ID: 977525735

View in Genome Browser
Species Human (GRCh38)
Location 4:98143413-98143435
Sequence CAATTTTGGTGGCGTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977525735_977525742 5 Left 977525735 4:98143413-98143435 CCAGGTGCACGCCACCAAAATTG 0: 1
1: 0
2: 1
3: 8
4: 116
Right 977525742 4:98143441-98143463 TAGGGATTAGACGCTCGCCCCGG No data
977525735_977525743 14 Left 977525735 4:98143413-98143435 CCAGGTGCACGCCACCAAAATTG 0: 1
1: 0
2: 1
3: 8
4: 116
Right 977525743 4:98143450-98143472 GACGCTCGCCCCGGTGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977525735 Original CRISPR CAATTTTGGTGGCGTGCACC TGG (reversed) Intergenic
900353195 1:2247077-2247099 CAGGTGTGGTGGCATGCACCTGG + Intronic
901842276 1:11961241-11961263 CAAGTGTGGTGGCTTGAACCTGG + Intronic
903061870 1:20674400-20674422 CAGATGTGGTGGCATGCACCTGG - Intronic
905115992 1:35641357-35641379 CAATATTGCTGGCGGCCACCCGG + Exonic
907074181 1:51563940-51563962 CAAGTGTGGTGGCATGCACCTGG + Intergenic
907359592 1:53903705-53903727 CAGGTGTGGTGGTGTGCACCTGG + Intronic
908459022 1:64331188-64331210 CAATTTTGTGGCAGTGCACCTGG - Intergenic
911429833 1:97771178-97771200 CAGTTGTGGTGGCATGCGCCAGG + Intronic
915712472 1:157914062-157914084 TGAGTTTGGTGGCATGCACCTGG + Intergenic
918110350 1:181450235-181450257 CAATGTTGGGGGAGGGCACCTGG - Intronic
1063084539 10:2804591-2804613 CAATCTAGGTGGCGTGAAACTGG - Intergenic
1063306732 10:4909572-4909594 TCATTTTGGTGGCGTGTACAGGG + Intergenic
1065989454 10:30993466-30993488 AAATTTTGGTGGCATCCACAAGG + Intronic
1067215599 10:44300154-44300176 CAATTCTGGTGGTCTGCACCAGG + Intergenic
1069426790 10:68295349-68295371 CAGGTGTGGTGGTGTGCACCTGG + Intronic
1069642881 10:69967429-69967451 CAAGTGTGGTGGCGGGCGCCTGG + Intergenic
1070177809 10:73987267-73987289 AAATTTTTGTAGCGTGAACCCGG - Intergenic
1072110848 10:92318579-92318601 CAGGTATGGTGGTGTGCACCTGG + Intronic
1073667222 10:105547035-105547057 CAATTTTGGGGGTGTGCAAAGGG - Intergenic
1076545541 10:131243468-131243490 CTATTTGGGTGGCTTGAACCCGG + Intronic
1083072558 11:60000634-60000656 GAATTTTGGAAGCTTGCACCTGG + Intergenic
1083906419 11:65674611-65674633 GAATTTTTGTGGGCTGCACCTGG + Intergenic
1084740865 11:71138672-71138694 CCAGTGTGGTGGCGTGCACTTGG + Intronic
1084849321 11:71926126-71926148 CAAATGTGGTGGCGTGTGCCTGG + Intronic
1089424641 11:118362262-118362284 CAGGCATGGTGGCGTGCACCTGG - Intronic
1095626916 12:44326019-44326041 CAAGTGTGGTGGCGTGCGCCTGG + Intronic
1097840014 12:64312465-64312487 CAGGTTTGGTGGCGGGCGCCTGG + Intronic
1099243617 12:80168097-80168119 CAGGTGTGGTGGCGTGCGCCTGG - Intergenic
1101110202 12:101478993-101479015 CAAGTGTGGTGGCGTGTGCCTGG + Intronic
1102237729 12:111304721-111304743 CAGTTTTGGTGGCTGCCACCAGG + Intronic
1104402698 12:128489929-128489951 CGATTTTGGTGGCATACACGTGG - Intronic
1105366929 13:19773792-19773814 CATGCTTGGTGGCATGCACCCGG - Intronic
1106359882 13:29021123-29021145 CAGATGTGGTGGTGTGCACCTGG + Intronic
1106938727 13:34752878-34752900 CAAGCTTGGCGGCATGCACCTGG + Intergenic
1107303398 13:38991709-38991731 CAGGTATGGTGGTGTGCACCTGG - Intergenic
1116276371 14:42838910-42838932 CTTTTCTGGTGGCGTGCCCCAGG - Intergenic
1116276452 14:42839566-42839588 CTTTTCTGGTGGCGTGCCCCAGG - Intergenic
1118454303 14:65930736-65930758 CAGGTCTGGTGGCATGCACCTGG + Intergenic
1118876336 14:69787916-69787938 CAGGTGTGGTGGTGTGCACCAGG + Intronic
1119828762 14:77681911-77681933 GACTTTTGGAGGCATGCACCTGG + Intronic
1119909343 14:78335471-78335493 CTATCTTGGTGCCTTGCACCTGG + Intronic
1121374716 14:93397780-93397802 CAGGTATGGTGGTGTGCACCTGG + Intronic
1125467136 15:39965261-39965283 CAGGTTTGGTGGCGGGCACTTGG - Intronic
1127559945 15:60126354-60126376 CAAATTTGGAGGTGTGCACAGGG - Intergenic
1128970008 15:72100104-72100126 CAGGTGTGGTGGCTTGCACCTGG + Intronic
1130186636 15:81689707-81689729 CAATTTTGGTTGGGTACAGCTGG + Intergenic
1131216717 15:90542999-90543021 CAATTAAGGTGGTGTCCACCAGG + Intronic
1132650312 16:1018566-1018588 CGGGTGTGGTGGCGTGCACCTGG - Intergenic
1134850156 16:17472233-17472255 CACCTTTGGATGCGTGCACCTGG - Intergenic
1135067111 16:19319408-19319430 CAAGCATGGTGGCGTGGACCTGG + Intronic
1136425558 16:30167756-30167778 CAGGTGTGGTGGCTTGCACCTGG + Intergenic
1142903658 17:3028347-3028369 CAATTTTGGAGGGGTGCTACTGG + Intronic
1145082071 17:19902441-19902463 CAGGTGTGGTGGCGGGCACCTGG - Intergenic
1145228156 17:21148602-21148624 CGAGTGTGGTGGTGTGCACCTGG + Intronic
1149460195 17:56822899-56822921 CACTTGTGGAGGCGTGCAGCAGG - Intronic
1149617647 17:58014792-58014814 CAGGTATGGTGGCGTGCGCCTGG + Intergenic
1203163111 17_GL000205v2_random:69772-69794 CAATAATGGTAGTGTGCACCAGG - Intergenic
1154453570 18:14501375-14501397 CACCTTTGGAGGGGTGCACCGGG - Intergenic
1158284062 18:55859313-55859335 CAATTTTGCCTGCGTGCACTGGG - Intergenic
1158535792 18:58307053-58307075 CAACTTTGGTGGAGTCCACTGGG + Intronic
1160051482 18:75438145-75438167 CAATGTTGGTGGCTTGGACCAGG + Intergenic
1161276343 19:3420177-3420199 CAGATGTGGTGGCGTGTACCTGG + Intronic
1162356631 19:10189559-10189581 CAAAAGTGGTGGCATGCACCTGG - Intronic
1163641253 19:18463474-18463496 CAGTTGTGGTGGCGTGCGCCTGG - Intronic
1164970584 19:32528898-32528920 CAGGTGTGGTGGCGAGCACCAGG + Intergenic
1166103806 19:40587760-40587782 CAAGTATGGTGGCATGCACCTGG + Intronic
1166126809 19:40719629-40719651 CAGGTGTGGTGGCGGGCACCTGG - Intronic
1167092061 19:47351328-47351350 CAGGTGTGGTGGCGGGCACCTGG - Intronic
932354925 2:71060635-71060657 CAGATGTGGTGGTGTGCACCTGG + Intergenic
934653705 2:96106520-96106542 CAGGTGTGGTGGCGTGCGCCTGG - Intergenic
935159014 2:100512843-100512865 CGAGTGTGGTGGCATGCACCTGG + Intergenic
942588322 2:177511239-177511261 CAAGCATGGTGACGTGCACCTGG - Intronic
946111294 2:217420183-217420205 CAGGTGTGGTGGGGTGCACCTGG + Intronic
948909479 2:240995805-240995827 CAATTTAGATGGGGTGCCCCGGG - Intergenic
1170503583 20:17000292-17000314 CAGTTTTTGTGGCTTGCACCTGG + Intergenic
1173914829 20:46699292-46699314 CAACTTTGGAGTCGTGCACTAGG - Intergenic
1175052724 20:56169948-56169970 CAGGTGTGGTGGCATGCACCTGG - Intergenic
1178451534 21:32705843-32705865 CAGGTGTGGTGGCATGCACCTGG + Intronic
1181354042 22:22288007-22288029 CAGGTGTGGTGGTGTGCACCTGG - Intergenic
1183286957 22:36972605-36972627 CAGGTTTGGTGGTGCGCACCTGG + Intergenic
1183380906 22:37490076-37490098 CAGTTTTGGTGCCCTGCTCCAGG + Intergenic
950046926 3:9954040-9954062 CAAGTGTGGTGGTGCGCACCTGG + Intergenic
962122383 3:132575716-132575738 CAATGTTAGTGTAGTGCACCGGG + Intronic
962486177 3:135844847-135844869 CAATTCAGGTGGCTTGGACCAGG + Intergenic
966116132 3:176463643-176463665 CAATTTTACTGGTGTGCTCCAGG - Intergenic
968097250 3:195940617-195940639 CAATTTGAGGGCCGTGCACCTGG - Intergenic
970095369 4:12458044-12458066 CAATTTTGGTGTGGGGCAGCAGG - Intergenic
971283547 4:25264461-25264483 AAATATTGGTGGTGTGGACCAGG + Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
974250952 4:59382154-59382176 CTTTTTTGGTGGAGTGCCCCTGG - Intergenic
977525735 4:98143413-98143435 CAATTTTGGTGGCGTGCACCTGG - Intergenic
978365882 4:107981125-107981147 CAATTTTAGTGGAGTGGATCTGG + Intergenic
981707689 4:147678840-147678862 GAACTTTGGAGGCTTGCACCTGG + Intronic
988890384 5:35610084-35610106 CAATTTTGGTGGTGTCTTCCTGG - Intergenic
992875465 5:81050164-81050186 CAGTGTTGATGGCCTGCACCAGG - Intronic
997407956 5:133667295-133667317 CAATGATGGTGGCTTGTACCAGG - Intergenic
998418951 5:141966137-141966159 CAGATGTGGTGGTGTGCACCTGG + Intronic
1001959129 5:175869733-175869755 CTAGTTTGGTGGTGGGCACCTGG - Intronic
1006644206 6:35505076-35505098 CAGGTGTGGTGGCATGCACCTGG - Intronic
1007615687 6:43178798-43178820 CAATGTAGGTGGCGTCCCCCAGG + Exonic
1011057580 6:83222349-83222371 TAATCTTGGTGGCTAGCACCCGG - Intronic
1013490270 6:110640077-110640099 CTAGTGTGGTGGCATGCACCTGG + Intronic
1016624076 6:146145551-146145573 AAACTTTGGTGGCGTCCACATGG + Intronic
1016715014 6:147215520-147215542 CAGGCGTGGTGGCGTGCACCTGG - Intronic
1017469202 6:154723039-154723061 CAGGTGTGGTGGCGGGCACCTGG - Intergenic
1017760592 6:157565103-157565125 CAGGTGTGGTGGCATGCACCTGG + Intronic
1021448221 7:20756499-20756521 CAATCTTGGTGGCGGGCACCTGG + Exonic
1022135607 7:27445296-27445318 CAAATGTTGTGGCATGCACCTGG + Intergenic
1026286870 7:68971038-68971060 CATGCTTGGTGGCATGCACCTGG + Intergenic
1027205899 7:76098725-76098747 CAGATGTGGTGGTGTGCACCTGG + Intergenic
1027887496 7:83927985-83928007 CAATTTTAGTGGCTTCCACTTGG - Intergenic
1033455094 7:141496008-141496030 CAATTCTGGTGGCATGAACTTGG + Intergenic
1035192435 7:157183172-157183194 CAATTCTGATGCCGTCCACCCGG + Intronic
1037893163 8:22634775-22634797 CTAGTTTGGTGGCGGGCACGGGG + Intronic
1037953409 8:23034384-23034406 CAAATCTGGTGGCTTCCACCTGG - Intronic
1039209792 8:35200693-35200715 CAGGTGTGGTGGCATGCACCTGG + Intergenic
1039689983 8:39852562-39852584 CAATTTTGGTGGCCCGTACAGGG - Intergenic
1041354840 8:56989524-56989546 CAATTTTTGTGGCTTGCAGAAGG + Intronic
1045468260 8:102488894-102488916 CAGTTGTGGTGGCCTGCACCTGG - Intergenic
1047991898 8:130295139-130295161 CAGGTGTGGTGGCATGCACCTGG + Intronic
1049165823 8:141125497-141125519 CAGGCGTGGTGGCGTGCACCTGG - Intronic
1051106178 9:13583046-13583068 CAACTTTGGGGGCAGGCACCTGG - Intergenic
1058426483 9:104879673-104879695 CAATTTTGTTTGAGTGCACATGG + Intronic
1190023375 X:46899585-46899607 CAGGCATGGTGGCGTGCACCTGG + Exonic
1195234829 X:102887137-102887159 CAGGTGTGGTGGTGTGCACCTGG - Intergenic
1201145523 Y:11063172-11063194 CCAGTGTGGTGGCGTGCACTTGG + Intergenic