ID: 977534058

View in Genome Browser
Species Human (GRCh38)
Location 4:98236473-98236495
Sequence CACATTGCCTTTCAAAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977534055_977534058 -9 Left 977534055 4:98236459-98236481 CCAACACTCTGTTCCACATTGCC No data
Right 977534058 4:98236473-98236495 CACATTGCCTTTCAAAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977534058 Original CRISPR CACATTGCCTTTCAAAGTCA GGG Intergenic
No off target data available for this crispr