ID: 977534055

View in Genome Browser
Species Human (GRCh38)
Location 4:98236459-98236481
Sequence GGCAATGTGGAACAGAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977534055_977534057 -10 Left 977534055 4:98236459-98236481 CCAACACTCTGTTCCACATTGCC No data
Right 977534057 4:98236472-98236494 CCACATTGCCTTTCAAAGTCAGG No data
977534055_977534059 -6 Left 977534055 4:98236459-98236481 CCAACACTCTGTTCCACATTGCC No data
Right 977534059 4:98236476-98236498 ATTGCCTTTCAAAGTCAGGGAGG No data
977534055_977534058 -9 Left 977534055 4:98236459-98236481 CCAACACTCTGTTCCACATTGCC No data
Right 977534058 4:98236473-98236495 CACATTGCCTTTCAAAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977534055 Original CRISPR GGCAATGTGGAACAGAGTGT TGG (reversed) Intergenic
No off target data available for this crispr