ID: 977539320

View in Genome Browser
Species Human (GRCh38)
Location 4:98297583-98297605
Sequence TCATACATGGGCATGGTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 7, 2: 30, 3: 126, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977539320 Original CRISPR TCATACATGGGCATGGTTCA CGG (reversed) Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
905175185 1:36130909-36130931 TCAGACATGGGCCTGGCTCTGGG + Intergenic
907079446 1:51607940-51607962 TTATACATTGGCATGGTTCCAGG + Intronic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910365419 1:86460035-86460057 TTATACATTGGCATGGTTCCGGG + Intergenic
910426147 1:87121601-87121623 TCAGAGATGGGCAGGGTTGAAGG + Intronic
910545735 1:88415331-88415353 TCTTACATGAGCACAGTTCATGG + Intergenic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911158042 1:94655680-94655702 TGATACATGTGTATGGATCAGGG + Intergenic
911189058 1:94929656-94929678 TTATACATTGGCATGCTTCCAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911746330 1:101445543-101445565 TTATACATTGGCATGGTTCTGGG - Intergenic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
915667006 1:157454176-157454198 TTATACATTGGCATGCTTCTGGG - Intergenic
917411999 1:174768642-174768664 TTATACATTGGCATGATTCCAGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918727393 1:187942972-187942994 TCATCCTTGGGCATGTTTTAGGG - Intergenic
918776835 1:188642838-188642860 TTATACATTGGCTTGGTTCCAGG - Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922877868 1:228954545-228954567 TTATACGTTGGCATGCTTCAGGG - Intergenic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064404978 10:15053586-15053608 TTATACATTGGCATGCTTCGGGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065410903 10:25426639-25426661 TCTTACATGGGTGAGGTTCATGG + Intronic
1065940443 10:30559470-30559492 TTATACATTGGCATGCTTCCAGG - Intergenic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1070315426 10:75306836-75306858 TCTTACAAGGGCGTGGTTCACGG - Intergenic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070709378 10:78667671-78667693 TCATACTTGTGTATGCTTCACGG - Intergenic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072982034 10:100106830-100106852 TTATACATTGGCATGCTTCTGGG + Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1073849589 10:107599276-107599298 TTATACATTGGCATGCTTCTGGG - Intergenic
1075373348 10:121956526-121956548 TCAGAGATGGGCTTGGTTGAAGG + Intergenic
1075739120 10:124682734-124682756 TCAGCCAGGGGCAGGGTTCAGGG - Intronic
1075751302 10:124773673-124773695 TCTTACGTGGGCACAGTTCATGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1078819330 11:14861854-14861876 TTATACATTGGCATGCTTCCAGG + Intronic
1078834434 11:15013671-15013693 TCATACCTGTACAGGGTTCATGG - Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080988917 11:37506558-37506580 AGATACGTGGGCATGGTGCAGGG + Intergenic
1081048216 11:38303631-38303653 TCAAACATGGGGATGGTCCTGGG - Intergenic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1081434339 11:43010681-43010703 TTATACATTGGCATGGTTCTGGG + Intergenic
1082686703 11:56246721-56246743 TCCTATATGGGCACAGTTCATGG + Intergenic
1082861865 11:57864379-57864401 TATTACATTGGCATGGTTCTGGG - Intergenic
1083487869 11:62994959-62994981 TCTGACGTGGGCATGGTCCAGGG + Intronic
1084046333 11:66570026-66570048 TCATTCCTGGGCATGGGCCAAGG + Intergenic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085270447 11:75266971-75266993 TCCTAAATGGACATGTTTCATGG - Intronic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088555588 11:111057413-111057435 TTATACATTGGCATGCTTCCGGG - Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092573576 12:9753229-9753251 TCATTCTTGGGCATGGTTATTGG + Exonic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093007617 12:14067657-14067679 TTATACATTGGCATGGTTCTGGG - Intergenic
1093252536 12:16825071-16825093 TCTTACATGGGCACAGATCATGG - Intergenic
1093435161 12:19128450-19128472 TCTTACATGGGCTCAGTTCATGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093691166 12:22110818-22110840 TCTTACATGGGCACATTTCATGG + Intronic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1096886082 12:54720714-54720736 TTATACATTGGCATGGTTCTGGG + Intergenic
1097206509 12:57326064-57326086 TCTTACATGGGCACAGTTCCTGG - Intronic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1097832844 12:64243775-64243797 TCATACATGACCCTGCTTCATGG + Intergenic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1102905245 12:116669639-116669661 TTATACATTGGCTTGGTTCCGGG + Intergenic
1103877979 12:124143616-124143638 TCATATATGAGGCTGGTTCACGG - Intronic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106662495 13:31814541-31814563 TAAGACATGGGCCTGGTTCTGGG - Intergenic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107236678 13:38178858-38178880 TTATACATTGGCATGTTTCTGGG + Intergenic
1107763542 13:43708342-43708364 TTATACATTGGCATGATTCCAGG - Intronic
1108181398 13:47843376-47843398 CCATCTATGGGCATGGTTCATGG + Intergenic
1108857071 13:54806600-54806622 TAAGACATGGGCATTGTTGAGGG + Intergenic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109167095 13:59049411-59049433 TCATTCAGGGAAATGGTTCAGGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110102993 13:71633175-71633197 TCATGCATAGTCATGGTTCCTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1110783655 13:79497264-79497286 TCCTACATGTGCATGGCTTAAGG + Intronic
1111135420 13:84036342-84036364 TCATACATTGGCATGCTTCTGGG + Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111243235 13:85503186-85503208 TCATACATTGGCATTCTTCCGGG + Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1112247642 13:97749050-97749072 TTATACATTGGCATGCTTCTGGG - Intergenic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1113065715 13:106372516-106372538 TCATTCCTTGGCTTGGTTCAGGG - Intergenic
1113535878 13:111065976-111065998 TTATACATGGGCATGGTTCAGGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113648976 13:112020703-112020725 TCCTGTATGGGCATGGTTTATGG - Intergenic
1115627986 14:35214583-35214605 TCTTACATGGGTGTGGTTCCTGG + Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1116112249 14:40601321-40601343 TCATCCATGGGCAGGGCTAATGG + Intergenic
1116122949 14:40743701-40743723 TGCCACATGGGCATGCTTCATGG + Intergenic
1117327416 14:54682332-54682354 TCCTACACAGGCATGGCTCAGGG - Intronic
1117455057 14:55888639-55888661 TCATACAGGTAAATGGTTCATGG - Intergenic
1117727705 14:58690955-58690977 TTATACATTGGCATGCTTCCCGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1119944333 14:78675979-78676001 TTCTACATGGGCATGGGTGATGG - Intronic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122522702 14:102356789-102356811 TTATATATGCACATGGTTCATGG - Intronic
1123126203 14:105947829-105947851 TTATACATTGACATGGTTCTGGG + Intergenic
1123406712 15:20023883-20023905 TTATACATTGGCATGGTTCTGGG + Intergenic
1123516042 15:21030531-21030553 TTATACATTGGCATGGTTCTGGG + Intergenic
1124901580 15:33828167-33828189 TCTTACAAGGGCATAGTTCATGG - Intronic
1127081438 15:55384255-55384277 TCTTTCATAGGCACGGTTCATGG + Intronic
1128738909 15:70070142-70070164 CCATGCATGGGCTTGGTTCCAGG - Intronic
1129499290 15:76020106-76020128 TCTTACACAGTCATGGTTCATGG - Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1131404433 15:92152787-92152809 ACTTACCTGGGGATGGTTCATGG - Intronic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1131923938 15:97361436-97361458 TCATACTTGGGCATTGTACTGGG + Intergenic
1131950748 15:97679016-97679038 TCAAACATGAGCATGCTTTATGG + Intergenic
1132020676 15:98359251-98359273 TTATACATTGGCATGGTTCTGGG - Intergenic
1133705647 16:8352254-8352276 TCATACTTCTGAATGGTTCATGG - Intergenic
1134851662 16:17483785-17483807 TCATACACTGGCATGCTTCTGGG - Intergenic
1138261783 16:55628871-55628893 TTATACATTGGCATGCTTCTGGG - Intergenic
1138262509 16:55635290-55635312 TTATACATTGGCATGCTTCCAGG - Intergenic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141251520 16:82363342-82363364 TTATACATTGGCATGCTTCTGGG + Intergenic
1141315215 16:82956168-82956190 ACAAACATGGGCATGATTCTCGG + Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1142953035 17:3499663-3499685 TCTCACATGGGCACGATTCATGG - Exonic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146158361 17:30543783-30543805 TCTTAGATGGGCACAGTTCATGG - Intergenic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149258108 17:54849817-54849839 TTATACGTTGGCATGCTTCATGG - Intergenic
1149290817 17:55216044-55216066 TTATACATTGGCATGGTTCTGGG - Intergenic
1149650959 17:58276180-58276202 TCAGACATGGGCATGGATGTAGG - Intronic
1151864204 17:76789264-76789286 TTATACATTGGCATGGTTCCGGG + Intergenic
1153227808 18:2911196-2911218 TTATACATTGGCATGCTTCCAGG + Intronic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1153746021 18:8180524-8180546 TTATACATTGGCATGCTTCCAGG + Intronic
1155637274 18:27970870-27970892 GCATCAATGGGCATGGTGCATGG + Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156634203 18:39008378-39008400 TTATACATTGGCATGCTTCCAGG + Intergenic
1156684108 18:39623455-39623477 TTATACATTGGCGTGGTTCTGGG - Intergenic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1157409664 18:47453212-47453234 TCATACATTGGCATACTTCTGGG - Intergenic
1158154549 18:54410708-54410730 ACATACATGTAAATGGTTCATGG - Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929307191 2:40376936-40376958 ATATACCTGGTCATGGTTCATGG - Intronic
929369859 2:41210041-41210063 TCAAACATGTCCAGGGTTCAGGG + Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
931230525 2:60370907-60370929 TCAGCCACGGGCATGGTTAAAGG - Intergenic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
932951033 2:76293821-76293843 TCTTACACGGGCATGATTCTTGG + Intergenic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
936005298 2:108881800-108881822 TCTTACATGGGTGTGGTTCTTGG + Intronic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
937556839 2:123168479-123168501 TTATACATTGGCATGATCCAAGG + Intergenic
939285462 2:140123386-140123408 TCATATATGGGTGTGGTTCATGG + Intergenic
939577149 2:143909397-143909419 TTATACATTGGCATGCTTCGGGG - Intergenic
939653376 2:144791473-144791495 TCTTACATTGGTGTGGTTCATGG + Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941954209 2:171188073-171188095 GAACACATGAGCATGGTTCAAGG + Intronic
943247004 2:185467459-185467481 TCTTAAAGGGGCATAGTTCATGG + Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
944956210 2:204812497-204812519 TTATACATTGGCATAGTTCTGGG + Intronic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
945392025 2:209276133-209276155 TTATACATTGGCATGGTTCCAGG - Intergenic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947051195 2:226045373-226045395 TTATACATTGGCATGGTTCCGGG - Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
947786297 2:232824034-232824056 CCTTACATGGGCACAGTTCACGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170633386 20:18083990-18084012 TCAGACATGAGAATGGCTCAGGG + Intergenic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1175173651 20:57096508-57096530 TGTGACATGGGCATGGGTCATGG - Intergenic
1176311345 21:5152176-5152198 TCTTACATGGGCACGGATCACGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1178479671 21:32968679-32968701 TCATGCATTGGCATGATTCCAGG - Intergenic
1179772038 21:43627970-43627992 TCTTACATGGGTGTGGCTCATGG - Intronic
1179845705 21:44109859-44109881 TCTTACATGGGCACGGATCACGG - Intronic
1179915522 21:44475536-44475558 TTATACATTGGCATGGTTCCGGG - Intergenic
1180027280 21:45174052-45174074 TCATCCATGGGAATGTTTAAAGG - Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182287933 22:29259094-29259116 TCAGACATGTGCATGGTGCCAGG - Exonic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183267992 22:36841697-36841719 TCTTACATAGTCATGGCTCATGG - Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949543004 3:5048835-5048857 TTATACATTGGCATGGCTCTGGG - Intergenic
949578036 3:5357994-5358016 TCATACATGAGCAGGGGACAGGG - Intergenic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949984663 3:9531106-9531128 TCTTACATGGGCGCAGTTCATGG + Intronic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
950780364 3:15386528-15386550 TTATACATGGGCATGGTTCCAGG + Intronic
950869509 3:16216618-16216640 TTATACATTGGCATGCTTCTGGG + Intronic
951333039 3:21388168-21388190 TCTTACATGGGCACAGTTAATGG - Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953436029 3:42878049-42878071 TCATATATGGGCCCAGTTCATGG - Intronic
953790064 3:45940583-45940605 TTATACATTGGCATGGTTCCAGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
957819532 3:85353422-85353444 ACATAAATGTGCCTGGTTCAGGG + Intronic
958673316 3:97232777-97232799 ATATACATTGGCATGGTTCCAGG + Intronic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959585593 3:108022339-108022361 TCATACATTGACATGGTTCCAGG + Intergenic
959681460 3:109101268-109101290 TCTCACATGGGCCTGGTTAAGGG - Intronic
959693639 3:109226031-109226053 ACACTGATGGGCATGGTTCATGG - Intergenic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960387681 3:117039652-117039674 TCAAACATGGACAGGGTTAATGG - Intronic
960794040 3:121465702-121465724 TCTTACATGAGTGTGGTTCATGG - Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963183845 3:142391003-142391025 TCTCAAATGGGCATGGTTGATGG + Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963746719 3:149131523-149131545 TCTCACATGGGCACAGTTCATGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964915643 3:161838302-161838324 TTATACATTGGCATAGTTCTGGG + Intergenic
965621800 3:170649941-170649963 TGATACTTGGGTATGCTTCACGG + Intronic
965996034 3:174884244-174884266 TCTTTCATGGCCAGGGTTCATGG - Intronic
965998771 3:174920979-174921001 TCTCACATGGTCATGGTCCATGG + Intronic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
967387851 3:188928339-188928361 TCATACCTGGGCCAGGCTCAGGG - Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967863653 3:194172671-194172693 TTATACGTTGGCATGGTTCTGGG + Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970766640 4:19557325-19557347 TCACAGATGGGAATGGTCCATGG + Intergenic
971086080 4:23276702-23276724 TCTTACAAGGGCACAGTTCATGG - Intergenic
971477907 4:27089583-27089605 TCATACATTGGCATGGTTTTGGG + Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972912194 4:43831203-43831225 TTGTACATTGGCATGGTTCCAGG - Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973548523 4:52006973-52006995 TAAAAGATGGGCATGGTTAAAGG - Intronic
973658388 4:53075734-53075756 TCTTACATGGGGGTAGTTCATGG + Intronic
973812632 4:54586679-54586701 TCATACGTTGGCATGCTTCTGGG + Intergenic
974039215 4:56843550-56843572 TTATACATTGGCATGGTTCTGGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974667346 4:64981550-64981572 TCCTAAATGGGTGTGGTTCATGG - Intergenic
974674443 4:65072259-65072281 TTATACATTGGCATGCTTCTGGG - Intergenic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975222857 4:71833343-71833365 TTATACATTGGCATGGTTCCGGG + Intergenic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975916411 4:79330992-79331014 TTATACATTGGCATGGTTCAGGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977582883 4:98744587-98744609 TTATACATTGGCATGGTTCCAGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978209176 4:106114392-106114414 TCATGCATGGGGATGATTAAAGG - Intronic
979183143 4:117755679-117755701 TTATACATTGGCATGCTTCTGGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979793517 4:124815552-124815574 TTATACATTGGCATGCTTCTGGG - Intergenic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
980270969 4:130583239-130583261 TTATACATTGGCATGCTTCCAGG + Intergenic
980758630 4:137198941-137198963 TAATACATTGGCTTGGTTCCGGG + Intergenic
981439359 4:144765533-144765555 TCCTACACAGGCATGGTTCATGG + Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
982920019 4:161261669-161261691 TCATTCATGTGCATGGATCATGG + Intergenic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983652889 4:170051231-170051253 TCTTACAGGGGCACAGTTCATGG + Intergenic
983904929 4:173172187-173172209 TTATACATTGGCATGATTCCAGG + Intronic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
984737105 4:183119580-183119602 ACATACATGGGCAAAGTGCATGG - Intronic
984899149 4:184569270-184569292 CCATATAGGGGCCTGGTTCATGG + Intergenic
985166898 4:187105544-187105566 TCATACATGGCAATAGTTCAAGG - Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986403790 5:7405710-7405732 TTACACATGGGCATGATACAGGG + Intronic
986479732 5:8174597-8174619 TCATACATTGGCATCCTTCCGGG - Intergenic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990430653 5:55732325-55732347 TCATTCCTGGCCAAGGTTCATGG + Intronic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
993749532 5:91649784-91649806 TTATACATTGGCATGCTTCCGGG - Intergenic
994281418 5:97908000-97908022 TTATACATTGGCATGGTTCTGGG - Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995331027 5:110946140-110946162 TTATACACTGGCATGGTTCTTGG - Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996280959 5:121728539-121728561 TTATACATTGGCATGATTCCGGG - Intergenic
996398822 5:123037387-123037409 TCCTACATGACCATGGTTCTGGG - Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
999514907 5:152291334-152291356 TCATTCATGGGCACAGTTCATGG - Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1002582003 5:180214784-180214806 ACATAGATGGGCATGGCCCAAGG - Intergenic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003783895 6:9461313-9461335 TTATATATTGGCATGGTTCCAGG + Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1003949235 6:11102984-11103006 TTATACATTGGCATTGTTCCGGG + Exonic
1003950567 6:11111751-11111773 TTATACATCGGCATGGTTCCGGG + Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1005158297 6:22833703-22833725 TTATACATTGGCATGATTCTGGG - Intergenic
1005621363 6:27623568-27623590 TTATACATTGGCATGGTTCCGGG + Intergenic
1005812171 6:29526081-29526103 TCATACATTGGCATGCCTCTTGG + Intergenic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1011095953 6:83663077-83663099 TCATTTATGGGCACAGTTCATGG - Intronic
1011186452 6:84681997-84682019 TTATACATTGGCATGCTTCCGGG + Intergenic
1012493671 6:99811021-99811043 TTGTACATTGGCATGGTTCCAGG + Intergenic
1012716068 6:102672111-102672133 TTATACATTGGCATGGTTCTAGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1016193981 6:141309108-141309130 TTATACACTGGCATGGTGCAGGG + Intergenic
1016234636 6:141848600-141848622 TCATACAAGGACAAGGTTCATGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1017298289 6:152825653-152825675 TCTTACGTGGGCACAGTTCATGG + Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017422809 6:154290365-154290387 TTATACATCAGCATGGTACAGGG - Intronic
1018843753 6:167539535-167539557 TCTTACATGGGTGTGGCTCATGG + Intergenic
1019645151 7:2124967-2124989 ACACACATGGGCATGGCTGAGGG + Intronic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020764452 7:12302868-12302890 TTATACATTGGCATGGTTCCAGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1022230039 7:28405798-28405820 TCATAGATGGGCAGGGATCCAGG - Intronic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1023112779 7:36830932-36830954 TCATGAATGGGCATGAATCAAGG + Intergenic
1023392058 7:39720234-39720256 TTATACACTGGCATGGTTCCAGG + Intergenic
1024016829 7:45324952-45324974 TTATACATTGGCATGGTTCCAGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1027437988 7:78186381-78186403 TCATACATGAACATTTTTCAGGG + Intronic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029499356 7:100918437-100918459 TTATACATTGGCATGGTTCCGGG - Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030414814 7:109229855-109229877 TTATACATTGTCATGGTTCCAGG + Intergenic
1030429572 7:109426259-109426281 TTATACATTGGCATGTTTCTGGG - Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031637228 7:124116709-124116731 TTATACATTGGCATGATTCCAGG + Intergenic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032379050 7:131456730-131456752 TCATATATGGACATGATTCTTGG + Intronic
1032701597 7:134385099-134385121 TCTTACATGGGCACAGTCCATGG - Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1033446635 7:141428688-141428710 TTATACATTGGCATGGTTCCAGG - Intronic
1033788549 7:144763416-144763438 TTATACATGGCCATAGTTCAGGG - Intronic
1034075427 7:148226774-148226796 TTATACATTGGCATAGTTCTGGG - Intronic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034404446 7:150892910-150892932 TCTTACACGGGCATGGCTCACGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1035744560 8:1952396-1952418 TCATCCAGGGGCTTGATTCATGG + Intronic
1037327835 8:17711967-17711989 TCTTAGATGAGCATGGTCCATGG + Intronic
1037941303 8:22953015-22953037 TTATACATTGGCATGCTTCTGGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1040441259 8:47445355-47445377 TCCTATATGGCCACGGTTCATGG - Intronic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1041033279 8:53760420-53760442 TTATACATTGGCATAGTTCCGGG - Intronic
1041409754 8:57540607-57540629 TCATACATTGGCATGCTTCTGGG + Intergenic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042230331 8:66548129-66548151 TTATACATTGGCATGTTTCTGGG + Intergenic
1042343269 8:67702819-67702841 TTATACATTGGCATGATTCTGGG - Intronic
1042396438 8:68296412-68296434 TTTTACATTGGCATGGTTCCAGG - Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042761733 8:72278460-72278482 TTATACATTGGCATGCTTCCAGG - Intergenic
1043275711 8:78389648-78389670 TCCCATATGGGCATGATTCATGG - Intergenic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043853436 8:85239738-85239760 TTATACATTGGCATGCTTCTGGG - Intronic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1044139944 8:88637759-88637781 TCACACATTGGCATGGTTCTGGG - Intergenic
1044558041 8:93585943-93585965 TCCCACGTGGGCATGGCTCATGG + Intergenic
1046866317 8:119154661-119154683 TTATACATGGGAATAGTACATGG - Intergenic
1047049696 8:121097127-121097149 TCATTCTTGGGCATAGGTCACGG - Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050575938 9:6995438-6995460 TCATAAAAGGGAATTGTTCAAGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051179095 9:14391742-14391764 TTATACATTGGCATGGTTCCAGG - Intronic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052060474 9:23954450-23954472 TACTACATGGGAATGGTTCATGG - Intergenic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1053339649 9:37313379-37313401 GCATACATGTTCATTGTTCAGGG + Intronic
1053766409 9:41406040-41406062 TCATATATGGATGTGGTTCATGG - Intergenic
1055839480 9:80484992-80485014 TAATACATGAACATGGTTTATGG + Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056094565 9:83239399-83239421 TTATACATTGGCATGCTTCCAGG - Intergenic
1056095457 9:83248785-83248807 GCAAACATGGCCAAGGTTCAAGG - Intronic
1056625651 9:88250968-88250990 TCATACCTGGGGAGGCTTCAAGG - Intergenic
1056979237 9:91293040-91293062 TCCTATGTGGGCGTGGTTCATGG - Intronic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1059966148 9:119616288-119616310 TCCAACATGGCCATGCTTCATGG + Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061172746 9:128970320-128970342 TCATTCATGGAGATGGTACAAGG + Intronic
1185806872 X:3066133-3066155 TCATACAACAGCATGTTTCATGG + Intronic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186321927 X:8437090-8437112 TTTTACAATGGCATGGTTCAGGG + Intergenic
1186367447 X:8910393-8910415 TCCTAGGTGGGCATTGTTCAGGG - Intergenic
1186570741 X:10712554-10712576 TTATACATTGGCTTGGTTCCAGG - Intronic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187156379 X:16724036-16724058 TCAAACCTGGGGATGGTTCTTGG - Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188091895 X:25974954-25974976 TTATACATTGGCATGGTTCCAGG - Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188953675 X:36408023-36408045 TTATACATTGGCATGCTTCCAGG - Intergenic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1190715729 X:53101647-53101669 TCTTACATGGGTACAGTTCATGG + Intergenic
1190949028 X:55123990-55124012 TTATACATTGGCATGGTTCTGGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1193066673 X:77267640-77267662 TCATACCTTGGCATGCTTCTCGG - Intergenic
1193286533 X:79721494-79721516 TTATACATTGGCATGGTTTGGGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194551413 X:95305152-95305174 TCCTACATGGTCATAGTGCATGG - Intergenic
1194627614 X:96243841-96243863 TCATACATTGGCATACTTCTGGG + Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195682901 X:107562094-107562116 TAATCCGTGGGCATGGGTCATGG + Intronic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196034955 X:111134179-111134201 ACATAGCTGGGCATGGTTCAAGG - Intronic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198516342 X:137411925-137411947 TAATTCATGTGCCTGGTTCATGG + Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1201574542 Y:15448222-15448244 ACATACATGGGCACATTTCATGG - Intergenic
1202254391 Y:22906051-22906073 TCATACATGTGTCTGGTCCACGG + Intergenic
1202407382 Y:24539800-24539822 TCATACATGTGTCTGGTCCACGG + Intergenic
1202463400 Y:25130281-25130303 TCATACATGTGTCTGGTCCACGG - Intergenic