ID: 977540416

View in Genome Browser
Species Human (GRCh38)
Location 4:98312224-98312246
Sequence CAGAATTATTAGCTGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977540416_977540421 11 Left 977540416 4:98312224-98312246 CCAGTCTCCAGCTAATAATTCTG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 977540421 4:98312258-98312280 CCAAATAGCCCTTATGAAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 131
977540416_977540419 10 Left 977540416 4:98312224-98312246 CCAGTCTCCAGCTAATAATTCTG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 977540419 4:98312257-98312279 ACCAAATAGCCCTTATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977540416 Original CRISPR CAGAATTATTAGCTGGAGAC TGG (reversed) Intronic
903371271 1:22837728-22837750 CAGAATTCTTAGCAACAGACCGG + Intronic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
904222664 1:28985359-28985381 TAGAACTTTTAGCTGGAGAGAGG + Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
909937412 1:81569103-81569125 AAGAATTATTAGGTGGGTACTGG + Intronic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
913283263 1:117205586-117205608 AAGAATTCTTAGCTGGCCACGGG - Intronic
916060816 1:161097560-161097582 CAGAGTTAATATCTGGAAACTGG + Intergenic
922180954 1:223232252-223232274 CAGTATTATTAACTGGAGTCTGG - Intronic
922249590 1:223836451-223836473 CAGAATTTTTAGCTGCATAATGG - Intronic
1065940920 10:30563302-30563324 CACAATTATTGGATGGAGCCCGG + Intergenic
1069585512 10:69598389-69598411 AAGAAATATTAACTGGAGATTGG - Intergenic
1069998498 10:72358250-72358272 CATGATTCTTAGCAGGAGACAGG - Intergenic
1070398918 10:76035847-76035869 AAGAATTAGTAGCAGGAGTCGGG - Intronic
1072704222 10:97668570-97668592 CATTATTATTATCTTGAGACAGG - Intronic
1073110323 10:101059507-101059529 CAGAATGATGAGCTGGAGTGTGG - Intergenic
1073916427 10:108409844-108409866 CAAAAATCTTAGTTGGAGACAGG - Intergenic
1074635791 10:115315726-115315748 CATTATTATTACCTGGACACTGG - Exonic
1075488764 10:122848314-122848336 AAGAATTATTAGCTAGTAACAGG - Intronic
1078486638 11:11729273-11729295 CAGAATGATTAGCCTGGGACAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1084625422 11:70302482-70302504 CAGAGCTGTGAGCTGGAGACAGG + Intronic
1091133970 11:133171179-133171201 CAGAATTGGTAACTGCAGACAGG - Intronic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1105894733 13:24708334-24708356 CTGAATTCTTAGCAGGAAACTGG + Intronic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108552326 13:51558985-51559007 CAGAAGAAGTATCTGGAGACAGG - Intergenic
1109511465 13:63380288-63380310 CTGAATTATTAGATGAAGATTGG + Intergenic
1110771544 13:79354194-79354216 CATAAATATTAACTGGAGAGAGG + Intronic
1113210945 13:107980078-107980100 CAAAAATATTTGCTGGAGAAAGG - Intergenic
1120045926 14:79806104-79806126 TAGAATTAATAGCTGGAGTTGGG + Intronic
1120927771 14:89814828-89814850 CAGAGTTATTAGCTGGGCATAGG - Intronic
1122496827 14:102162945-102162967 CAAAATTATCTGCTGGTGACTGG + Intronic
1126963596 15:54026565-54026587 CAGCAAAATCAGCTGGAGACTGG - Intronic
1128285884 15:66436735-66436757 CAGATGAATTAGCTGGAGAAAGG - Exonic
1134139456 16:11705047-11705069 CAGAAAAATTAGCTGGACATGGG - Intronic
1137284340 16:47002772-47002794 AAGATTTATCAGCTGGAGGCTGG + Intergenic
1137857162 16:51806530-51806552 CAAAATTCTTAGCTGCTGACAGG - Intergenic
1141962413 16:87417923-87417945 CAGAAATCTTAGCTGCAGAAAGG - Intronic
1147714962 17:42499937-42499959 TAAAATTATTAGCTGTGGACTGG + Intronic
1149820361 17:59771177-59771199 TTGAATTATTAACTGGAGACAGG + Intronic
1151908950 17:77068824-77068846 CAGAATAATTGTCTGGACACTGG - Intergenic
1152503760 17:80732237-80732259 CAGATTTATGGGCTGGAGAGTGG + Intronic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156370357 18:36467243-36467265 CAGAATTACTAGGAGGTGACTGG - Intronic
1156820729 18:41369827-41369849 CATAATTATTAGATGTAAACTGG - Intergenic
1157420197 18:47541370-47541392 CAGAAATATCAGGTGGAGGCTGG + Intergenic
1158182068 18:54727952-54727974 CAGAGTTTTTAGCTGTAGTCAGG - Intronic
1161639777 19:5414469-5414491 CAGAATTATAAGATGAAGAATGG - Intergenic
1165182932 19:33988206-33988228 CAGAATTATTACCTGGCTGCTGG - Intergenic
1165992064 19:39821796-39821818 TAGAATTTTAAGCTGGGGACAGG - Intergenic
1166190798 19:41175322-41175344 CAGAATTCTTAGCCGGAGAGTGG - Intergenic
1166591982 19:44007731-44007753 CAGAATGATAAGCGGGACACAGG - Intronic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
927552882 2:24014306-24014328 CACAAAAATTAGCTGTAGACTGG - Intronic
932167499 2:69521605-69521627 CAGAAGTTTTAGCTGGGCACAGG + Intronic
932282903 2:70509985-70510007 GAGAAACATTAGCTGGAGGCAGG - Intronic
933478558 2:82823459-82823481 CAGAATTATTCTCTGGACAATGG - Intergenic
935377806 2:102417920-102417942 AAGAATTAGTAACTGCAGACAGG - Intergenic
935458744 2:103302388-103302410 CAGATATAATAGCTTGAGACAGG + Intergenic
938839761 2:135148806-135148828 AAGAATTACTAGCTTGAGGCTGG - Intronic
939675337 2:145065433-145065455 CAGAATAAATACCAGGAGACTGG + Intergenic
942342097 2:174959484-174959506 CAGAATTAGTTGCTGAAGGCAGG + Intronic
943305983 2:186263450-186263472 CATAATTACTAGCTGAACACAGG + Intergenic
943699168 2:190971486-190971508 CAGAATTATTTGTTGGGGATTGG - Intronic
943887531 2:193240915-193240937 GAGAATTTTTAGCCAGAGACAGG - Intergenic
945256822 2:207810144-207810166 CAGAATTTCAAGATGGAGACAGG + Intergenic
1169510697 20:6260979-6261001 CAGAATTTTGAACTGGGGACAGG + Intergenic
1172479937 20:35265174-35265196 TAGAATTTTGAGCTGCAGACTGG - Intronic
1173111960 20:40199424-40199446 CAGAAATATAAGGAGGAGACAGG - Intergenic
1174535956 20:51251645-51251667 CAGCAATGTTAGCTGGAGACAGG + Intergenic
1176656817 21:9594348-9594370 CATATTTTTTTGCTGGAGACGGG - Intergenic
1178189020 21:30258720-30258742 CTGAATTATTAGTTGAAGATGGG - Intergenic
1178392583 21:32211344-32211366 CAGGATTATTAATTGGAGAAAGG + Intergenic
1179327020 21:40357293-40357315 CTGAATAATTAAGTGGAGACAGG + Intronic
1179729054 21:43357312-43357334 CAAAATTATTATTTTGAGACGGG - Intergenic
950882474 3:16334446-16334468 CAGAGTTATTCACTGGAGAGCGG + Intronic
950943657 3:16921717-16921739 CAGAATTTTTTTCTGAAGACAGG + Intronic
951785556 3:26414814-26414836 CTGAATTATTAACTGGAGGGAGG + Intergenic
955469912 3:59275649-59275671 CAGAATTAATTGCAGCAGACTGG + Intergenic
955841215 3:63114980-63115002 CAGGGTTATCAGCTGGTGACTGG - Intergenic
956827584 3:73012801-73012823 GAGATTTGTTAACTGGAGACTGG + Intronic
965526016 3:169719135-169719157 CAAGAATATTAGCTGGAGAATGG + Intergenic
970000694 4:11363296-11363318 CTGATTTTTTACCTGGAGACAGG - Intergenic
971579147 4:28311449-28311471 CAGAATTATTGCTAGGAGACAGG - Intergenic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
974162982 4:58164140-58164162 CAAAATTATTAGTTTGATACTGG - Intergenic
977145256 4:93431664-93431686 CAGAAATTTTAGATGGAGAGGGG + Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
978165599 4:105603008-105603030 CAGAGTCCTTATCTGGAGACAGG - Intronic
979532059 4:121779510-121779532 CAGAAACAATAGCTGGAGAATGG - Intergenic
980621386 4:135309247-135309269 CATAATTATTCTCTGGAGAAGGG - Intergenic
980759229 4:137207019-137207041 GAGAATTTTTAGCTGAAGAAAGG + Intergenic
983778361 4:171637519-171637541 CACAAAAATTAGCTGGAGAGTGG - Intergenic
984211028 4:176848628-176848650 CAGACTTAATGGCTGGAAACAGG + Intergenic
984992831 4:185397159-185397181 CTGAAGCATTTGCTGGAGACAGG + Exonic
987058854 5:14222771-14222793 CAGGATTCTTACCTGGAAACAGG - Intronic
993602363 5:89943293-89943315 CAGAAAATTTAGCTGCAGACGGG + Intergenic
994650916 5:102526322-102526344 CAGTATTATTAGGTGGATATAGG + Intergenic
995299463 5:110560821-110560843 CAGATTTATTGGCTGGAGCTGGG - Intronic
996499112 5:124196982-124197004 CAAGATTATTTGCTGAAGACTGG - Intergenic
998471950 5:142390377-142390399 CAGATTTCTAAGCTGAAGACAGG - Intergenic
999093797 5:148959891-148959913 CAGAATCATTTGATGCAGACTGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999753217 5:154645775-154645797 CAGGCTTATTAGCTGGAGTGTGG - Intergenic
1001109798 5:168886186-168886208 CAGTATTGTTAGCCGGAGAAGGG - Intronic
1002945424 6:1756755-1756777 CAGAACGCTTAGCTGGAGAATGG - Intronic
1010962473 6:82161860-82161882 TACAATTATTAGCTTAAGACTGG - Intergenic
1011270591 6:85575507-85575529 CAGATTTATTATTGGGAGACAGG - Intronic
1011887497 6:92115139-92115161 AAGAATTTTAAGCTGGAGAATGG - Intergenic
1013302911 6:108820907-108820929 CAGGATTATCTGCTGGAGAGTGG - Intergenic
1016375261 6:143413842-143413864 CAGAAGTATTAGTTGGTTACTGG + Intergenic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1020434291 7:8146158-8146180 CAAAATTATTAGCTAGCGATGGG + Intronic
1021212976 7:17879061-17879083 CAGAATGCATAACTGGAGACAGG - Intronic
1021860339 7:24899858-24899880 CAGAATTTCTATCTAGAGACGGG + Intronic
1023698324 7:42870003-42870025 CAGAATTATTACCAGGAAAGAGG + Intergenic
1026173087 7:67971863-67971885 CTCAAATATTAGATGGAGACAGG + Intergenic
1026664305 7:72329333-72329355 CAGAATGGACAGCTGGAGACAGG + Intronic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1031957142 7:127954166-127954188 CAGAAATATTTGCTGGAGTAAGG - Intronic
1033324358 7:140365100-140365122 GACAATAATTAGCTGGAGACAGG + Intronic
1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG + Exonic
1040384918 8:46908201-46908223 CAGTGTTATTAGCTGGAAAGGGG - Intergenic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1041854516 8:62435393-62435415 CAGAATTAGTATGTGGAGCCAGG + Intronic
1042437120 8:68779502-68779524 CAGAATTAAAAGCACGAGACAGG + Intronic
1043712790 8:83443439-83443461 CACAATTATCAGCTGCAGAGTGG + Intergenic
1044301012 8:90582851-90582873 TAGAATTAATAGCTAGAGAACGG - Intergenic
1046093697 8:109533478-109533500 TAGAATTATTGGCTGGGCACTGG + Intergenic
1046650478 8:116831898-116831920 CATATTTAGAAGCTGGAGACAGG - Intronic
1048319778 8:133389344-133389366 CAGAAGAATTGGCTAGAGACTGG - Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1203634531 Un_KI270750v1:97832-97854 CATATTTTTTTGCTGGAGACGGG - Intergenic
1186202712 X:7170441-7170463 CAAAATTATTATTTTGAGACAGG + Intergenic
1186235441 X:7503506-7503528 CATAATTATAAGCTGAAGAACGG + Intergenic
1187163154 X:16782839-16782861 CAGAGTTTATAGCTGGACACAGG - Intergenic
1193709841 X:84865957-84865979 CAAAATTATTTTCTGGAGAATGG - Intergenic
1193882981 X:86948258-86948280 TAGAGTTATTAGCTAGAAACTGG - Intergenic
1194181076 X:90713280-90713302 CATAATTTTTTGGTGGAGACGGG + Intergenic
1194186991 X:90783449-90783471 CAAAATTATTCACTGGTGACTGG + Intergenic
1195369214 X:104156630-104156652 CATTATTTTTAGCTGGGGACAGG - Intronic
1195551872 X:106180732-106180754 CTGAATTATTATCTGGATATAGG - Intronic
1195684300 X:107571652-107571674 CAGAATTACTGACTGGAGGCTGG - Intronic
1197862416 X:130984813-130984835 AAGATTTATTATTTGGAGACAGG + Intergenic
1198998973 X:142609826-142609848 CAGATTTATTAGAGTGAGACTGG + Intergenic
1200533580 Y:4365526-4365548 CAAAATTATTCACTGGTGACTGG + Intergenic