:179648498-179648520 GGGCTTCCTCCCCATGACACAGG + Intergenic
1008831663 6:55771349-55771371 GCACTGCCTCAACATGAAACAGG + Intronic
1018836875 6:167491881-167491903 GGTCTGTCTCGTCATGAGTCAGG - Intergenic
1020799173 7:12712454-12712476 GGTCTCCCTAACCATGTTACAGG - Intergenic
1021892080 7:25195650-25195672 GGCCTGCCTCACACTGAGTCTGG + Intergenic
1023234464 7:38069237-38069259 GGTGTCCCTCAGCAGGAGACTGG + Intergenic
1024349988 7:48353585-48353607 GGACTGCCTCTCCAGGTGACTGG + Intronic
1025155594 7:56603326-56603348 AGCCTGCCTCCCCATGAGCCAGG - Intergenic
1027663636 7:81017611-81017633 GGTCAGGCTGACCATGAGACAGG - Intergenic
1029688741 7:102166348-102166370 TGTCTGCCCCACCATGAGAACGG - Intronic
1030634270 7:111930989-111931011 GGTTTGCCTCAGCTTGAGAGAGG + Intronic
1032188410 7:129747772-129747794 GATCTGCAGCACCATGAGAATGG + Intronic
1035542444 8:452529-452551 GATCTGCCTCATCAGGAGAAAGG - Intronic
1035745790 8:1961392-1961414 TATCTGCATCACCATGAGGCCGG - Intergenic
1036618016 8:10403760-10403782 CGTCTGCCTCAGCCTGAGCCTGG - Intronic
1045770213 8:105728572-105728594 GGACTGCCTGTCAATGAGACAGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048321803 8:133405844-133405866 GGTCTGCCCCTCTATGGGACAGG - Intergenic
1059501389 9:114756946-114756968 GATCTGCCACACCAGGGGACTGG + Intergenic
1062171954 9:135139753-135139775 GCTCTGTCTGACCATGTGACAGG - Intergenic
1193672666 X:84408678-84408700 GGTCTCCCTATCCATGAGAGTGG + Intronic
1195614041 X:106898823-106898845 CTTCTCCCTCAGCATGAGACAGG - Intronic
1200173438 X:154096270-154096292 CATCTGCCTGACCATGAGTCAGG + Intronic
1201349496 Y:13023894-13023916 GGCCTGCTTCCCCATGGGACTGG - Intergenic