ID: 977534176

View in Genome Browser
Species Human (GRCh38)
Location 4:98237795-98237817
Sequence CAGAAAAGGGTGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977534170_977534176 -4 Left 977534170 4:98237776-98237798 CCTATCCTTTCATTAACCTCAGA No data
Right 977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG No data
977534168_977534176 3 Left 977534168 4:98237769-98237791 CCCACATCCTATCCTTTCATTAA No data
Right 977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG No data
977534169_977534176 2 Left 977534169 4:98237770-98237792 CCACATCCTATCCTTTCATTAAC No data
Right 977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG No data
977534171_977534176 -9 Left 977534171 4:98237781-98237803 CCTTTCATTAACCTCAGAAAAGG No data
Right 977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977534176 Original CRISPR CAGAAAAGGGTGAAGGAAGA AGG Intergenic
No off target data available for this crispr