ID: 977537404

View in Genome Browser
Species Human (GRCh38)
Location 4:98270820-98270842
Sequence GAGTAGGCTGAGAAGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 1, 2: 6, 3: 66, 4: 702}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977537404_977537409 -4 Left 977537404 4:98270820-98270842 CCCCTCCTCTTCTCAGCCTACTC 0: 1
1: 1
2: 6
3: 66
4: 702
Right 977537409 4:98270839-98270861 ACTCAAGAGTGACTATAATAAGG 0: 1
1: 0
2: 0
3: 12
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977537404 Original CRISPR GAGTAGGCTGAGAAGAGGAG GGG (reversed) Intronic
900185407 1:1331006-1331028 CAGCAGGCTGTGGAGAGGAGAGG - Intergenic
900720174 1:4170873-4170895 GAGAAGGGTGAGAAGAAGAGGGG - Intergenic
900908625 1:5578343-5578365 GAGAAAGGAGAGAAGAGGAGAGG - Intergenic
901167275 1:7229569-7229591 GAGGAGGGTGAGGAGAGGAGGGG + Intronic
901911556 1:12462907-12462929 CATTGGGCTGAGATGAGGAGTGG - Intronic
902262374 1:15236369-15236391 GACTGGGCTGAGAACAGGAAAGG - Intergenic
902700273 1:18167601-18167623 GATTAGGCTGAGAAGGCGTGGGG + Intronic
903478788 1:23638246-23638268 CAGTAGGCTGGGAGAAGGAGGGG + Intronic
903528837 1:24013945-24013967 GAGATGGCTAAGAAGAGGGGAGG + Intergenic
904237858 1:29125525-29125547 GAGTGGGATGAGAGGGGGAGAGG - Intergenic
904695872 1:32331002-32331024 GACTAGTATCAGAAGAGGAGCGG - Intronic
904808451 1:33147740-33147762 GAGGAGGGAGAGAAGATGAGTGG + Intronic
905296239 1:36956155-36956177 GCTTAGTCTGAGAAGGGGAGAGG - Intronic
905323766 1:37135823-37135845 TTGGAGGCTGGGAAGAGGAGTGG - Intergenic
905380372 1:37557486-37557508 AAGTAGGCTAGGAAGAGGGGAGG + Intronic
905624348 1:39477611-39477633 GAGTGGTCTGAGGGGAGGAGTGG + Intronic
905632888 1:39528632-39528654 AAGGAGGCTGTGAAAAGGAGAGG + Intergenic
906096731 1:43229083-43229105 TAGCAGCCTGAGAAGATGAGAGG + Intronic
906155672 1:43612624-43612646 GGGCTGGCGGAGAAGAGGAGGGG - Intronic
906479095 1:46188746-46188768 GAGAAGGCTGAGAGGAGGCCTGG + Exonic
906521530 1:46469658-46469680 GGGGTGGGTGAGAAGAGGAGAGG + Intergenic
906545251 1:46615757-46615779 GTGGAGACAGAGAAGAGGAGGGG + Intronic
907045919 1:51299965-51299987 GAGTAGGAGGTGATGAGGAGGGG + Intronic
907096000 1:51781504-51781526 GAGTAGGATGAGATGAGGATGGG + Intronic
907188377 1:52629427-52629449 GGGCAGGAGGAGAAGAGGAGGGG + Intergenic
907242483 1:53088422-53088444 GAGCTGGCTTAGTAGAGGAGGGG + Intronic
907517441 1:55001528-55001550 GAGGAGGCTGAGGGGAGGACAGG - Intronic
907717599 1:56941869-56941891 GTGTAGGGTGAGTGGAGGAGAGG - Intronic
907923027 1:58930833-58930855 CATTCGGCAGAGAAGAGGAGGGG - Intergenic
908143101 1:61208345-61208367 GAGTGAGCTCAGAAGAGGAAGGG + Intronic
909729633 1:78875720-78875742 GAATAAGGTGAGAAGCGGAGAGG - Intergenic
909829947 1:80175291-80175313 GGGTAAGCTGAGAAGATCAGAGG + Intergenic
909861025 1:80606177-80606199 GTGAAGGCTCAGAAGAAGAGAGG + Intergenic
910321786 1:85954778-85954800 GAGTAGCCTAAAAACAGGAGGGG + Intronic
910413150 1:86967444-86967466 CAGTAGGGGGAGAAGGGGAGGGG - Intronic
910442291 1:87265366-87265388 GAGTAAGGTGGGAAGTGGAGAGG - Intergenic
910875860 1:91877180-91877202 GGGTAGGCTAGGAAAAGGAGAGG - Intronic
912045248 1:105445656-105445678 GAGTATTCAGAGAGGAGGAGAGG - Intergenic
912170551 1:107094156-107094178 GAGTAGGCTGAGGGGAAGGGAGG - Intergenic
913339216 1:117740961-117740983 GTGGAGGCTGAGAAAAGCAGGGG + Intergenic
914266194 1:146040261-146040283 GAGGAGGCGGAGGAGAGAAGCGG + Intergenic
915489629 1:156243969-156243991 GAGAGGGCAGAGAAGAGGAGGGG - Exonic
915641540 1:157230972-157230994 CATGAGGCTGAGGAGAGGAGAGG - Intergenic
915701823 1:157803795-157803817 GGATAGGCTGAGAAGGGCAGTGG - Intronic
915997157 1:160575141-160575163 CAGTGGGTGGAGAAGAGGAGAGG - Intronic
916844227 1:168631957-168631979 GAGTAGGGTGAGCTCAGGAGAGG - Intergenic
917623150 1:176818681-176818703 GATTAGGCTGTGAAGAGGCAGGG - Intronic
917979218 1:180259099-180259121 GGGTGGGCAGAGAAGAGGTGTGG + Intronic
918131730 1:181635380-181635402 GAGAGGGAGGAGAAGAGGAGTGG - Intronic
919172447 1:193972466-193972488 GAGTAGGCTGAGAAGGAGGAGGG - Intergenic
919724359 1:200872588-200872610 GTGGAGGCTGAGAAGAGGTTAGG + Intergenic
919797745 1:201331599-201331621 GAGGAGGCTGAGAAGGGGTGAGG - Exonic
920693904 1:208167223-208167245 GAAAAGGCTGAGAGGAAGAGAGG + Intronic
921335947 1:214086498-214086520 GAGAAGGCTGAGAAGAAGATAGG - Intergenic
921746147 1:218742858-218742880 CTGTGGGCAGAGAAGAGGAGAGG + Intergenic
921799341 1:219383990-219384012 AGGTTGGCTGGGAAGAGGAGGGG - Intergenic
922122969 1:222692183-222692205 GAGGATGCGGAGAAGGGGAGAGG + Intronic
922532265 1:226353474-226353496 AAGTAGGACAAGAAGAGGAGAGG + Intergenic
922757678 1:228105555-228105577 GAGGAGGCTGGGTAGTGGAGGGG + Intergenic
922858139 1:228792730-228792752 GACTAGGTTGAAGAGAGGAGAGG + Intergenic
923051805 1:230395163-230395185 GAGGAGTGTGAGGAGAGGAGGGG - Intronic
923051865 1:230395364-230395386 GAGGAGCATGAGGAGAGGAGGGG - Intronic
923051936 1:230395594-230395616 GAGGAGCATGAGGAGAGGAGGGG - Intronic
923051970 1:230395711-230395733 GAGGAGTGTGAGGAGAGGAGGGG - Intronic
923441425 1:234024306-234024328 GAAGATGCTGAGAACAGGAGTGG + Intronic
923510765 1:234650493-234650515 GAGTAGGCTGAGCAGTGGGGAGG + Intergenic
923791787 1:237117655-237117677 GAGAAGGAAGAGAAGAGAAGAGG - Intronic
923908782 1:238415790-238415812 GAGAAGAGAGAGAAGAGGAGAGG + Intergenic
924799595 1:247318104-247318126 GAATAGGCTCAGCTGAGGAGGGG + Intronic
1063649352 10:7917910-7917932 GAGAAGACCGAGGAGAGGAGTGG + Intronic
1064086753 10:12350918-12350940 GATTAGGCTGGGAAGAGAAAGGG + Intronic
1064772730 10:18740639-18740661 GAGTTGACTGTGAAGAGGAAAGG + Intergenic
1065193011 10:23232339-23232361 GAATAGGCTGAGAAAAGGCTAGG + Intronic
1066585598 10:36930976-36930998 GAGTAGGGTAACAAGAGAAGTGG + Intergenic
1068630237 10:59290551-59290573 GAGTAGGGTCTGAGGAGGAGGGG - Intronic
1069073073 10:64010038-64010060 GAGTAGGGTGAGAAGAGCAAAGG - Intergenic
1069094540 10:64242662-64242684 GAGTAGGCTGAGGAGAAGGAAGG - Intergenic
1069449053 10:68501525-68501547 GAGAAAGAGGAGAAGAGGAGAGG + Intronic
1069546817 10:69334858-69334880 GGGGATGCTGAGGAGAGGAGTGG + Intronic
1069817928 10:71210332-71210354 GGTTAGGCTGAGAAGGGAAGTGG + Intergenic
1070604020 10:77885895-77885917 GAGCAGGATGAGAGGAGGAAGGG + Intronic
1070622792 10:78026700-78026722 GTGTAGGATGAGAAGATAAGAGG - Intronic
1070711874 10:78689014-78689036 GAGGAGGGAGAGGAGAGGAGAGG - Intergenic
1070938720 10:80323492-80323514 GGGTATACTCAGAAGAGGAGAGG - Intergenic
1070959753 10:80490350-80490372 GTGTTGACTGAGAAGAGGAGAGG + Intronic
1071007100 10:80895394-80895416 GAGTAAGGTGAGCAGAGGTGGGG - Intergenic
1071146895 10:82585531-82585553 GTGTAGCCGGAGAAGAGGGGTGG - Intronic
1071310579 10:84339798-84339820 GAGAAGGCTGAGAAGATGAATGG - Intronic
1072171440 10:92865971-92865993 GAGTAGGCTGAGGAGGAGATGGG + Intronic
1072585460 10:96777726-96777748 GAGAAGGGTGAGAAGGGGTGAGG + Intergenic
1073078884 10:100844110-100844132 GAGTAGGCTGAGGAGAAGGAGGG - Intergenic
1073099737 10:101000225-101000247 TAGTGGGCTGAGGAGAGCAGAGG - Exonic
1074497937 10:113996284-113996306 CAGTAGGAGGACAAGAGGAGGGG - Intergenic
1074690227 10:115997744-115997766 GTTTAGGATGAGAAGAGGTGGGG + Intergenic
1075880690 10:125848238-125848260 GAGTTGGCTCTGAAGAGGACAGG + Intronic
1075908874 10:126106267-126106289 GAGGAGGCTGAGATGGGCAGAGG - Intronic
1076802229 10:132835982-132836004 GAGCAGGGCGAGAAGGGGAGGGG - Intronic
1077282141 11:1750652-1750674 GACTAGGCTGGAAAGAGGAGGGG - Intronic
1078019022 11:7640140-7640162 GAGGAGGAAGAGAAGAAGAGAGG - Intronic
1078084947 11:8228333-8228355 AAGGAGGCTGAGAAGAGGGTGGG + Intronic
1078148393 11:8738134-8738156 GAGTAGGCAACGAAGAGGTGGGG + Intronic
1078565164 11:12408334-12408356 GAGAGGGCTGAGAACAGGAGAGG - Intronic
1081278104 11:41175890-41175912 GGCTAGGCTGAGAAGAGGAAAGG - Intronic
1081566589 11:44264519-44264541 AACTAGGCAGAGCAGAGGAGTGG + Exonic
1081818286 11:45966024-45966046 AAGGAGACTGAGAGGAGGAGTGG - Intronic
1082223893 11:49677673-49677695 GAGGAGGAGGAGAGGAGGAGAGG - Intergenic
1083262532 11:61530994-61531016 GAGGTGTCTGAGAAGAGGCGAGG - Intronic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1084014364 11:66369930-66369952 GAGGAGGTTAAGCAGAGGAGTGG - Intronic
1084529261 11:69717459-69717481 GAGGAGGAGGAAAAGAGGAGGGG - Intergenic
1084741711 11:71144295-71144317 GAGTAGGCTGGGAAACGCAGTGG - Intronic
1084754998 11:71232543-71232565 GAGGAGGAGGAGGAGAGGAGGGG - Intronic
1084950010 11:72659675-72659697 GAGGAGGATGGGGAGAGGAGTGG + Intronic
1085036338 11:73302463-73302485 TAGTAGGCGGAGAAGAGAAGAGG + Intergenic
1085279366 11:75320116-75320138 GAGGAGGAAGAGAAGAGGTGAGG + Intronic
1085350450 11:75795000-75795022 GAGAAGGGAGAGGAGAGGAGAGG - Intronic
1085849967 11:80108788-80108810 GAGTAGGGTGAGCAGAAAAGAGG + Intergenic
1085982954 11:81746688-81746710 GAGTAGCCAGAGAAAATGAGGGG + Intergenic
1086200495 11:84195467-84195489 GGGTAGGCGGAGAAGAGTAGAGG - Intronic
1086269595 11:85045370-85045392 GCCTAGGCAGAGAAGAGGAATGG + Intronic
1086407519 11:86511334-86511356 GTGTGGAGTGAGAAGAGGAGTGG - Intronic
1086437093 11:86792207-86792229 GAGTAGGAAGAGAAGAGGTCAGG + Intronic
1086554763 11:88096090-88096112 GAAGATACTGAGAAGAGGAGTGG - Intergenic
1086625160 11:88941550-88941572 GAGGAGGAGGAGAGGAGGAGAGG + Intronic
1086663844 11:89455903-89455925 GAATAGGCTGAGAAGAGTAGTGG + Intronic
1087832841 11:102838286-102838308 GAATAGGTTGAGGAGAGAAGAGG + Intronic
1087929284 11:103957712-103957734 CAGCAAGCTGAGAAGAGAAGGGG + Intronic
1088842689 11:113639999-113640021 GGTTAGGGTGAGACGAGGAGAGG + Intergenic
1089364245 11:117911363-117911385 GAATGGGCCGAGTAGAGGAGCGG + Intronic
1089729949 11:120513101-120513123 GGGTTGTCTGGGAAGAGGAGGGG + Intronic
1089953505 11:122550377-122550399 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1090007206 11:123013195-123013217 GAGTAGTCTGGGGAGAGGAATGG + Intergenic
1090017185 11:123096760-123096782 GTGTAGACAGAGAAGAGGAAAGG + Intronic
1091070463 11:132558298-132558320 GAGGAGGGGGAGAGGAGGAGGGG - Intronic
1091070479 11:132558330-132558352 GAGGAGGGGGAGAGGAGGAGGGG - Intronic
1091214427 11:133891952-133891974 GGGTAGACAGAGAAGAGAAGGGG - Intergenic
1091930041 12:4388776-4388798 GTGTTGGCGGAAAAGAGGAGGGG - Intergenic
1092924655 12:13262249-13262271 GAATAAGGTGAGAAGCGGAGGGG + Intergenic
1092992163 12:13913287-13913309 GAGTAGGGTGAGTACAGGAAGGG - Intronic
1093944171 12:25088009-25088031 GAGTAGGCTTAGGAGAGGACAGG + Intronic
1094825937 12:34269057-34269079 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1095229200 12:39717495-39717517 GAGTAGGCTGAGGAGGAGAAGGG + Intronic
1095454817 12:42372022-42372044 GAGTAGGGTGAGAGGGGGTGAGG - Intronic
1095473811 12:42565191-42565213 GTAGAGCCTGAGAAGAGGAGAGG + Intronic
1095937098 12:47696611-47696633 GAGTAGGCTGAGGAGGGGGAAGG - Intronic
1095984312 12:47989289-47989311 GAGTAGGCGGATGAGAAGAGAGG + Intronic
1096868522 12:54578963-54578985 GAGGAGCCTGAGGAGAGGAAGGG - Exonic
1096899602 12:54862129-54862151 TACTAGACTGAGGAGAGGAGGGG - Intergenic
1096915870 12:55032448-55032470 GAGTAGAGTGAGAATAGGTGAGG + Intergenic
1096973385 12:55684813-55684835 GGGTAGGGTGAGAAGGGCAGGGG - Exonic
1097341464 12:58443271-58443293 GAGTAGGTAGAGAGCAGGAGTGG + Intergenic
1097592494 12:61589916-61589938 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1098095591 12:66952066-66952088 GTGTAAAGTGAGAAGAGGAGAGG + Intergenic
1098304314 12:69087232-69087254 GAGTCAGGTTAGAAGAGGAGAGG + Intergenic
1098635222 12:72775829-72775851 GAAGAGGAGGAGAAGAGGAGGGG + Intergenic
1098920093 12:76294888-76294910 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1099176486 12:79428598-79428620 GCTTAGTGTGAGAAGAGGAGGGG + Intronic
1099366718 12:81774033-81774055 AAGTAGGCAGAGGTGAGGAGGGG + Intergenic
1099872988 12:88371106-88371128 GAATAAGGTGAGAAGCGGAGGGG - Intergenic
1100114002 12:91280698-91280720 GTATAGAGTGAGAAGAGGAGAGG - Intergenic
1100444007 12:94644259-94644281 GAGGAGGGTGACAAGAGAAGAGG - Intronic
1100458798 12:94778222-94778244 GGGCAGGCAGAGAAGATGAGGGG + Intergenic
1100542063 12:95567004-95567026 GAGAACGCAGAGAAGAGGAAGGG - Intergenic
1100554518 12:95679847-95679869 GAGTAAGCTGGGAAGACAAGTGG - Intronic
1100861892 12:98815294-98815316 GAGTGGGCTCAGATGAGGACAGG - Intronic
1101096483 12:101347072-101347094 GAGTAATCTGAGAAGAAGTGAGG + Intronic
1101285366 12:103306494-103306516 GAGTAGGAGAAGAAGAAGAGGGG + Intronic
1101311775 12:103587132-103587154 GAGGGGGCAGAGTAGAGGAGAGG + Intergenic
1101382217 12:104223923-104223945 GAGTAGTGTGGGAAGGGGAGAGG + Intronic
1101411323 12:104470956-104470978 GTGTAGGGTAAGAAGAGAAGGGG - Intronic
1101615386 12:106331376-106331398 GAGTAGGCTAAGCAGTGGGGTGG - Intronic
1102404367 12:112660426-112660448 GAGTAGGATGAGAAGGGAATTGG - Intronic
1102425132 12:112838175-112838197 GTGTAAGCTGAGACCAGGAGAGG + Intronic
1103018173 12:117512369-117512391 GAAAAAGCTGAGAAGAGAAGAGG - Intronic
1104049508 12:125186312-125186334 GAGGAGGAGGAGGAGAGGAGCGG - Intergenic
1104177417 12:126346379-126346401 GGGTAAGCAGAGAAGAGGACGGG - Intergenic
1104400037 12:128467766-128467788 GAGAATGCTGAGAAGAACAGAGG - Intronic
1104497860 12:129257582-129257604 GACTAGACTGAGAAGGGAAGGGG - Intronic
1104663727 12:130632585-130632607 GAGTAGGCCGAGCCGAGGACAGG - Intronic
1104707295 12:130956576-130956598 GAGAGGACTGAGAGGAGGAGAGG + Intronic
1104729647 12:131097865-131097887 GAGCAGGGTGAGCAGAGGATGGG - Intronic
1104788248 12:131465366-131465388 GAGTAGGCTGAGAGGAGGAAAGG - Intergenic
1105032424 12:132893138-132893160 GAATAAGGTGAGAAGCGGAGGGG - Intronic
1107418690 13:40225108-40225130 GTGTAGGCAGAGAAGAGAAGGGG + Intergenic
1108731132 13:53236945-53236967 GGGTAGGCAGAGAAAAGAAGGGG + Intergenic
1109343771 13:61091787-61091809 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1110601078 13:77374878-77374900 GAGCAGGCTAAGAAGGGGAGAGG - Intergenic
1110627405 13:77666833-77666855 AAGGAGGATGAGAGGAGGAGAGG + Intergenic
1111948978 13:94694789-94694811 GTGTAGACAGAGACGAGGAGAGG + Intergenic
1112751141 13:102584561-102584583 GTGTAGGCAGAAAAGAGAAGAGG + Intergenic
1113250388 13:108446172-108446194 GAGTTGGCTGGAAAGAGGACAGG + Intergenic
1113324522 13:109268770-109268792 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1113446745 13:110374728-110374750 GAGTGGGAGGAGAGGAGGAGAGG - Intronic
1113909708 13:113836313-113836335 GGGGAGGGGGAGAAGAGGAGGGG + Intronic
1114258665 14:21022690-21022712 GATTAGAGAGAGAAGAGGAGGGG + Intronic
1114272235 14:21107986-21108008 GAGGAGGAAGAGAGGAGGAGGGG + Intergenic
1114522597 14:23348413-23348435 GGGTAGTTGGAGAAGAGGAGGGG + Intronic
1114823671 14:26052069-26052091 AAGCAGGGTGAGTAGAGGAGAGG - Intergenic
1116538693 14:46069075-46069097 GAGAATTGTGAGAAGAGGAGTGG + Intergenic
1117649055 14:57883006-57883028 GAGGAGGAGGAGGAGAGGAGGGG + Intronic
1117649066 14:57883033-57883055 GAGAAGGAGGAGAAGGGGAGGGG + Intronic
1117867577 14:60165437-60165459 GAGCAGGCCGGGAGGAGGAGCGG + Exonic
1117950062 14:61073865-61073887 GAGGAGGCTGAGAAGAAGGCAGG - Intronic
1118794920 14:69133536-69133558 CAGTAGGCAGGGAAGAGGCGGGG + Intronic
1118937061 14:70298082-70298104 GAATAAGGTGAGAAGTGGAGGGG + Intergenic
1118977482 14:70690184-70690206 GTGGAGGCTGAGGAAAGGAGAGG - Intergenic
1119126910 14:72135875-72135897 GAGGAGGAGGAGAGGAGGAGGGG + Intronic
1119905862 14:78301363-78301385 AGGTAGGCAGAGAAAAGGAGAGG + Intronic
1119983738 14:79112247-79112269 GAGGGGGCTGGGAAGAAGAGAGG - Intronic
1120498056 14:85260659-85260681 GAGAGGGTTGAGAAAAGGAGAGG + Intergenic
1120649974 14:87120230-87120252 GAGTAGGCTCAGGAGTGGAGAGG + Intergenic
1120659763 14:87237321-87237343 GAATAAGGTGAGAAGCGGAGGGG + Intergenic
1121152938 14:91654085-91654107 GAGGTGGGTGAGTAGAGGAGGGG + Intronic
1121248894 14:92484737-92484759 GAGTAGGGTGTGAAAGGGAGTGG - Intronic
1121529819 14:94644408-94644430 GAGAAGGCTGAGACTGGGAGAGG - Intergenic
1121740940 14:96252061-96252083 GAGCAGGCCAAGAGGAGGAGAGG + Intronic
1122012220 14:98759646-98759668 GGGCAGGTTGAAAAGAGGAGAGG - Intergenic
1123153216 14:106202310-106202332 GAGCAGGCTGAGTAGAGTATAGG + Intergenic
1123457120 15:20436325-20436347 GAGGAGTCTTAGAAGAAGAGTGG - Intergenic
1123660942 15:22564034-22564056 GAGGAGTCTTAGAAGAAGAGTGG + Intergenic
1124159911 15:27258883-27258905 GAGGAGGCTGCGGAGAGAAGAGG - Intronic
1124314743 15:28658268-28658290 GAGGAGTCTTAGAAGAAGAGTGG + Intergenic
1124862432 15:33455394-33455416 AAGTAGTGTGAGAAGAGCAGAGG + Intronic
1125479180 15:40069092-40069114 GAGGGGGCTGAGAGCAGGAGTGG - Intergenic
1125587105 15:40828709-40828731 GAGGAGACAGAGAACAGGAGAGG + Exonic
1126207608 15:46062924-46062946 GTGAAGGCTGAGAAGGGGTGGGG - Intergenic
1126262153 15:46705666-46705688 AAGTTGGATGAGAAGAAGAGGGG - Intergenic
1126412822 15:48389556-48389578 GAGAAGGCAGGGGAGAGGAGAGG - Intergenic
1126843944 15:52742009-52742031 GAATAAGGTGAGAAGCGGAGGGG - Intergenic
1127410950 15:58706601-58706623 GAGGAGGAGGGGAAGAGGAGAGG + Intronic
1127488029 15:59437505-59437527 GAAAGGGCTGGGAAGAGGAGGGG + Intronic
1129733037 15:77942638-77942660 GTGTAGTCTGAGTGGAGGAGGGG - Intergenic
1129970568 15:79774533-79774555 CAGGAGGCAGAGAAGAGGAGAGG + Intergenic
1129980168 15:79861935-79861957 GAACAGGCTGGGAAGAAGAGGGG + Intronic
1130860931 15:87889016-87889038 GAGAAGGCTGGGAAGAGCACAGG - Intronic
1130982650 15:88823356-88823378 CAGAAGGCTGAGAACAGGAAGGG + Intronic
1131131416 15:89903126-89903148 GGGTAGGATGAGAAGACGACAGG - Intronic
1131407458 15:92176893-92176915 GAGCAGACTGAGAAGAGGTGTGG - Intergenic
1131661884 15:94526093-94526115 GAGAGGGCTGAGATGGGGAGAGG - Intergenic
1131697213 15:94890796-94890818 GAGGAAACTGAGGAGAGGAGAGG - Intergenic
1133700161 16:8301192-8301214 GAGTAAGCTGAGAAGGGGTCAGG - Intergenic
1133754474 16:8752122-8752144 GAGCAGGGGAAGAAGAGGAGGGG - Intronic
1134025002 16:10946587-10946609 GAGGTGGCTGAGGAGGGGAGGGG + Intronic
1134450349 16:14359573-14359595 GGGTAGGCAGAGAAGTAGAGAGG - Intergenic
1134751831 16:16631241-16631263 GAGGAGGAGGAGGAGAGGAGGGG - Intergenic
1135051971 16:19200793-19200815 GAGAAAGAAGAGAAGAGGAGAGG + Intronic
1135416509 16:22272526-22272548 GAGCAGGATGAGGAGAGTAGGGG + Intronic
1135613537 16:23889291-23889313 GAGGAGACTGAGACAAGGAGAGG - Intronic
1135939449 16:26808830-26808852 AATTAGGCAGAGAACAGGAGAGG + Intergenic
1136162783 16:28431628-28431650 GAGGAGGCGGAGAAGGAGAGAGG - Intergenic
1136200183 16:28683360-28683382 GAGGAGGCGGAGAAGGAGAGAGG + Intergenic
1136216531 16:28797553-28797575 GAGGAGGCGGAGAAGGAGAGAGG + Intergenic
1136395343 16:29989474-29989496 GAGAAGAGAGAGAAGAGGAGAGG - Intronic
1137645255 16:50067526-50067548 TAGGTGGCTGAGAAGAGCAGGGG + Intronic
1138204447 16:55114594-55114616 GAGTGGTCTGAGAACAGAAGTGG + Intergenic
1138435195 16:56994756-56994778 AAGAAAGCAGAGAAGAGGAGAGG + Intronic
1138952756 16:61933283-61933305 GAGGAGAGTGACAAGAGGAGAGG + Intronic
1138988482 16:62361438-62361460 AAGAAGGATGGGAAGAGGAGGGG + Intergenic
1139144486 16:64307572-64307594 GAGGAGGGAGAGAACAGGAGAGG + Intergenic
1139328229 16:66168015-66168037 GAGAAGGCTGAGAGGAGGGGAGG + Intergenic
1139687134 16:68612762-68612784 CAGGAGGAGGAGAAGAGGAGAGG + Intergenic
1139935128 16:70564996-70565018 GGGCTGGCTGAGAAGAGGATAGG - Intronic
1140020090 16:71230417-71230439 GGGAAGGCTGAGGAGGGGAGGGG + Intronic
1140724515 16:77800024-77800046 GAGAAAGCTGAGATGAGGAAGGG - Intronic
1141372410 16:83500405-83500427 GAGGGGGAGGAGAAGAGGAGGGG - Intronic
1142718996 17:1763754-1763776 GGGTAGGCTGAGGTGAGGTGAGG - Intronic
1143123612 17:4626094-4626116 CAGTAGGCTCGGAAGAGCAGAGG - Intergenic
1143179318 17:4974274-4974296 GAGGAGGCTGGGGACAGGAGAGG + Intronic
1143754353 17:9055645-9055667 GAGGAAGGTGGGAAGAGGAGAGG + Intronic
1144002993 17:11072952-11072974 CAGGAGGGAGAGAAGAGGAGGGG - Intergenic
1144312592 17:14026534-14026556 GAGTTGGTTGAAAAGAAGAGAGG - Intergenic
1144332163 17:14234791-14234813 GAGTTGGTTGAAAAGAAGAGAGG + Intergenic
1145741540 17:27279055-27279077 GAGAAGGCAGAGAGGTGGAGAGG - Intergenic
1146625612 17:34432799-34432821 GAGGTGGGTGTGAAGAGGAGGGG - Intergenic
1147594230 17:41706314-41706336 GAGGAGGCTCAGGAGAGAAGCGG + Intergenic
1147769548 17:42858008-42858030 CAGTAGGTTGAGGACAGGAGAGG + Exonic
1147909552 17:43847348-43847370 GAGGAGGCTGAGGATAGGTGGGG - Intronic
1148148880 17:45384426-45384448 GAGTGAGCTGAGCAGAGGAGAGG + Intergenic
1148464156 17:47854948-47854970 GAGTATGGTGGGGAGAGGAGGGG - Intronic
1148568438 17:48647367-48647389 AAGGAGGCTGAGAAGGGGAGGGG + Intergenic
1148753781 17:49961781-49961803 AAGATGGCTGAGAAGAGGAGGGG - Intergenic
1148785791 17:50145655-50145677 GAACAGGCTGAGCAGAAGAGGGG + Intronic
1148869266 17:50646555-50646577 AAGGAGGCAGAGAAGAGGAAAGG + Intronic
1148984961 17:51613316-51613338 GAGAGGGGGGAGAAGAGGAGGGG - Intergenic
1149114985 17:53082529-53082551 GTGTGGGATGAGAAGAGTAGAGG + Intergenic
1149680727 17:58505300-58505322 GTGTTGGCTGAGAAGTGGAAGGG + Intronic
1149892548 17:60402955-60402977 GAGCATCCTGAAAAGAGGAGGGG + Intronic
1150089452 17:62310054-62310076 GAGGAGGAGGAGAGGAGGAGAGG - Intergenic
1150241209 17:63634397-63634419 GACGAGGCTGGGAAAAGGAGGGG + Intronic
1150556878 17:66262628-66262650 GATTGGGAGGAGAAGAGGAGAGG - Intergenic
1150624063 17:66830192-66830214 TAGTGGGCTGTGGAGAGGAGAGG + Intergenic
1150868834 17:68881925-68881947 GAGTATGCAGGGAAGAGGAAAGG - Exonic
1151589976 17:75036845-75036867 GACTGGGCAGAGATGAGGAGCGG - Intronic
1152493655 17:80654980-80655002 GAGGAGGATTAGAAGAGGAATGG - Intronic
1153001352 18:458436-458458 GGGTGGGCTGAGGAGGGGAGAGG + Intronic
1153575550 18:6516614-6516636 GAGGAGGAGGAGAAGAAGAGTGG + Intronic
1155375610 18:25153788-25153810 GAGAAGGAGGAGAAGAGGAATGG - Intronic
1156422193 18:36966969-36966991 GAGAACGATGAGAAGAGTAGAGG + Intronic
1156916009 18:42464997-42465019 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1157392740 18:47316566-47316588 GAGTATCCAGAGAAGTGGAGTGG - Intergenic
1157439110 18:47696800-47696822 GAGGAGACAGTGAAGAGGAGTGG - Intergenic
1157701393 18:49763192-49763214 GAGGAGGAGGAGAGGAGGAGAGG - Intergenic
1157944424 18:51962885-51962907 GAGTAGACTGAGAAGATAAGAGG + Intergenic
1158391872 18:57051079-57051101 GAGGAGGGTGAGAAAAGGAAGGG + Intergenic
1158742514 18:60159685-60159707 GAGTTAGCTGAGAGGTGGAGTGG + Intergenic
1158938195 18:62384356-62384378 GAGGAGGAGGAGAGGAGGAGGGG - Intronic
1159246763 18:65815848-65815870 GAGTAGGCATAGAAGGGAAGAGG - Intronic
1160171262 18:76557387-76557409 GAGTAGGCTGAGCAGTGAGGTGG - Intergenic
1160425944 18:78779314-78779336 GAGTAGGCTGGGGAGGAGAGAGG - Intergenic
1160927141 19:1552178-1552200 GGGGAGGCTGGGGAGAGGAGAGG - Intergenic
1161195398 19:2983607-2983629 GAGCAGAGTGAGAGGAGGAGGGG + Intronic
1161846493 19:6714150-6714172 GAGTACGGTAAGAGGAGGAGGGG - Exonic
1162038115 19:7953401-7953423 GAGGAGGAGGAGGAGAGGAGGGG - Intergenic
1162529771 19:11229158-11229180 GAGGAGGGGGACAAGAGGAGTGG + Intronic
1162959423 19:14117391-14117413 GGGTAGGCAGAGAGGATGAGGGG + Intronic
1162965388 19:14153130-14153152 GAGGAGGTGGAGAAGAGGATGGG - Intronic
1163051604 19:14689075-14689097 GAGTAGGCTGAGGAAAGGGAGGG - Intronic
1163167087 19:15506017-15506039 AGGTGGGCAGAGAAGAGGAGGGG - Intergenic
1163430614 19:17264909-17264931 TTGGAGGCTGAGAAGAGGAGGGG - Intronic
1163597647 19:18229677-18229699 GAGTAAACTGAGACGTGGAGAGG + Intronic
1163900015 19:20092901-20092923 GAATAAGGTGAGAAGCGGAGGGG + Intronic
1164249731 19:23466289-23466311 GAGGAGGAGGAGATGAGGAGAGG - Intergenic
1164292538 19:23880880-23880902 GAGGAGGATGAGAGGAGGAATGG + Intergenic
1164302412 19:23973480-23973502 GAGTAGGAGGAGAGGAGGAGAGG + Intergenic
1164302423 19:23973526-23973548 GACGAGGATGAGAGGAGGAGGGG + Intergenic
1164324609 19:24180548-24180570 GAGTAGGAGGAGAAAAGGAGAGG + Intergenic
1164324669 19:24180899-24180921 GAGGAGGATGAGAGCAGGAGAGG + Intergenic
1165135080 19:33662691-33662713 GAGGAGGGGAAGAAGAGGAGAGG + Intronic
1165652197 19:37501330-37501352 AAGTAGCCTGGGATGAGGAGAGG - Intergenic
1166042513 19:40212539-40212561 GGTTAGGCTGTGAAGAGGAGGGG + Intronic
1166592102 19:44008702-44008724 GAGCAGGCGGAGAGGAGAAGTGG - Intronic
1166840806 19:45695804-45695826 GAGTAGAGTGGGAAGACGAGAGG - Intronic
1167214274 19:48154069-48154091 GTGCAGGCAGAGAAGGGGAGAGG - Intronic
1167464747 19:49644881-49644903 GAGGAGGTGGAGGAGAGGAGGGG + Intronic
1167741813 19:51328579-51328601 GAGTGGGCTCAGAAGAGATGGGG + Intronic
1168349893 19:55669731-55669753 GAGGGCGCGGAGAAGAGGAGGGG - Intronic
1168349906 19:55669784-55669806 GAGCGCGCGGAGAAGAGGAGGGG - Intronic
1168389423 19:55993589-55993611 GGGGAGGTTGAGAGGAGGAGGGG - Intergenic
1168467266 19:56613234-56613256 GAGTAGTCTGTGAAGAGAACTGG - Intronic
1168525775 19:57087786-57087808 GGGAAGGGAGAGAAGAGGAGAGG + Intergenic
1168569435 19:57453213-57453235 GAGGAGGAGGAGAGGAGGAGAGG - Intronic
925128201 2:1476769-1476791 GAGCAGGCTGAGGGGAGGTGCGG + Intronic
925619072 2:5773258-5773280 GAGTTAGCAGAGGAGAGGAGAGG + Intergenic
926010087 2:9400403-9400425 GAGGAGGGTGAGAGGAGGGGAGG - Intronic
926890306 2:17633838-17633860 GAGCAGGCTGAGAAGACAAGGGG + Intronic
927086202 2:19676036-19676058 GCGTGGGCTGAGAAGTGGTGAGG - Intergenic
927269588 2:21191756-21191778 GAGGGGGGAGAGAAGAGGAGAGG - Intergenic
928430653 2:31215698-31215720 GAGTGGGCTTGGGAGAGGAGGGG - Intronic
929751535 2:44719250-44719272 GGGTAGGCTGAGAAGGCAAGGGG - Intronic
930667238 2:54111383-54111405 GAGTATGCTGAAGTGAGGAGAGG - Intronic
932330089 2:70893886-70893908 GAGAAGGCAGAAAAGAAGAGGGG + Intergenic
932367049 2:71160219-71160241 GAATAAGGTGAGAAGCGGAGGGG + Intergenic
932702294 2:74000205-74000227 GAGAAGGCTGACCAGAAGAGGGG + Intronic
933457980 2:82541282-82541304 GAGGAGGTGGAGAAGTGGAGAGG - Intergenic
933726629 2:85430869-85430891 GAGTGGGAAGGGAAGAGGAGGGG + Intronic
935710913 2:105897238-105897260 GTGGAGGCTGGGAAGAGGAAGGG - Intergenic
936339743 2:111620711-111620733 GAGAAGGATGAAAGGAGGAGTGG - Intergenic
936444047 2:112582306-112582328 GAGTAGGCTGAGGAGAGGAAGGG + Intergenic
936514701 2:113174277-113174299 GAGAAGGGTCAGATGAGGAGGGG - Intronic
936592540 2:113817852-113817874 GATTTGGGAGAGAAGAGGAGAGG - Intergenic
937071125 2:119064336-119064358 GAGTGGGGTGAGGAGTGGAGAGG - Intergenic
937370896 2:121296485-121296507 GAGGGGGCTGAGGTGAGGAGGGG + Intergenic
938083564 2:128383421-128383443 GAGTAGACTGAGGAGGAGAGGGG - Intergenic
938930647 2:136083835-136083857 GAGTGGGCTGAGGAGAGAAAAGG - Intergenic
939957695 2:148540329-148540351 GCGTAGGCTGAGAGGAAGAAAGG - Intergenic
940183892 2:150961735-150961757 GAATAAGGTGAGAAGCGGAGGGG - Intergenic
941038203 2:160590533-160590555 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
941456001 2:165712782-165712804 GAATAAGGTGAGAAGCGGAGGGG + Intergenic
941538196 2:166747654-166747676 GATGTGGCTGAGAAGAGCAGAGG - Intergenic
942110943 2:172682257-172682279 GAGCAGGGGGAGAATAGGAGAGG + Intergenic
942112486 2:172695875-172695897 GAGTAAGCTTAGAAGAGGCTGGG + Intergenic
942183241 2:173400840-173400862 GAGAAAGGAGAGAAGAGGAGGGG - Intergenic
942211735 2:173677950-173677972 GAGTGGGGCGAGAATAGGAGTGG + Intergenic
943067869 2:183107546-183107568 GAGTAGGCTGAGGAGAAGGAGGG + Intergenic
943557158 2:189419872-189419894 GAGGAGGAGGAGGAGAGGAGAGG + Intergenic
943579824 2:189672200-189672222 GAGTAGGCTGAGGAGGAGAAGGG - Intergenic
944073278 2:195697051-195697073 GAGTAGGCTGAGGACAGAGGTGG + Intronic
944251224 2:197581533-197581555 GAATAAGGTGAGAAGTGGAGGGG - Intronic
944952728 2:204770761-204770783 GAGAAGGGTGAGCAGAGGATGGG - Intronic
944956637 2:204819867-204819889 ACGAAGGCTGAGAAGAGGTGAGG + Intronic
945060554 2:205905093-205905115 GAAGAGGCTGGGAGGAGGAGGGG - Intergenic
945199832 2:207270468-207270490 GTGTGGGCTGAGAAAAAGAGAGG - Intergenic
945548625 2:211190435-211190457 AATTAGGCTGGGAAGAGGACTGG - Intergenic
945614703 2:212053405-212053427 GAGGAGGAAGGGAAGAGGAGGGG - Intronic
945960216 2:216125717-216125739 GAGTTGGCTTAGAAGGGAAGAGG - Intronic
946189991 2:218003057-218003079 GAGGAGGCTGGGACGAGGGGTGG - Intergenic
946767037 2:223050455-223050477 GAGTAGGCAGAAAGGAGGTGGGG - Intergenic
946776104 2:223142851-223142873 GAGCAGGGTGAGATGGGGAGTGG - Intronic
946851344 2:223909704-223909726 AAGTTGGCTGTGTAGAGGAGAGG - Intronic
947549972 2:231038523-231038545 GGGTGGGGAGAGAAGAGGAGTGG + Intronic
947698278 2:232211151-232211173 GACTCTGTTGAGAAGAGGAGGGG - Intronic
948329059 2:237150818-237150840 GAGTAGGCTGAGTCCAGGAGAGG + Intergenic
948598620 2:239096032-239096054 GAGCAGGCTGAGAATGGGAGAGG - Intronic
948696323 2:239734849-239734871 GAGAAGGCTCAGCAGAGGGGTGG - Intergenic
948748215 2:240110816-240110838 GAGGAGGAAGAGAGGAGGAGGGG - Intergenic
1168863529 20:1063835-1063857 GACAAGGTTGAGAAGAGGACAGG - Intergenic
1168979499 20:1992677-1992699 GACTGGGGGGAGAAGAGGAGGGG + Intronic
1169438126 20:5611194-5611216 GGGTCGGCTGAGAAGGGCAGCGG - Intergenic
1170104725 20:12741320-12741342 TAGTAGGAAGAGAAGAGGAGGGG + Intergenic
1170364004 20:15580491-15580513 GACTAGACTGAGGAGAGAAGGGG - Intronic
1170398748 20:15957555-15957577 AAGTCAGCTGAGAACAGGAGAGG - Intronic
1170960860 20:21024459-21024481 GAGGAGGCTGAGCAAAGAAGAGG - Intergenic
1171480536 20:25452535-25452557 GAGGAGGCTGAGAACAGAACAGG + Intronic
1172398708 20:34630284-34630306 TAGTGGGCTGAGGAGAGGTGTGG + Intronic
1172907687 20:38381147-38381169 GATCAGGTTGAGGAGAGGAGAGG - Intergenic
1172932272 20:38594995-38595017 GAATAAGGTGAGAAGCGGAGGGG + Intergenic
1173513684 20:43649996-43650018 GAGAAGGGAGAGGAGAGGAGAGG + Intergenic
1173620551 20:44432519-44432541 GAGTGGACAGAGGAGAGGAGAGG + Exonic
1173663372 20:44749436-44749458 GGGCAGGCTGAGCAGTGGAGGGG + Intronic
1173997704 20:47352184-47352206 TAATAGACTGAGAAGAGAAGGGG - Intronic
1174137576 20:48391096-48391118 GAGGGGGCAGGGAAGAGGAGGGG + Intergenic
1174212580 20:48891672-48891694 GAGTTGGGTGAGAAGAAGAAGGG + Intergenic
1175048371 20:56128663-56128685 AAATAGGCTCAGAAGAGGACTGG - Intergenic
1175060634 20:56239000-56239022 AAGGAGGGTGAGAAGAGGAAAGG + Intergenic
1175370776 20:58489004-58489026 GAGTAGGGGGAAAAGAGGAGAGG + Intronic
1175378580 20:58546740-58546762 GAGTAGGGTGATAAGAGAAGGGG + Intergenic
1175693526 20:61083791-61083813 GAGTATGATGAAAAGAGGATTGG + Intergenic
1176362078 21:6006215-6006237 GAGGAGGAGGAGGAGAGGAGGGG + Intergenic
1176520432 21:7820118-7820140 GAGAAGGCAGAGAAAAGAAGTGG - Intronic
1176942492 21:14940795-14940817 GAGTTGGTTGAGAAGAGAAGAGG - Intergenic
1177758374 21:25373846-25373868 TAGTAGTGTGAGGAGAGGAGGGG - Intergenic
1178654455 21:34450130-34450152 GAGAAGGCAGAGAAAAGAAGTGG - Intergenic
1178909971 21:36666541-36666563 GAGAAGGCTGAGAAGAGTGGAGG + Intergenic
1179030023 21:37712456-37712478 GAGGAGGGAGAGAGGAGGAGGGG - Intronic
1179030071 21:37712604-37712626 GAGGAGGGAGAGAGGAGGAGGGG - Intronic
1179238563 21:39568466-39568488 GTGTAGGCAGAGAAGAGAAGAGG - Intronic
1179424797 21:41267204-41267226 GAGTGGGCTGAGGAGAGGCAGGG - Intronic
1180094735 21:45550786-45550808 GAGAAGGTGGAGGAGAGGAGAGG - Intergenic
1180230371 21:46423712-46423734 GAGGAGGAAGAGAAGGGGAGGGG + Intronic
1181393944 22:22604703-22604725 GAGGAGGGTGAGCAGGGGAGGGG - Intergenic
1181417614 22:22771843-22771865 GAGGAGGCTGAGGAGGAGAGGGG - Intronic
1181779951 22:25185336-25185358 CAGTGGGCGGGGAAGAGGAGAGG - Intronic
1181924745 22:26348957-26348979 GAGAAGGGAGAGGAGAGGAGAGG + Intronic
1182061683 22:27402842-27402864 GATGAGGCTCAGAAGAGGAAAGG - Intergenic
1182068682 22:27447920-27447942 GAGTAGGCTGAGGGGAGAAGAGG - Intergenic
1182555628 22:31127048-31127070 GAGCAGGCCCAGAAGAGGATGGG + Intronic
1182667551 22:31970697-31970719 AAGGAGGCGGGGAAGAGGAGCGG + Intergenic
1182692647 22:32174854-32174876 GAGTAGGCTCACAAAAGGAGAGG - Intergenic
1182741484 22:32571214-32571236 AAGGAGGATGAGAAGGGGAGGGG - Intronic
1182844424 22:33418721-33418743 GAGTGAGCAGGGAAGAGGAGGGG + Intronic
1183376816 22:37470067-37470089 GAGTGGGCTGAGAGCAGAAGTGG - Intronic
1183440825 22:37822315-37822337 GAGGGGGCAGAGGAGAGGAGGGG + Intergenic
1183782458 22:40007525-40007547 GAGGAGGAGGAGAGGAGGAGAGG - Intronic
1184378864 22:44132457-44132479 GGGTAGGCTGCCAAGAGCAGAGG - Intronic
1184412344 22:44332406-44332428 GACTGGGGTGGGAAGAGGAGAGG - Intergenic
1184581172 22:45418769-45418791 GAGTAGACTGGGGAGAGAAGAGG - Intronic
1184674928 22:46036364-46036386 GCTTAGGCTGAGACGAGGGGTGG - Intergenic
1184713951 22:46269670-46269692 GGGCAGGCTGGGAACAGGAGAGG - Intronic
1184883670 22:47328797-47328819 GAGAAGGGAGAGAAGGGGAGGGG - Intergenic
1185039783 22:48498021-48498043 GAGTGGGCTGAGGGTAGGAGAGG + Intronic
1185039832 22:48498158-48498180 GAGTGGGCTGAGGGTAGGAGAGG + Intronic
1185039881 22:48498295-48498317 GAGTGGGCTGAGGGTAGGAGTGG + Intronic
1203306076 22_KI270736v1_random:110143-110165 GAGTGGACTGGAAAGAGGAGTGG + Intergenic
949211527 3:1508762-1508784 GGAGAGGCTGAGAAGAGGAAGGG + Intergenic
949901058 3:8815077-8815099 GAGTAGACACAGAAGAGGCGGGG + Intronic
949986883 3:9548400-9548422 GAGCAGCATGAGGAGAGGAGAGG - Intronic
950287318 3:11755118-11755140 GAGCAGGATGAGGGGAGGAGGGG - Intergenic
950525554 3:13520809-13520831 GAGAAGGCTGAGGGGAGGAAGGG + Intergenic
950676148 3:14555500-14555522 GAGAAGGCAGAGCAGAGGCGGGG + Intergenic
951870409 3:27355588-27355610 GAGTAGGGTGATAGTAGGAGTGG - Intronic
952263143 3:31760172-31760194 GAGGAGGAGGAGAATAGGAGGGG + Intronic
952895026 3:38072949-38072971 GAATAAGGTGAGAAGCGGAGGGG + Intronic
953169013 3:40490591-40490613 AAGCAGGCTGAGAAGGGGAGAGG - Intergenic
953210732 3:40872748-40872770 AAGTAAGCTGAGAAGCAGAGAGG + Intergenic
953302830 3:41796087-41796109 GAGTGTGCTGAGCTGAGGAGTGG + Intronic
953471345 3:43169366-43169388 AAGTAGGCTGGGAAGGGAAGAGG - Intergenic
954558467 3:51536799-51536821 GAGTAGGAGGAAAAGAGAAGTGG + Intergenic
954719845 3:52552369-52552391 GAGCAGGCTTAGAGGAGTAGGGG - Intronic
955061176 3:55492559-55492581 GAGGAGCCTGAGGAGAGTAGAGG + Intergenic
955196259 3:56807290-56807312 GAATGGGTGGAGAAGAGGAGGGG - Intronic
955238855 3:57163044-57163066 GAGCAGGATGAGAAGGGTAGGGG + Intronic
955744940 3:62131218-62131240 GAGGGGGATGAGAAGGGGAGGGG - Intronic
956029605 3:65023419-65023441 AAGTAGGTGGAGGAGAGGAGAGG + Intergenic
956398724 3:68853429-68853451 CAGTAGGCAGAGAGGAGGAAAGG - Intronic
956440932 3:69279771-69279793 GAGGAGGAGGAGAGGAGGAGGGG - Intronic
956592264 3:70927274-70927296 GAGTAGGAGGAGAAGGGGAAAGG - Intergenic
956791269 3:72681709-72681731 AAGTTTACTGAGAAGAGGAGAGG + Intergenic
956882138 3:73521220-73521242 CTGCAGGCTGAGCAGAGGAGGGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957904663 3:86540665-86540687 GAATAAGGTGAGAAGTGGAGGGG + Intergenic
958751168 3:98194360-98194382 GAATAAGGTGAGAAGCGGAGGGG - Intronic
959124393 3:102272556-102272578 GGGAAGGTTGGGAAGAGGAGAGG - Intronic
959947505 3:112141791-112141813 TAGAAGGATGAGAATAGGAGTGG - Intronic
960013495 3:112859057-112859079 GAGTAGGCAGATAGCAGGAGGGG - Intergenic
960702593 3:120451678-120451700 GAGTGGGCGGAAGAGAGGAGGGG - Intergenic
960950781 3:122997293-122997315 AAGGAGGCTGAGGAGAGGGGAGG - Intronic
961345525 3:126260922-126260944 GAGAAGGGAGAGGAGAGGAGGGG - Intergenic
961480356 3:127175542-127175564 GAGCAGGCTGGGAAGAGCACTGG + Intergenic
961532417 3:127547665-127547687 GAGGAGGAGGGGAAGAGGAGGGG - Intergenic
961770745 3:129248330-129248352 GAGTGGGCTGTGGAGAGGAGAGG - Intergenic
961786470 3:129350060-129350082 GAGGGTGCTGAGCAGAGGAGGGG - Intergenic
961871770 3:129993567-129993589 GAGTGGGCTGAGGAGAGAAGCGG - Intergenic
962856201 3:139347305-139347327 GAGCAGGCAGAAAAAAGGAGGGG - Intronic
962973230 3:140424391-140424413 CAGTAGGCTGGGAGGAGGAGAGG - Intronic
963061242 3:141228903-141228925 GAGCAGGCTGGGAATAAGAGGGG + Intronic
963087982 3:141455877-141455899 GAGCAGGGTGAGGGGAGGAGGGG + Intergenic
963091989 3:141490904-141490926 GAGCAGGCAGAGATGAGGAGGGG - Intronic
963195976 3:142530765-142530787 GAGTAGTAAAAGAAGAGGAGAGG - Intronic
963253656 3:143122643-143122665 GAGAAGGCAAAGAAGAAGAGGGG - Exonic
963319929 3:143800714-143800736 GAATAAGGTGAGAAGTGGAGGGG - Intronic
963600977 3:147378589-147378611 GAGTAAAAAGAGAAGAGGAGAGG + Intergenic
964570884 3:158106290-158106312 GAGGAGGAGGAGAAGAGAAGGGG + Intronic
964606929 3:158570287-158570309 GGGTAGGCAGAGCAGGGGAGAGG - Intergenic
965639842 3:170820244-170820266 GAATAAGGTGAGAAGCGGAGGGG + Intronic
968687952 4:1974064-1974086 GCGTTGGCTGAGATGAGGGGTGG - Intronic
969139407 4:5055524-5055546 GGGTGGGCTGAGCAGAGCAGAGG - Intronic
969717884 4:8877255-8877277 GAGTGGGGAGAGGAGAGGAGAGG + Intergenic
969848419 4:9937676-9937698 GAGATGGCTGAGGAGAGAAGAGG - Intronic
971100410 4:23460123-23460145 GAGTGGGATGGGAAAAGGAGTGG - Intergenic
971251278 4:24975362-24975384 GAGAAGGCAGAGAAGAGGAGGGG + Intronic
971514346 4:27467923-27467945 GAGGAGGAGGAGATGAGGAGGGG - Intergenic
971783850 4:31074927-31074949 GAGTAGGAGGAGAAGAAGAAAGG - Intronic
973560907 4:52134343-52134365 GAGTAGGCTGAAAAGTGCTGAGG + Intergenic
973634813 4:52852116-52852138 GAGGTGACTGTGAAGAGGAGAGG - Intergenic
973666065 4:53160514-53160536 GAGGAGGTTCAGAAAAGGAGGGG + Intronic
973990380 4:56400174-56400196 GAGTAGGCTGAGGAGGGAAGAGG - Intronic
974414375 4:61586534-61586556 GAGTAAAGTGAAAAGAGGAGCGG + Intronic
974478231 4:62410514-62410536 GAGTAGGCAGAGAGAAGAAGAGG + Intergenic
975298267 4:72759277-72759299 GAGGAGGCAGAGAACAGGAATGG + Intergenic
975816622 4:78223613-78223635 GGTTAAGCTGAGAAGAGGAATGG - Intronic
976213615 4:82694766-82694788 GAGTAGGCTGAGAGGAGGAGGGG + Intronic
976258617 4:83124810-83124832 GTGCAGGCAGAGGAGAGGAGAGG + Intronic
977537404 4:98270820-98270842 GAGTAGGCTGAGAAGAGGAGGGG - Intronic
977921295 4:102646269-102646291 GAGTAGGGTGGGCAAAGGAGGGG - Intronic
978413921 4:108455565-108455587 GAGTATACAGAGAAGAGGACTGG - Intergenic
978594684 4:110364624-110364646 GAGTGGGCTGGGGAGAGAAGAGG + Intergenic
979220795 4:118221436-118221458 GAGAAGGCTGGGAAGAGGAGAGG - Intronic
979528169 4:121739445-121739467 GAGTGGGCTGGGGTGAGGAGAGG + Intergenic
979574107 4:122266052-122266074 GAGGAGGCTGAGAAAAGCACTGG + Intronic
981710276 4:147701998-147702020 GGGTAGGAAGAGAGGAGGAGGGG + Intergenic
981900427 4:149855690-149855712 GAGTACAGTGAGGAGAGGAGAGG - Intergenic
981906178 4:149924157-149924179 GAGCAGTCTGAGAAGAGTCGGGG - Intergenic
982217343 4:153093987-153094009 GCGCAGGCTGAGGAGAGCAGGGG - Intergenic
982347744 4:154379366-154379388 AGGGAGGCTGAGAAAAGGAGAGG + Intronic
982353559 4:154443029-154443051 GAGTAGGCTGGACAGAGGGGAGG - Intronic
983121152 4:163886555-163886577 GAATAAGCAGAGAAGAGGAGAGG + Intronic
983750765 4:171266790-171266812 GAGGAGGATGAGAAGAGATGAGG - Intergenic
984096381 4:175440193-175440215 GTATAGTCTGAGAAAAGGAGTGG - Intergenic
984280172 4:177661317-177661339 GAGTAGAGTAAGAACAGGAGGGG - Intergenic
984624126 4:181986645-181986667 GAGTGGGCTGTTAAGAAGAGTGG - Intergenic
984952481 4:185017822-185017844 GAGTGGGCCGAGAAGAAAAGGGG - Intergenic
985064235 4:186105290-186105312 GAGTAGGGGGAGGAGAGCAGCGG - Intronic
986901022 5:12433626-12433648 GAGGAGGAGGAGGAGAGGAGAGG - Intergenic
987215777 5:15735299-15735321 GACTAGGTAGAGAAGAGAAGTGG + Intronic
987280668 5:16410724-16410746 GAGTAGGGTGGGAATTGGAGTGG + Intergenic
988539198 5:32094074-32094096 GAGTAGCCTGAGAAGGAGGGAGG + Intronic
989731858 5:44658520-44658542 GAGTAGGCTGAGAGGAGGAAGGG + Intergenic
990880140 5:60530027-60530049 GAGATGGCTGTGGAGAGGAGAGG + Intergenic
991092341 5:62705370-62705392 TAGAAGGCTGAGATGAGGATAGG + Intergenic
991400386 5:66245388-66245410 GAGAGGGCTGAGTAGAGGTGTGG + Intergenic
992256734 5:74928814-74928836 GAAGAGGAAGAGAAGAGGAGAGG - Intergenic
992554690 5:77891822-77891844 GAGTGGGTTGCTAAGAGGAGGGG + Intergenic
993621381 5:90172277-90172299 CAGTAGGATGAGAAGAAGAATGG - Intergenic
993817658 5:92572237-92572259 CAGTGGGGTGAGATGAGGAGTGG - Intergenic
995721078 5:115133653-115133675 TTGTAGGCTGAGAACAGGATTGG - Intronic
995807139 5:116065677-116065699 GAGTAGGCTGAGAAGGAGGATGG + Intergenic
996022231 5:118604064-118604086 GAATAGGCGGAGGAAAGGAGGGG - Intergenic
996088756 5:119330053-119330075 GAGTAAGTTGAATAGAGGAGGGG + Intronic
996216107 5:120868706-120868728 GAGGTGGCTGAGATGCGGAGAGG - Intergenic
998001077 5:138626445-138626467 GAGTAGAGTGAGAAGAAAAGAGG - Intronic
998015229 5:138726341-138726363 AAGTTGGCTGAGAAGACCAGTGG + Intronic
998058602 5:139101000-139101022 GTGTAGACAGAGAAGAGCAGAGG + Intronic
998604055 5:143615537-143615559 GAGGAGGAAGAGAGGAGGAGAGG - Intergenic
998699713 5:144684135-144684157 CAGCAGGCTGGGAGGAGGAGAGG - Intergenic
998741027 5:145201973-145201995 GGGTAGGTGTAGAAGAGGAGGGG - Intergenic
999192450 5:149758419-149758441 GAGTCGACTGGGAAGAGAAGAGG + Intronic
999261516 5:150241552-150241574 AAGGAGGCAGAGGAGAGGAGAGG - Intronic
999470243 5:151848809-151848831 GAGTGAGGTGAGGAGAGGAGAGG - Intronic
999676722 5:154011385-154011407 GAGGAGGAAGAGGAGAGGAGTGG + Intronic
999693821 5:154170921-154170943 GAGGAGGGCAAGAAGAGGAGAGG + Intronic
1000288105 5:159845493-159845515 GAGTTGGGTGGGAAGTGGAGGGG - Intergenic
1000443781 5:161295143-161295165 GGGAGGGCTGAGAAGAGGAAAGG + Intronic
1000981724 5:167823907-167823929 GAGTAGGGTGTGAGTAGGAGAGG - Intronic
1001133241 5:169081278-169081300 AAGGAGCCTGGGAAGAGGAGAGG + Intronic
1001354111 5:171003674-171003696 GAATAAGGTGAGAAGTGGAGGGG + Intronic
1002315036 5:178338034-178338056 GAGCAAGCTGAGAAACGGAGGGG + Intronic
1002721758 5:181265584-181265606 GATGAGGCTGAGAGGAGCAGGGG + Intergenic
1003056302 6:2824025-2824047 GTGTAGGATGTGAAGAGGGGAGG - Intergenic
1003163746 6:3658240-3658262 GAGGAGGCTGAGAAGGTGGGTGG + Intergenic
1003856081 6:10277080-10277102 GAGCAGGGTGAGGAGTGGAGGGG - Intergenic
1003886349 6:10524616-10524638 GAGCAGGCAGAGAGGAGGACAGG + Intronic
1004203170 6:13569048-13569070 CAGAAGGCTGAGAAGAAAAGAGG + Intergenic
1004358570 6:14951202-14951224 GGGAAGTCTGAGAAGTGGAGAGG - Intergenic
1004364533 6:15000715-15000737 GAGGAGGAAGAGAAGAGGAAGGG + Intergenic
1005003574 6:21266450-21266472 GAGAGGGGTGAGAAGAAGAGGGG + Intergenic
1005302553 6:24484703-24484725 AAGTAGGCAGGAAAGAGGAGTGG - Intronic
1005398022 6:25404097-25404119 GAGTAATCTTAGAAGTGGAGGGG - Intronic
1005841791 6:29748632-29748654 GAGGAGACGGAGGAGAGGAGAGG + Intergenic
1005871229 6:29975501-29975523 GAGGAGGCGGAGGAGAGGTGAGG + Intergenic
1006058965 6:31405065-31405087 GGGTAGGGTGAGGACAGGAGGGG - Intronic
1006071450 6:31499950-31499972 GGGTAGGGTGAGGACAGGAGGGG - Intronic
1006389860 6:33751876-33751898 GAGAAGGCTGGGAGGAGGGGAGG + Intergenic
1006627755 6:35409696-35409718 GTGGAGGCTGGGAGGAGGAGAGG - Intronic
1006838053 6:37011101-37011123 GGGAAGGCTGAGAAGGGGTGAGG - Intronic
1006915048 6:37588511-37588533 GAGGCGACTGAGAAGAGGAGTGG - Intergenic
1007303530 6:40886878-40886900 GAGGAGAGGGAGAAGAGGAGAGG + Intergenic
1007509445 6:42364124-42364146 GAGTAGGAGGAGAAGAGGTCAGG - Intronic
1007657745 6:43462149-43462171 GAGTGAGCAGAGAGGAGGAGGGG - Intergenic
1007830097 6:44631181-44631203 GAGAAGGTTGGGAAGGGGAGTGG + Intergenic
1007910963 6:45513656-45513678 GAGTAGGGAAAGAAGAGGGGTGG + Intronic
1009850663 6:69194019-69194041 GAGAAGGATGAGAAAGGGAGAGG - Intronic
1010435728 6:75827863-75827885 AAGGTGGTTGAGAAGAGGAGTGG + Intronic
1010702255 6:79064438-79064460 GAGTAGATTGAGGAGAGGATGGG - Intronic
1010908722 6:81525782-81525804 GTGTAGAGTGAGAAAAGGAGAGG - Intronic
1011693212 6:89888211-89888233 GAGGAGGGAGAGAGGAGGAGAGG + Intergenic
1011803310 6:91043093-91043115 GAGAAGACTGAGTAAAGGAGTGG + Intergenic
1011965815 6:93156474-93156496 GAGGAGGCAGGGAAGAGAAGTGG + Intergenic
1012409266 6:98937552-98937574 GAGTAGGCTGAGAAGGGAGGAGG + Intronic
1013094021 6:106927854-106927876 TAGAAGGCTAAGAAGAGAAGGGG + Intergenic
1014931658 6:127343458-127343480 GAAGACGCGGAGAAGAGGAGAGG - Intronic
1015035409 6:128647492-128647514 GAGTAGGTTGAGCAGAGAAAGGG + Intergenic
1016097824 6:140059853-140059875 GAGAAGACACAGAAGAGGAGGGG + Intergenic
1016377183 6:143433975-143433997 GAGTAGCCTGAAAAGAGAAAGGG + Exonic
1017009913 6:150056409-150056431 GAGCAGGTTGAGAGGAGGATGGG - Intergenic
1017072380 6:150586954-150586976 GAGCCGCCTGGGAAGAGGAGAGG - Intergenic
1017346276 6:153385437-153385459 CAGAAGTCTGAGAAGAGTAGAGG + Intergenic
1017681934 6:156872939-156872961 GAGTAGCCTCAGAGCAGGAGGGG - Intronic
1018345447 6:162894104-162894126 GAGTAGTCTGAGACCTGGAGTGG + Intronic
1018900513 6:168049677-168049699 GGGCAGGCTCAGGAGAGGAGAGG + Intergenic
1019065416 6:169292104-169292126 GTGTGGGCTCAGAAGACGAGAGG - Intergenic
1019102046 6:169639701-169639723 GAGTAGGATGAGGTGGGGAGTGG - Intronic
1019347544 7:538339-538361 GAGGAGGCAGATAAGAGGGGTGG - Intergenic
1019632816 7:2058774-2058796 GTGTGGCCAGAGAAGAGGAGAGG + Intronic
1020157804 7:5741137-5741159 GGGCAGGCTGAGGAGAAGAGGGG + Exonic
1020208892 7:6142916-6142938 GAGCAGCCTGGGAAGAGAAGAGG - Exonic
1020794397 7:12662964-12662986 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1021044613 7:15907020-15907042 GAGAAGGGTGAGCAGAGAAGGGG - Intergenic
1021637511 7:22706668-22706690 GAATAAGGTGAGAAGCGGAGGGG - Intergenic
1021815277 7:24441303-24441325 AAGTGAGCTCAGAAGAGGAGAGG + Intergenic
1022207906 7:28180648-28180670 GGGTGGGGTGAGGAGAGGAGGGG + Exonic
1022226051 7:28364644-28364666 GAGGAGCCTGAGGATAGGAGAGG - Intronic
1022354877 7:29604479-29604501 GAGTAGATGGAGAACAGGAGTGG + Intergenic
1022378101 7:29834051-29834073 GTCTAGGCAGAGGAGAGGAGTGG + Intronic
1023662501 7:42484533-42484555 GAGGGTGCTAAGAAGAGGAGTGG - Intergenic
1023808130 7:43889652-43889674 GAGTAGATTAAGAGGAGGAGAGG - Intronic
1024207943 7:47179788-47179810 GAGGAGGGTGAGGAGAGGAGGGG + Intergenic
1024290634 7:47801143-47801165 GAGGCAGCTGAGGAGAGGAGAGG - Intronic
1024298082 7:47862358-47862380 GAGCAGCCTGAGATGAGGAGGGG + Intronic
1024907369 7:54401555-54401577 GAGAAAACTGAGAAGTGGAGAGG + Intergenic
1025945154 7:66099405-66099427 GAGGAGGAGGAGAGGAGGAGAGG + Intronic
1026205614 7:68255028-68255050 GAGGAGGAGGGGAAGAGGAGAGG - Intergenic
1026301651 7:69103088-69103110 AAGAAGGCGGAGAAGAGGAGAGG - Intergenic
1027307834 7:76920582-76920604 GAGTAGGCTGAGGAGGTGGGAGG + Intergenic
1027318238 7:76997371-76997393 GTGTAGGCTGTGAGGAGGTGTGG + Intergenic
1027433460 7:78138352-78138374 GAGAAGAAAGAGAAGAGGAGAGG + Intronic
1027532422 7:79353252-79353274 GCCAGGGCTGAGAAGAGGAGGGG - Intronic
1028305506 7:89258867-89258889 GAGTAGGCTGAGAAGGAAATAGG + Intronic
1028484554 7:91343609-91343631 GAGGAAGCTGAGCAGAGGGGAGG - Intergenic
1028512232 7:91638041-91638063 GAGAGGGATCAGAAGAGGAGGGG - Intergenic
1028909772 7:96195003-96195025 GAGTAGAGTGAGAAGATGTGAGG - Intronic
1029292863 7:99515963-99515985 GAGATGGCTCAGAAGAGGGGAGG - Intronic
1029389747 7:100267053-100267075 GAGCAAGCAGAGAACAGGAGTGG - Intronic
1029446415 7:100615275-100615297 GAGTAGGCAGGAAAGAGAAGAGG - Exonic
1029615877 7:101656893-101656915 GAGTGGGCTGAGATGAGAGGTGG - Intergenic
1029888955 7:103906105-103906127 AAAGAGGCTGAGAAGAGGTGTGG + Intronic
1030034462 7:105396736-105396758 GAGGAGGAGGAGGAGAGGAGAGG + Intronic
1030186384 7:106766101-106766123 GAGTAAGCTGAGCAGGGGACGGG - Intergenic
1030440229 7:109579946-109579968 AAGAAGAGTGAGAAGAGGAGGGG - Intergenic
1030699574 7:112622932-112622954 GCGGAGGGTGAGAAGAAGAGGGG + Intergenic
1030896379 7:115065897-115065919 GAGTAGGCAGAGAAAAGGCTGGG - Intergenic
1031350904 7:120729700-120729722 GATTATGGTGAGAAGAGGAAGGG - Intronic
1031422278 7:121566272-121566294 GAATAAGGTGAGAAGCGGAGGGG + Intergenic
1032423068 7:131798856-131798878 CAGGTGGCTGAGAAGAGGGGAGG - Intergenic
1032446385 7:131987386-131987408 GAGAAGGCTGAGAATTTGAGTGG + Intergenic
1033214208 7:139482369-139482391 GGGGAGGATGAGAAGGGGAGTGG + Intronic
1033367447 7:140682478-140682500 GAGGAGGCTGAGGAGGTGAGAGG + Intronic
1033776829 7:144620656-144620678 CAGAAGACTCAGAAGAGGAGAGG + Intronic
1033832636 7:145271798-145271820 GAGAAGGAGGAGAAGAGGAGGGG + Intergenic
1034262294 7:149764706-149764728 AACTAGGCTCAGAAGAAGAGCGG + Exonic
1034390681 7:150785220-150785242 GAGTGGGGTGAGAAGAGCAGTGG + Intergenic
1034737350 7:153441311-153441333 CAGCAGGCTGAGGGGAGGAGCGG + Intergenic
1035287268 7:157814441-157814463 GAGCAGGATGGGAACAGGAGGGG + Intronic
1035455701 7:159007336-159007358 GAGGAGCCTGAGAAGAGAAAGGG + Intergenic
1035889947 8:3332405-3332427 GAATTAGCTGGGAAGAGGAGAGG + Intronic
1036216698 8:6885696-6885718 GAGGAGGAGGAGTAGAGGAGAGG - Intergenic
1036427451 8:8658215-8658237 GAGTTGCCAGAGGAGAGGAGAGG + Intergenic
1036656654 8:10681456-10681478 GGGGAGGCTCAGGAGAGGAGAGG + Intronic
1036705254 8:11041681-11041703 GACTAGAGGGAGAAGAGGAGAGG + Intronic
1036962926 8:13265702-13265724 GAGAGGGGAGAGAAGAGGAGAGG - Intronic
1037152780 8:15657607-15657629 GAGAGGGCTCAGAAGAAGAGGGG - Intronic
1037607265 8:20448408-20448430 GAATAGGCTCAGAGGAGAAGTGG + Intergenic
1037680358 8:21092265-21092287 GTGTTGTCAGAGAAGAGGAGGGG - Intergenic
1037691292 8:21183483-21183505 GAGGAGGAGGGGAAGAGGAGGGG - Intergenic
1037730846 8:21523011-21523033 GGGAAGGCTGTGAATAGGAGAGG - Intergenic
1038454794 8:27666201-27666223 TATTAGGCTGAGAAGCTGAGTGG - Intronic
1038534137 8:28342002-28342024 GAGAAGGCTGGGAAGAAGTGGGG + Intronic
1038934207 8:32230408-32230430 CAGTAGCCTGAGAAGTGCAGGGG - Intronic
1039429553 8:37515266-37515288 CTGGAGGCTGAGAAGAGCAGAGG - Intergenic
1039585610 8:38704677-38704699 GTGTGGGCTGAGAAGCAGAGGGG - Intergenic
1039793092 8:40891181-40891203 GAGTGGGGAGAGGAGAGGAGAGG + Intronic
1039920803 8:41893110-41893132 GGGTAGGAGGAGAAGAGGACAGG - Intronic
1040522780 8:48192752-48192774 GAGGAGGAGGAGAGGAGGAGAGG + Intergenic
1042228811 8:66536703-66536725 GACGAGCCTGAGAAGGGGAGGGG + Intergenic
1042421037 8:68589733-68589755 GAGAAGGGAGAGAAGAGGAAAGG + Intronic
1042689472 8:71481842-71481864 GAGGAGGAGGAGGAGAGGAGGGG + Intronic
1042994790 8:74684440-74684462 GAGGGGGAGGAGAAGAGGAGAGG + Intronic
1043603211 8:81966519-81966541 GAGGAGGCTGAGTAGATGAGTGG - Intergenic
1044120167 8:88384595-88384617 GAGTAGGCTGAAGAGAGGATGGG - Intergenic
1044641600 8:94388242-94388264 GAGTAGGCTAAGAGGAGAGGAGG - Intronic
1044820691 8:96153997-96154019 CAGTGGGCTGGGAAGTGGAGTGG + Intronic
1045016624 8:98006410-98006432 GAATAGGGTGAGAATAAGAGGGG - Intronic
1045030207 8:98127864-98127886 AAGTAGGAGGAGGAGAGGAGAGG - Intronic
1045226543 8:100252265-100252287 AAGGAGGCAGAGAAGAGAAGGGG + Intronic
1045981783 8:108198064-108198086 GAGTAGGCTGAGGAGGGGGTTGG - Intergenic
1046878663 8:119284053-119284075 GTGTAGGTTGAGAAGAAAAGAGG + Intergenic
1048756886 8:137749339-137749361 AATTAGGCTGAGAAGACAAGGGG + Intergenic
1048987577 8:139743020-139743042 GAGTGGGCTGAGAGGAGCAGGGG + Intronic
1049493664 8:142918047-142918069 GAGGATGCTGAGAAAAGGCGTGG + Intergenic
1049591998 8:143466836-143466858 GAGCAGGCTGGGAAGGGGAGGGG - Intronic
1049633071 8:143669803-143669825 GAGCAGGAGGAGGAGAGGAGTGG + Intergenic
1049868634 8:144956546-144956568 GAATAAGGTGAGAAGTGGAGGGG + Intergenic
1050306364 9:4309512-4309534 AAATAGGCTGAAAAAAGGAGAGG + Intronic
1050517610 9:6461357-6461379 GAGGAGGGGGAGAGGAGGAGGGG - Intronic
1051226096 9:14900581-14900603 GGGAGGGCTGGGAAGAGGAGAGG + Intronic
1051366522 9:16325227-16325249 GATTAGGCTGAAGAGAGGAGAGG - Intergenic
1052317346 9:27129387-27129409 GAGTAGGCTGGGAACTGGAAAGG - Intronic
1052544933 9:29864361-29864383 GAGTGGGAAGAGAAGAGAAGTGG - Intergenic
1053023857 9:34714775-34714797 GAGATGGCAGGGAAGAGGAGGGG + Intergenic
1055682425 9:78730402-78730424 GAGTAGGAGGGGAACAGGAGAGG + Intergenic
1056371307 9:85957338-85957360 GAGTAGGCTGAGGAAGGAAGAGG + Intronic
1056477952 9:86971032-86971054 GAGGAGAAAGAGAAGAGGAGGGG + Intergenic
1056633619 9:88314009-88314031 GAGAGGTCTGACAAGAGGAGGGG + Intergenic
1056685052 9:88752378-88752400 GAGGAGGCTGGGATGAGGTGGGG + Intergenic
1056867550 9:90242655-90242677 GAGAAAGAAGAGAAGAGGAGAGG + Intergenic
1058718877 9:107745627-107745649 GAGTAGGCTGAGAAGGGAGGAGG - Intergenic
1059170251 9:112117951-112117973 CAGTAGGCTGAGAAGAGCATAGG + Intronic
1059203523 9:112441409-112441431 GTGTAGGATGAGAAGGGCAGAGG + Intronic
1059941902 9:119367863-119367885 GAGAAGGCAGAGAGGTGGAGAGG - Intronic
1060184053 9:121553067-121553089 GAGTAGACAGAGGAGAGGAGAGG - Intergenic
1060219044 9:121754819-121754841 GAGCTGGCTGTGGAGAGGAGAGG - Intronic
1060849911 9:126866099-126866121 GAGAAGGCTGAGAATAGAAAGGG - Intronic
1061159686 9:128886134-128886156 GAGCTGGCTGAGAAGGAGAGGGG - Intronic
1061662483 9:132139329-132139351 GAGAAGGAAGAGAAGGGGAGGGG + Intergenic
1061729581 9:132603452-132603474 GAGTTAGATTAGAAGAGGAGAGG + Intronic
1062117860 9:134818766-134818788 GAGTAGGCTGTGAGGGGCAGAGG + Intronic
1062454884 9:136630654-136630676 GAGGGGGCTGAGAAGGGGAGGGG + Intergenic
1185518990 X:724300-724322 GAGAAGGTTGAGAAGAGAAAGGG + Intergenic
1185537363 X:872913-872935 GAGAAGGCAGGGAAGGGGAGTGG - Intergenic
1185688237 X:1948178-1948200 GAGGAGGAAGAGAAAAGGAGAGG + Intergenic
1185688526 X:2133717-2133739 GAGGAGGAAGAGAAAAGGAGAGG + Intergenic
1185834182 X:3329605-3329627 GAGCAGGCTGGTGAGAGGAGTGG - Intronic
1186304499 X:8241124-8241146 CACTAGGCTGAAAATAGGAGAGG + Intergenic
1186939546 X:14490135-14490157 GAGTAGCCTGAGATGAAGGGAGG - Intergenic
1187100939 X:16190978-16191000 GACAAGGCTGAGAAGAGTGGGGG - Intergenic
1187851269 X:23593819-23593841 GAGGAGGAGGAGAAGAGCAGAGG - Intergenic
1187868407 X:23744055-23744077 GGTCAGGCCGAGAAGAGGAGAGG - Intronic
1188248422 X:27861565-27861587 GAGTAGGCTGAGGAGAAAAATGG - Intergenic
1188300913 X:28505002-28505024 GAATAAGGTGAGAAGCGGAGGGG + Intergenic
1188548095 X:31332426-31332448 GAGTAGAGAGAGAAGGGGAGAGG + Intronic
1188849432 X:35113684-35113706 TAGTAAGTTGTGAAGAGGAGTGG + Intergenic
1189166035 X:38862135-38862157 GAGTATACAGAGAAGAGAAGAGG + Intergenic
1189232079 X:39460380-39460402 GACTAGGATGAGCATAGGAGAGG - Intergenic
1189251638 X:39604858-39604880 GAGGAGGAGGAGGAGAGGAGAGG - Intergenic
1190027000 X:46933685-46933707 GAGTGGATTGAGAACAGGAGTGG + Intronic
1190461431 X:50680227-50680249 GTGTAGGCAGCAAAGAGGAGAGG - Intronic
1190714239 X:53090626-53090648 GAGTATGCGGTGAAGAGGAGGGG + Intergenic
1190738645 X:53272772-53272794 GAGAAGGCTGAGAGGAGTACAGG - Intronic
1191761473 X:64652327-64652349 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1191972706 X:66834469-66834491 GAGGAGGCTGAGAAAAAGATAGG + Intergenic
1192153648 X:68727182-68727204 GAGTAGGCAGAGATGAGGGATGG - Intergenic
1193042334 X:77017002-77017024 AAGTAGGCTGTGAAGAGGTGAGG + Intergenic
1193550271 X:82883958-82883980 CATCAGGCTGAGGAGAGGAGAGG + Intergenic
1194219077 X:91169039-91169061 GAGTAAGCTGGGAAGGGTAGTGG - Intergenic
1195385257 X:104308135-104308157 GAGTAGGCTGAGAAGGAGGAAGG - Intergenic
1195668925 X:107452941-107452963 GGGTGGGATGAGTAGAGGAGAGG + Intergenic
1195724967 X:107905316-107905338 GGGTAGGGTGAGAAGGTGAGTGG + Intronic
1197257198 X:124275890-124275912 GAGCAGCGTGAGAAGAAGAGGGG + Intronic
1197293471 X:124688199-124688221 GAGAAGGGAGAGGAGAGGAGAGG - Intronic
1198467552 X:136917123-136917145 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
1198673568 X:139107775-139107797 GAGAAGGAAGAGGAGAGGAGAGG + Intronic
1199665605 X:150094321-150094343 AGGTAGGGTGAGCAGAGGAGAGG + Intergenic
1199759992 X:150898306-150898328 GAGTAGCCGGAGAGGAGGGGTGG - Intronic
1200555590 Y:4632795-4632817 GAGTAAGCTGGGAAGGGTAGTGG - Intergenic
1201937313 Y:19422397-19422419 GAATAAGGTGAGAAGTGGAGGGG - Intergenic
1201964895 Y:19721345-19721367 GAGTAGGATACGATGAGGAGAGG + Intronic
1202076348 Y:21041369-21041391 GAATATGATGAGAAGCGGAGGGG + Intergenic