ID: 977522268

View in Genome Browser
Species Human (GRCh38)
Location 4:98099881-98099903
Sequence AATAACTACAAGAGTATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5581
Summary {0: 8, 1: 424, 2: 977, 3: 1228, 4: 2944}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977522267_977522268 -9 Left 977522267 4:98099867-98099889 CCTGTACATTTTAAAATAACTAC 0: 1
1: 0
2: 5
3: 47
4: 371
Right 977522268 4:98099881-98099903 AATAACTACAAGAGTATAATTGG 0: 8
1: 424
2: 977
3: 1228
4: 2944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977522268 Original CRISPR AATAACTACAAGAGTATAAT TGG Intronic
Too many off-targets to display for this crispr