ID: 977536785

View in Genome Browser
Species Human (GRCh38)
Location 4:98262601-98262623
Sequence GAAATTATGACAGACAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977536785_977536789 16 Left 977536785 4:98262601-98262623 CCACTCCTGTCTGTCATAATTTC 0: 1
1: 0
2: 1
3: 18
4: 254
Right 977536789 4:98262640-98262662 CTCCCTTGGCATCTGTCAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 210
977536785_977536788 2 Left 977536785 4:98262601-98262623 CCACTCCTGTCTGTCATAATTTC 0: 1
1: 0
2: 1
3: 18
4: 254
Right 977536788 4:98262626-98262648 CTTTTTAAAATTTGCTCCCTTGG 0: 1
1: 0
2: 4
3: 45
4: 455
977536785_977536790 17 Left 977536785 4:98262601-98262623 CCACTCCTGTCTGTCATAATTTC 0: 1
1: 0
2: 1
3: 18
4: 254
Right 977536790 4:98262641-98262663 TCCCTTGGCATCTGTCAGCTGGG 0: 1
1: 0
2: 3
3: 21
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977536785 Original CRISPR GAAATTATGACAGACAGGAG TGG (reversed) Intronic
901958083 1:12801721-12801743 GAAAGAAAGACAGACAGGACAGG - Intergenic
904668975 1:32147959-32147981 GAAATTATGAAAGTCAGGCTGGG - Intronic
905805536 1:40874287-40874309 GAGATTAGGAAAGGCAGGAGGGG + Intergenic
906443062 1:45867640-45867662 GAAATAATAACAGATTGGAGGGG + Intronic
908120894 1:60984997-60985019 GAGACTATGAAAGACAGTAGGGG - Intronic
909596578 1:77412967-77412989 ACATTCATGACAGACAGGAGAGG - Intronic
910508701 1:87979416-87979438 GAAATTACCACAGAGAAGAGGGG + Intergenic
911601038 1:99848752-99848774 GAGATTAGGACAGACAGATGGGG - Intergenic
912792136 1:112662928-112662950 GGAATTATTACAAACAGGATGGG - Intronic
913171655 1:116238519-116238541 GCAATTATGTTAGACTGGAGAGG + Intergenic
913557229 1:119980047-119980069 GATATCATGCGAGACAGGAGAGG - Intronic
917068620 1:171124892-171124914 GAAATTATGATAGCTGGGAGTGG - Intergenic
917299632 1:173559926-173559948 GAGGTTATGACAAACAGGAAGGG - Intronic
917658421 1:177152002-177152024 GAAATCAGGAAGGACAGGAGAGG + Intronic
917703600 1:177606860-177606882 GAAGTTCTGACATACAGGAAGGG + Intergenic
920063780 1:203249614-203249636 GAAACTGTCACAGACAAGAGGGG - Intronic
920770900 1:208884187-208884209 GTAATTGTGAAAGACAGAAGTGG - Intergenic
923827592 1:237517073-237517095 GGCATGATGACAAACAGGAGGGG - Intronic
924272750 1:242350766-242350788 AATATAATGACAGGCAGGAGTGG - Intronic
1063173524 10:3531189-3531211 GAAGGGATGCCAGACAGGAGAGG - Intergenic
1063198509 10:3765359-3765381 TAAAATATGACAGACAGAAATGG - Intergenic
1063236468 10:4121718-4121740 GAAGAAAGGACAGACAGGAGTGG - Intergenic
1065081216 10:22131207-22131229 GAAACTGTGACAGACAGCACCGG - Intergenic
1065244731 10:23745712-23745734 GAAAATGTGACCGACAGGTGTGG + Intronic
1065613109 10:27491782-27491804 AAATCTATGGCAGACAGGAGCGG - Intergenic
1066711961 10:38245881-38245903 AATATAATGACAGGCAGGAGCGG + Intergenic
1070893850 10:79964911-79964933 GGAATTATGTCTGACAGAAGGGG - Intronic
1071430356 10:85602108-85602130 TAAATAATGACAGAATGGAGTGG - Exonic
1072663535 10:97378120-97378142 GAAACTATGCCTGAAAGGAGAGG + Intronic
1072864090 10:99040600-99040622 GAAATAATGACATAAATGAGCGG - Intronic
1073075410 10:100822970-100822992 ACATTTAGGACAGACAGGAGGGG + Intronic
1073266094 10:102229388-102229410 GAATTTTTGACAGACAAGAAGGG + Exonic
1073999544 10:109356002-109356024 GAAATTATATCAAACAGTAGAGG - Intergenic
1074553466 10:114466861-114466883 GAAATTATGACATACGGGCCAGG + Intronic
1074669763 10:115776578-115776600 AATATTACGAGAGACAGGAGGGG - Intronic
1077957567 11:7037446-7037468 GACATTATGAAAGACTGGAAAGG + Intronic
1079363851 11:19792262-19792284 GAAATTATGGGAGAAGGGAGAGG - Intronic
1081038521 11:38180576-38180598 AAATTTATGACAGACAGAAAAGG + Intergenic
1082669206 11:56013600-56013622 GAAATTATACCAGATAGAAGTGG - Intergenic
1087395286 11:97589278-97589300 CAAATTATAACACACAGCAGAGG + Intergenic
1087675728 11:101158932-101158954 GAAATCATGACATTTAGGAGGGG + Intergenic
1090526458 11:127543892-127543914 GGAATTATGTCTGACAGAAGGGG + Intergenic
1090536256 11:127645125-127645147 GAAATAATTAAAGAAAGGAGTGG + Intergenic
1090982196 11:131733322-131733344 GAAATGATGAAAGAGAGGACTGG - Intronic
1092958880 12:13576957-13576979 GAAAATAACACAGACAGGACAGG + Intronic
1093628022 12:21373629-21373651 GAACTTCTGACAGACAGGAATGG + Intronic
1093961679 12:25280292-25280314 GAAATTGTGGCAGGGAGGAGAGG - Intergenic
1094401039 12:30060744-30060766 GAAATTATGACAGAATAGAATGG - Intergenic
1095127253 12:38494810-38494832 GTAATTATGAAAGAAAGAAGGGG + Intergenic
1095467641 12:42504754-42504776 GAAATTAGCAGAGACAGGAATGG - Intronic
1095882769 12:47155963-47155985 GAAATCATGACAGACATAATGGG + Intronic
1095972921 12:47916616-47916638 GAAATAATGTCAAACAGGATAGG + Intronic
1097309934 12:58107564-58107586 AAAATTAAGTCAGACAGAAGAGG + Intergenic
1099806307 12:87524419-87524441 GAAATTATGTAGCACAGGAGAGG + Intergenic
1101190168 12:102324498-102324520 GATAGTATGACAGACAGCACTGG - Intergenic
1101363357 12:104048578-104048600 GAAATAATGAAAGACAGAATGGG + Intronic
1103023159 12:117552949-117552971 GGAATTAGGACAGAGAGCAGAGG - Intronic
1105251973 13:18707354-18707376 GAAATTAGGGCAGGCAGAAGGGG - Intergenic
1106946464 13:34833146-34833168 TAAATTATGACACAAAGGAAGGG + Intergenic
1107238277 13:38199300-38199322 GAAAATGTCACAGCCAGGAGAGG + Intergenic
1112089641 13:96069184-96069206 GAAAATCTGAGAAACAGGAGAGG + Intergenic
1113793989 13:113046217-113046239 GAAATTTGGACGGACAGGCGGGG - Intronic
1114822164 14:26033711-26033733 CAATTTGTGACAGACAGGTGTGG - Intergenic
1115144309 14:30208656-30208678 GATATTATTACAGAGAGGAAGGG - Intergenic
1115839371 14:37450158-37450180 GAAATTAAGAGTGACAGGATGGG - Intronic
1116294760 14:43092797-43092819 AATATTATGTCAAACAGGAGTGG - Intergenic
1117566837 14:57001922-57001944 GAAATTCTGAGAGACAAGAGTGG - Intergenic
1118358517 14:65036171-65036193 GAAACTATGACACAGAGCAGTGG - Intronic
1118696251 14:68388560-68388582 GAAATTATGAGGGACAGTAAAGG - Intronic
1118796372 14:69149391-69149413 GAAATTATGACAGCAACAAGTGG - Intronic
1119536923 14:75410166-75410188 GAAATGGTGACAGACAGGGGTGG - Intergenic
1119793046 14:77370331-77370353 AAAATAATGAAAGACAGTAGTGG + Intronic
1120106016 14:80495565-80495587 GATTTTATAACAGACTGGAGAGG - Intronic
1121275990 14:92668012-92668034 ATTATTATGAAAGACAGGAGGGG - Intronic
1124131792 15:26996447-26996469 CAATTTATGACATACAAGAGAGG - Intronic
1124626765 15:31312218-31312240 GAAAGGATGAGAGCCAGGAGAGG + Intergenic
1125221545 15:37342478-37342500 GAAATAATCACAGCCAAGAGTGG - Intergenic
1130610475 15:85356222-85356244 GAAAGTGAGACAGACAGTAGTGG + Intergenic
1131685922 15:94767495-94767517 GAAAGAAAGAGAGACAGGAGAGG + Intergenic
1132372127 15:101306496-101306518 CACATTCTGACAGCCAGGAGAGG - Intronic
1132791638 16:1692920-1692942 GAAATGTAGACAGAAAGGAGAGG + Intronic
1133544327 16:6790648-6790670 AAAATAATGACAGACAGAACAGG - Intronic
1135785406 16:25344514-25344536 TAAAGTATGACAGAGAGTAGAGG + Intergenic
1137936149 16:52637397-52637419 GAAAAGATGACAGAAAGGAAGGG - Intergenic
1139648749 16:68351202-68351224 GAAATGCTGGCAGACAGAAGGGG - Intronic
1139878352 16:70164293-70164315 GAGCTTTTGAAAGACAGGAGGGG - Intergenic
1140317905 16:73917197-73917219 GAAAGAATAACAGACAAGAGAGG + Intergenic
1140382718 16:74504978-74505000 GAAATTAAGACAAACTGAAGTGG + Intronic
1143632969 17:8149307-8149329 GAACCTGGGACAGACAGGAGAGG + Exonic
1144224604 17:13132703-13132725 GAAATTAGGAGAGACAAGGGAGG + Intergenic
1145053561 17:19682809-19682831 GACATAATCACAGACAGCAGTGG - Intronic
1146382515 17:32341654-32341676 GAGATAATGACAGAAAGGAGAGG + Intronic
1146460277 17:33040838-33040860 GAAAGTGTGAGAGACAGGAGTGG + Intronic
1147178347 17:38670481-38670503 GTCCTTGTGACAGACAGGAGAGG + Intergenic
1147783346 17:42959950-42959972 GAAAATATGGCAGCCAGGTGCGG - Intronic
1148254780 17:46120489-46120511 GAAATTATGTCAGAAACAAGTGG + Intronic
1150563292 17:66314248-66314270 GAAATTTTGACAGACTGATGAGG - Intronic
1151271735 17:73001859-73001881 GAAAGTATCACAGACAGAACAGG + Intronic
1151306424 17:73265547-73265569 GTGATTATGAGAGAAAGGAGAGG + Intergenic
1156401809 18:36745992-36746014 GAAATTGTGAAGGACAGGAGCGG - Intronic
1158133514 18:54180390-54180412 AGAATTATGACAGAAAGGAGTGG + Intronic
1158155762 18:54423949-54423971 GAGATAATGTCAGAGAGGAGTGG + Intergenic
1158582953 18:58701370-58701392 AAAAGTATGACAGACAGAAAAGG - Intronic
1159667163 18:71175994-71176016 GGAATGGTTACAGACAGGAGGGG - Intergenic
1163629844 19:18412708-18412730 GAAGAAATGACAGCCAGGAGTGG + Intergenic
1164603850 19:29581601-29581623 TCAATAATGACAGACAGCAGTGG - Intergenic
1167412009 19:49349876-49349898 GACAATAAGACAGACATGAGAGG + Intronic
925691105 2:6524272-6524294 GAAATGCAGACAGAAAGGAGAGG + Intergenic
926041602 2:9677762-9677784 GAGATTATAACAGCCAGGTGCGG - Intergenic
926519009 2:13885615-13885637 GGAAATATTACAGGCAGGAGAGG + Intergenic
926671132 2:15577852-15577874 GAAATTGTGTCAGGCAGGAGAGG - Intergenic
927042266 2:19241379-19241401 CAAACTAAGGCAGACAGGAGGGG + Intergenic
928927713 2:36596379-36596401 GAATTTTTGAGAGACAGGACAGG - Intronic
929975776 2:46633121-46633143 GAAAATATGACAAACAGGCCAGG + Intergenic
930963398 2:57288838-57288860 GAAAGTATGAGAGAAAGGTGTGG - Intergenic
932404104 2:71502614-71502636 GCATTTCTGACTGACAGGAGGGG - Intronic
932987109 2:76739367-76739389 GCAGGTATGGCAGACAGGAGAGG - Intergenic
934156627 2:89207201-89207223 GAAAATCTGAAAGAAAGGAGGGG - Intergenic
934210688 2:89975550-89975572 GAAAATCTGAAAGAAAGGAGGGG + Intergenic
935096808 2:99952571-99952593 GAAATAATAACACACAGGACTGG - Intronic
935484703 2:103639410-103639432 TTAATTATGACAGACAGAAGAGG + Intergenic
935958481 2:108401113-108401135 CAAATTATGACTTACAGGAAGGG + Intergenic
936030488 2:109066787-109066809 GAGATTATGACAGAGCCGAGCGG + Intergenic
936383440 2:112007960-112007982 GAAATTATGTGTGTCAGGAGGGG - Intronic
936810332 2:116391921-116391943 GTAATTCTTCCAGACAGGAGTGG + Intergenic
937532338 2:122844545-122844567 GTAATGATGAAAGATAGGAGGGG - Intergenic
937840621 2:126520583-126520605 GAAAGTAAGACAGAGAGAAGTGG - Intergenic
939245541 2:139618905-139618927 GAAATTATGTCAGACCACAGTGG - Intergenic
939501890 2:142997025-142997047 GCACTTATTACAGAAAGGAGTGG - Intronic
940697085 2:156993206-156993228 GAGTTTATTACAGGCAGGAGAGG + Intergenic
940944279 2:159598557-159598579 GAAATAATTACAGACGGGTGTGG + Intronic
941103220 2:161321770-161321792 GAAATGAAGACACACAGGATGGG + Intronic
944909322 2:204293932-204293954 CATATTTTGACAGACTGGAGTGG - Intergenic
946032366 2:216715445-216715467 GAAATAATGACAGAAAGAAAGGG - Intergenic
946531327 2:220573686-220573708 GAAATAAAGACAGCCAGGCGCGG + Intergenic
947234842 2:227930133-227930155 GAAATTGAGACACAGAGGAGTGG - Intergenic
947677102 2:231992200-231992222 GAAATTAGGTGAGACAGTAGGGG + Intronic
1169055668 20:2618784-2618806 GAGATAATGGCAGACAGAAGGGG - Intronic
1169809480 20:9594675-9594697 GAAAGTATGGGAGAAAGGAGAGG - Intronic
1169921488 20:10739164-10739186 GAAAATATAACAGAGAGCAGGGG - Intergenic
1170152988 20:13244944-13244966 GAAACAATGAAAGAAAGGAGTGG + Intronic
1171183018 20:23104946-23104968 GAAACTACCAGAGACAGGAGTGG + Intergenic
1173352303 20:42256429-42256451 GAAATTGTAGCAAACAGGAGGGG + Intronic
1173973106 20:47167683-47167705 GATCTGATGACAGAAAGGAGAGG - Intronic
1176837505 21:13807206-13807228 GAAATTAGGGCAGGCAGAAGGGG - Intergenic
1177400597 21:20598878-20598900 GAAATAATGACAAACAGTAAAGG - Intergenic
1178085993 21:29112650-29112672 GTAATTATGAGAGACAGGAAGGG - Intronic
1178518707 21:33269211-33269233 GAAACACTGACAGGCAGGAGAGG - Intronic
1179873768 21:44257077-44257099 CAAATTAAAACAGACTGGAGGGG + Intronic
1181582183 22:23834552-23834574 AAAATAATGAGAGCCAGGAGTGG + Exonic
1183147714 22:36009968-36009990 GAAATGGTGGCACACAGGAGCGG - Intronic
1183771842 22:39933414-39933436 TTAATTTTGACAGACAGGATGGG + Intronic
1183950496 22:41349904-41349926 TAAATGATGACAGGCAGTAGGGG - Intronic
949395502 3:3610508-3610530 ATAATAAGGACAGACAGGAGAGG - Intergenic
949740900 3:7232588-7232610 GAACTTCTGAGAGACAGAAGAGG + Intronic
949802779 3:7921542-7921564 GAAATAATGGCAGACATGAATGG + Intergenic
951220885 3:20067956-20067978 GAAATTAAGCCAGACGGGACAGG - Intronic
951405058 3:22286028-22286050 GAAATAAAGACACACAGGAAAGG + Intronic
953896983 3:46810525-46810547 GAAATAAGAACAGACAGGAAAGG + Intronic
954499290 3:50995733-50995755 GAAATATTGAAAGACAGTAGGGG + Intronic
958550282 3:95603616-95603638 GAAATTTTGGCCCACAGGAGAGG - Intergenic
959104089 3:102046509-102046531 AAGATTCTGACAGACAGGACAGG - Intergenic
961231805 3:125319613-125319635 GAAATTATGAAAACCTGGAGAGG + Intronic
961484214 3:127206307-127206329 GAACTTGGGGCAGACAGGAGTGG - Intergenic
964980177 3:162668776-162668798 AAAATTATGATAGAAATGAGTGG - Intergenic
966586475 3:181631997-181632019 GAAATTATGACTAACAAGACAGG - Intergenic
967969180 3:194986595-194986617 GAAATTGGGAAAGACAGGGGTGG - Intergenic
970407931 4:15781332-15781354 GAATGTGTGACAGGCAGGAGAGG - Intronic
971482466 4:27126705-27126727 GAAAGTAGGACACACAGCAGAGG - Intergenic
972122505 4:35722579-35722601 AAAATTAGAACAGGCAGGAGGGG + Intergenic
974434657 4:61841156-61841178 CAAAATATGAAAGAGAGGAGAGG - Intronic
975341577 4:73247811-73247833 GAAATTATCACAAAGAGCAGAGG - Intronic
975878756 4:78876193-78876215 GAATGATTGACAGACAGGAGGGG + Intronic
976141019 4:81991826-81991848 GAAATAATGAGTGAAAGGAGTGG - Intronic
977536785 4:98262601-98262623 GAAATTATGACAGACAGGAGTGG - Intronic
977543958 4:98353074-98353096 GATATAATGACAAACAGGAATGG - Intronic
979736837 4:124096972-124096994 GAAATTAGTAAAGACAAGAGAGG - Intergenic
980984055 4:139678389-139678411 GCAATTAAAAAAGACAGGAGAGG - Intronic
984315391 4:178123363-178123385 AAAATTTTGAAAGACAGGGGAGG + Intergenic
984656099 4:182320511-182320533 GTCTTTATGAGAGACAGGAGAGG - Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985085599 4:186309332-186309354 GACATTCTGCAAGACAGGAGTGG + Intergenic
985171989 4:187160217-187160239 GAAATTATGAATGACAAGAAGGG + Intergenic
986900808 5:12431192-12431214 GAAATTATGACTAAAAAGAGTGG - Intergenic
988116295 5:26896296-26896318 GAAATTATCAGATACAGGAGAGG + Intronic
988354389 5:30153858-30153880 AAAATTATAACATACAAGAGTGG + Intergenic
989078022 5:37585785-37585807 GAGATTATGACAGGCAGGGCAGG - Intronic
989518984 5:42378452-42378474 GAAAGTATGGCAGAGAAGAGTGG + Intergenic
990653805 5:57932457-57932479 GAAATGGTGAGAGAGAGGAGTGG + Intergenic
991363648 5:65846022-65846044 GAAAATATGGCGGCCAGGAGTGG - Intronic
991446671 5:66707592-66707614 GAAATTAGGACAGCCAGGCATGG - Intronic
992712326 5:79471743-79471765 GAAGTTAAGACAGGGAGGAGGGG - Intronic
994257815 5:97620800-97620822 GAAATTATCACAAACAGTTGAGG - Intergenic
995009982 5:107246346-107246368 GAAATAAAGACAAACAGAAGTGG + Intergenic
1001290016 5:170450412-170450434 GAAAGGAAGACAGACAGGGGTGG - Intronic
1002452133 5:179325221-179325243 GAAATGATGATGGTCAGGAGGGG + Intronic
1004001847 6:11603275-11603297 GTAATTATATAAGACAGGAGAGG + Intergenic
1005048450 6:21664142-21664164 GAAAATGTGCCAGACAGGAGTGG + Intergenic
1006152328 6:31996172-31996194 GAAAAGATGTCAAACAGGAGGGG - Intronic
1006158629 6:32028910-32028932 GAAAAGATGTCAAACAGGAGGGG - Intronic
1006332787 6:33404299-33404321 GAAAGCAAGACAGTCAGGAGTGG - Intronic
1006911031 6:37563777-37563799 CAGAATAGGACAGACAGGAGAGG - Intergenic
1007119405 6:39367702-39367724 GAAATTATGTCAGGAAGGAGGGG - Intronic
1007126842 6:39432816-39432838 AAAATAATAACAGACAGTAGAGG + Intronic
1007802593 6:44409386-44409408 CAAATTATAACAGACAATAGGGG - Intronic
1008717039 6:54301303-54301325 CAAATTAAGACAGCCTGGAGAGG - Intergenic
1009487724 6:64246190-64246212 GAAATTAAGAAAGAAAAGAGAGG - Intronic
1009520316 6:64673657-64673679 GAAAATATCACATCCAGGAGAGG - Intronic
1009537946 6:64914052-64914074 AAAATTCTAGCAGACAGGAGGGG + Intronic
1009537951 6:64914092-64914114 AAAATTCTAGCAGACAGGAGGGG + Intronic
1010361229 6:74996894-74996916 TAAATTTTCACAGACAGCAGAGG + Intergenic
1011443276 6:87409669-87409691 AAAATAATGAAAAACAGGAGAGG + Intronic
1012990753 6:105923273-105923295 GAGATCAAGAAAGACAGGAGAGG + Intergenic
1014150182 6:118045511-118045533 GAAATTAAGACACACAGCTGTGG - Intronic
1015613293 6:135048973-135048995 GAAATTATAAAAGTCAGAAGGGG + Intronic
1017115671 6:150974311-150974333 GTAACAATGACAGCCAGGAGTGG - Intronic
1018404575 6:163465336-163465358 GAAATAAAGGCAGCCAGGAGTGG + Intronic
1019087150 6:169489371-169489393 GAGACTATGGCAGACAGCAGTGG + Intronic
1021285498 7:18776702-18776724 GATATTAGGATAGACAGGTGAGG + Intronic
1022474391 7:30700363-30700385 GGAATTGAGACAGGCAGGAGGGG + Intronic
1022537219 7:31105705-31105727 CAGATTAGGACAGACAAGAGAGG + Intronic
1022875598 7:34525338-34525360 GAAACTCTCAAAGACAGGAGTGG - Intergenic
1023545158 7:41310949-41310971 GTCATTAAGAAAGACAGGAGTGG + Intergenic
1026371460 7:69704030-69704052 AAAAGGATGACAGAGAGGAGAGG - Intronic
1026729949 7:72902823-72902845 GAAAATATCATAGACAGGTGAGG - Intronic
1027114033 7:75464300-75464322 GAAAATATTATAGACAGGTGAGG + Intronic
1027286283 7:76648904-76648926 GAAAATATTATAGACAGGTGAGG + Intergenic
1027681777 7:81231751-81231773 CAAATTATGTCTGACAGGAGAGG + Intergenic
1028354827 7:89894013-89894035 GAATTAATCACAGACAGGATAGG - Intergenic
1028370034 7:90081241-90081263 GAAATTATTACAGCAAGGAAAGG + Intergenic
1028565336 7:92224306-92224328 AAACTAATGACAGCCAGGAGCGG + Intronic
1028942871 7:96544180-96544202 GAAATTATGAAATAAAGGACAGG - Intronic
1029887954 7:103892955-103892977 GAAATTTTGAAAGAGAAGAGAGG + Intronic
1031349309 7:120709566-120709588 GAAATGACGACATAGAGGAGAGG - Intronic
1031397317 7:121288999-121289021 CTAAATATGATAGACAGGAGAGG - Intronic
1031736562 7:125370140-125370162 GAAAATATCACAGAAAGCAGAGG - Intergenic
1032131761 7:129234794-129234816 GAAATTCTTTAAGACAGGAGAGG - Intronic
1032458416 7:132091864-132091886 GATATCATGGCAAACAGGAGAGG - Intergenic
1034289373 7:149916824-149916846 GAAATCAGGAAAGACAGAAGAGG + Intergenic
1034661694 7:152776002-152776024 GAAATCAGGAAAGACAGAAGAGG - Intronic
1037269349 8:17109117-17109139 GGAATAAGGACAGCCAGGAGAGG - Intronic
1038902874 8:31863787-31863809 GAAATAATGGCAGAGAGGAAGGG - Intronic
1041025985 8:53687486-53687508 GTATTTATCACAGACAAGAGTGG - Intergenic
1041362525 8:57067797-57067819 GAAATTATGAAAGACTGAAATGG + Intergenic
1041802462 8:61814639-61814661 GAAAGAAAGACACACAGGAGAGG + Intergenic
1044171145 8:89053361-89053383 GAAAGTTTGAGAGACAGGTGAGG + Intergenic
1044845569 8:96377158-96377180 GAAATTGTGACCGTCAGTAGGGG + Intergenic
1046274930 8:111946286-111946308 GAAATTATGATAGACAGGATGGG + Intergenic
1048472283 8:134713856-134713878 GAGATAATGACAGATAGGAATGG - Intergenic
1049528536 8:143142051-143142073 GTCATTATGAGAGACAGTAGAGG + Intergenic
1050758431 9:9036750-9036772 GAAATGGGGACAAACAGGAGAGG - Intronic
1052386544 9:27829911-27829933 GAGATTATTACAGTCAGGAAGGG + Intergenic
1052793894 9:32904344-32904366 GAAATAACAACAGAAAGGAGAGG + Intergenic
1054958807 9:70944071-70944093 GAAATTATTTTAGCCAGGAGTGG - Intronic
1055408579 9:76002364-76002386 AAAATTATGTGATACAGGAGAGG + Intronic
1055993908 9:82136797-82136819 TGAAAGATGACAGACAGGAGAGG - Intergenic
1057611252 9:96545751-96545773 GAAATCATCACAGATTGGAGCGG - Intronic
1057633065 9:96736353-96736375 GAGACTCTGTCAGACAGGAGAGG - Intergenic
1060300066 9:122369875-122369897 GAAATTATGCCAGGTGGGAGAGG - Intergenic
1060682966 9:125581900-125581922 GAACTGAAGACAGATAGGAGTGG - Intronic
1187590773 X:20714706-20714728 GAAATTATAAGAGACAGAAAAGG - Intergenic
1188580522 X:31706520-31706542 GAGATTATGAAAGAGAGGAGAGG - Intronic
1188584850 X:31761239-31761261 GAGATTATGAGAGACAAGAGTGG + Intronic
1188600846 X:31961852-31961874 GAAATTATGAAAAACAGGGTTGG + Intronic
1191567816 X:62561714-62561736 GAAAATCTGAAAGAAAGGAGGGG + Intergenic
1192475637 X:71439538-71439560 GAAAATATGGGAGACAGGAGTGG - Intronic
1195060324 X:101187988-101188010 GCAATTTTGACACACAAGAGAGG - Intergenic
1195781596 X:108471839-108471861 GAAATTATGAAAGATTAGAGTGG - Intronic
1197893784 X:131289530-131289552 GAAACTCTGAGAGACAGGCGAGG - Intronic
1199515114 X:148667609-148667631 CACATTATGGCAGACAAGAGAGG + Intronic
1199819756 X:151432911-151432933 GAAAGTATGGGAGACAGGACGGG + Intergenic
1201233866 Y:11891733-11891755 GGAATTATGACTGACAGAAGGGG + Intergenic
1201771416 Y:17620462-17620484 GAAATTTAGAGATACAGGAGTGG - Intergenic
1201830139 Y:18285524-18285546 GAAATTTAGAGATACAGGAGTGG + Intergenic