ID: 977534057

View in Genome Browser
Species Human (GRCh38)
Location 4:98236472-98236494
Sequence CCACATTGCCTTTCAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977534050_977534057 30 Left 977534050 4:98236419-98236441 CCTTTTACTGCTTTATCTTAAGG No data
Right 977534057 4:98236472-98236494 CCACATTGCCTTTCAAAGTCAGG No data
977534055_977534057 -10 Left 977534055 4:98236459-98236481 CCAACACTCTGTTCCACATTGCC No data
Right 977534057 4:98236472-98236494 CCACATTGCCTTTCAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977534057 Original CRISPR CCACATTGCCTTTCAAAGTC AGG Intergenic
No off target data available for this crispr