ID: 977542568

View in Genome Browser
Species Human (GRCh38)
Location 4:98335307-98335329
Sequence CAGGTTGGTCATGCAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977542563_977542568 19 Left 977542563 4:98335265-98335287 CCATCAGGCTACAAGGATCAATA 0: 1
1: 0
2: 0
3: 4
4: 118
Right 977542568 4:98335307-98335329 CAGGTTGGTCATGCAGTTGCTGG 0: 1
1: 0
2: 3
3: 69
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977542568 Original CRISPR CAGGTTGGTCATGCAGTTGC TGG Intronic
900233729 1:1576027-1576049 AGGGTTGGACAGGCAGTTGCTGG + Intergenic
900694137 1:3999752-3999774 CAGGGTGGGCATGGAGTTGCAGG + Intergenic
901720054 1:11189804-11189826 CAGCGTGGTCATGCAGGTGATGG + Exonic
903569028 1:24290702-24290724 TAGTTTGGTCATCCAGTTGGTGG - Intergenic
904537175 1:31207575-31207597 CAGGGGGGTCAGGCAGCTGCTGG - Intronic
906499954 1:46334445-46334467 AAGGTTGGACAGGCAGTTACTGG - Intergenic
906681488 1:47728939-47728961 AAGGTTGGACAGGCAGTTACTGG - Intergenic
906911072 1:49951484-49951506 AAGGTTGGACAGGCAGTTGCTGG - Intronic
907019186 1:51048867-51048889 AAGGCTGGACAGGCAGTTGCTGG - Intergenic
908474580 1:64474892-64474914 CAGGTTGGTCAGACAGCTGCTGG + Intronic
909621358 1:77671066-77671088 GAGGTTGGACCGGCAGTTGCTGG - Intronic
910238979 1:85065522-85065544 GAGGTTGGACAGGCAGTTCCTGG + Intronic
910417344 1:87014760-87014782 AAGGTTGGACAGCCAGTTGCTGG - Intronic
911401736 1:97383895-97383917 CAGGTTGGTCATGAATTTCTGGG - Intronic
912541377 1:110418675-110418697 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
914932628 1:151948685-151948707 CAAGTTGGACAGGCAGTGGCTGG - Intergenic
919928586 1:202206778-202206800 CAGGCTGGTCTTGAACTTGCTGG + Intronic
921460727 1:215423478-215423500 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
922193292 1:223338701-223338723 CAGGCTGCGCATGCAGCTGCAGG + Intronic
922449054 1:225722048-225722070 CAGATTGGACATGTAGTAGCAGG - Intergenic
922742243 1:228020510-228020532 CCGGATGGTCATCCAGTTGCCGG + Intronic
922842636 1:228655978-228656000 CAAGATTGTCAGGCAGTTGCTGG - Intergenic
922938652 1:229440981-229441003 GAGGTTGGACAGGGAGTTGCTGG - Intergenic
923069873 1:230553059-230553081 GAGGTTGGACAGGCAGTAGCTGG + Intergenic
923070135 1:230556565-230556587 AAGGTTGGACAGGCGGTTGCTGG + Intergenic
923321129 1:232834622-232834644 AAGGTTGGACAAGCAGTTGCTGG - Intergenic
923374423 1:233345887-233345909 CACAGTGGTCATCCAGTTGCTGG - Intronic
924323975 1:242876934-242876956 GAGGTTAGACAGGCAGTTGCTGG + Intergenic
924938493 1:248792446-248792468 GAGGTTGGACAAGCAGTTGCTGG + Intergenic
1063141806 10:3262497-3262519 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1064576832 10:16754977-16754999 CAGCCTGTTCATGCTGTTGCAGG + Exonic
1064902467 10:20310194-20310216 AAGGTTGGACAGGCAATTGCTGG - Intergenic
1065848694 10:29768226-29768248 GAGGTCGGACAGGCAGTTGCTGG - Intergenic
1067013295 10:42734698-42734720 CAGCCTGTTCATGCTGTTGCAGG - Intergenic
1067310538 10:45109403-45109425 CAGCCTGTTCATGCTGTTGCAGG + Intergenic
1067391049 10:45864737-45864759 CAGGTTGGACAGGCAGTTCTGGG + Intergenic
1067432949 10:46255904-46255926 TAGGTTGGCCAGGCAGTTGCTGG - Intergenic
1067872231 10:49971368-49971390 CAGGTTGGACAGGCAGTTCTGGG - Intronic
1069853148 10:71423559-71423581 CAGGGGGGTGATGCATTTGCTGG + Intronic
1070138238 10:73714961-73714983 CAGGTTGGACAGGCAGTTCTGGG + Intergenic
1072408512 10:95177596-95177618 AAGGTTGGAGAGGCAGTTGCTGG - Intergenic
1072745646 10:97937372-97937394 CAGGGTGGTGGTGCAGTGGCGGG - Intronic
1072746132 10:97940545-97940567 CGGGTTGGTCATGCCCTTGATGG - Intronic
1075173703 10:120139990-120140012 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1075967795 10:126627796-126627818 CAGGTTGGTCTTGAAATTGTGGG + Intronic
1076198153 10:128535590-128535612 CAGGCTGGTCCTTCAGCTGCTGG + Intergenic
1076575578 10:131464610-131464632 CAGGTTGGGGATCCAGATGCCGG - Intergenic
1078536485 11:12179172-12179194 CAGGTTGGTGAGGCAGGAGCTGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079424303 11:20325688-20325710 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1079555547 11:21754195-21754217 GAGGTTATTCATGCAGATGCAGG - Intergenic
1081440981 11:43080656-43080678 GAGGTTGGACAAACAGTTGCTGG + Intergenic
1082172887 11:49027138-49027160 CAGGGTGGTCAGTCAGTTGGTGG + Intergenic
1082683452 11:56208512-56208534 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1083372541 11:62193347-62193369 GAGGTCGGTCATGCAGCTCCTGG - Intronic
1084828337 11:71748369-71748391 CAATTGGATCATGCAGTTGCAGG + Intergenic
1086322610 11:85665957-85665979 AAGGTTGGACAGGCAGTTTCTGG - Intronic
1086692883 11:89808920-89808942 CAGGGTGGTCAGTCAGTTGGTGG - Intergenic
1086712917 11:90030739-90030761 CAGGGTGGTCAGTCAGTTGGTGG + Intergenic
1087602098 11:100329395-100329417 CAGGTTTCTCAGGCAGTGGCTGG - Intronic
1087718228 11:101632976-101632998 CAGGTGAGTCATGCAGTAACTGG - Intronic
1090889037 11:130906560-130906582 GATGTTGGTCCTGCAGTTACAGG - Intronic
1092076828 12:5680923-5680945 CAGGTCTGTCATGCAGAGGCTGG - Intronic
1093065012 12:14648508-14648530 GAGGTTGGACAGGCAGTTGTTGG - Intronic
1094799728 12:34019179-34019201 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1095112517 12:38313498-38313520 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1096205807 12:49720756-49720778 GAGGTTGGACAAGCAATTGCTGG - Intronic
1096401652 12:51312296-51312318 AAGGTTGAACAGGCAGTTGCTGG - Intronic
1096553589 12:52390009-52390031 CTGGTTGGCCATGCAGGTTCTGG + Intergenic
1097128575 12:56792889-56792911 CAGGTTGGACAGGCAGTTCTGGG + Intergenic
1097314189 12:58154611-58154633 AAGGTTGGGCAGGCAGTGGCTGG - Intergenic
1098786346 12:74761570-74761592 GAGGTTAGACAGGCAGTTGCTGG - Intergenic
1099310360 12:81012851-81012873 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1099428641 12:82553804-82553826 CAGGTTGGCCCTGCAGCTCCAGG - Intergenic
1099795101 12:87390310-87390332 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1100535966 12:95509487-95509509 GAGGTTGGGCAGGCAGTTGTTGG + Intronic
1101373240 12:104149246-104149268 AAGGTTGGACAGGCAGCTGCTGG - Intergenic
1101503437 12:105325607-105325629 CAGGTTCGACAGGCAGTTGCTGG + Intronic
1102080115 12:110091067-110091089 CAGGCTAGTCATTCAGTTCCAGG - Intergenic
1102694099 12:114784722-114784744 GAAGTTGGACAGGCAGTTGCTGG - Intergenic
1103228791 12:119310330-119310352 CTGGTTGGTTATGCAGTAGCAGG - Intergenic
1104003268 12:124873979-124874001 CAGGCTGGTCTTGAACTTGCTGG - Intronic
1104513637 12:129404086-129404108 CAGGATGGGGATGCAGTTGGAGG + Intronic
1104840339 12:131821480-131821502 GGGGTTGGACAGGCAGTTGCTGG - Intergenic
1107984533 13:45764101-45764123 AAAGTTGGACAGGCAGTTGCTGG + Intergenic
1112673203 13:101665907-101665929 AAGGTTAGGCAGGCAGTTGCTGG - Intronic
1113196080 13:107808123-107808145 AAGGTTGGACAGGCAGTTGCGGG + Intronic
1113909154 13:113833952-113833974 CAGGTAGGTCATGCTGTGACAGG + Intronic
1113909196 13:113834168-113834190 CAGGTAGGTCATGCTGTGACAGG + Intronic
1115549676 14:34493850-34493872 AAGGTTGAACAGGCAGTTGCTGG + Intergenic
1117654887 14:57944953-57944975 AAGGTTGGGCAGGCAGATGCTGG - Intronic
1118204659 14:63711444-63711466 AGGATTGGTCATGCAGTTGTAGG + Intronic
1119433467 14:74583324-74583346 CAGGTTTCTCAAGCAGTTGCTGG - Intronic
1119751170 14:77078514-77078536 CAGTTTTGTCATGGAGTTGGGGG - Intergenic
1120753833 14:88223194-88223216 AAGGTTGGACAGTCAGTTGCTGG - Intronic
1121636208 14:95455451-95455473 CAGGATGGTCCTGCAGAGGCTGG - Exonic
1122668034 14:103347564-103347586 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
1123201868 14:106673871-106673893 AAGGTTGAACAGGCAGTTGCAGG + Intergenic
1202943602 14_KI270726v1_random:6433-6455 AAGGTTGAACAGGCAGTTGCAGG - Intergenic
1123990725 15:25681304-25681326 GAGGTTGGACAGACAGTTGCTGG - Intronic
1125844624 15:42840359-42840381 CTATGTGGTCATGCAGTTGCAGG - Exonic
1126193536 15:45904669-45904691 GCGGTTGGACAGGCAGTTGCTGG + Intergenic
1127285434 15:57528794-57528816 CAGGCTGGTCAAGCAGATGGAGG + Exonic
1127847649 15:62885436-62885458 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1128799436 15:70488228-70488250 CTGGTTGGCCATGCAGTTCAAGG - Intergenic
1130824292 15:87527950-87527972 CAGGTGGGGACTGCAGTTGCAGG + Intergenic
1131155738 15:90074129-90074151 CAGGTTGTACATGCGGTTGAAGG - Exonic
1131506784 15:93026581-93026603 CAGGTGGCTCATGCAGTCACCGG - Exonic
1135663898 16:24319373-24319395 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1135700851 16:24631250-24631272 CAGGTTTCTCAAGCAGTTGTAGG - Intergenic
1136055687 16:27687854-27687876 CAGAATGGTCTTGCTGTTGCAGG - Intronic
1136709587 16:32225572-32225594 AAGGTTGGACAGGCATTTGCTGG - Intergenic
1136758322 16:32703841-32703863 AAGGTTGGACAGGCATTTGCTGG + Intergenic
1136809786 16:33166534-33166556 AAGGTTGGACAGGCATTTGCTGG - Intergenic
1136816262 16:33276614-33276636 AAGGTTGGACAGGCATTTGCTGG - Intronic
1139371444 16:66471839-66471861 CAGGTTGGTGATGCAGGGGTGGG - Intronic
1140525403 16:75618732-75618754 CAGGATGGTCATGTAGCTCCTGG + Intronic
1141152553 16:81574276-81574298 CAGGGTGGCCAAGCAGTTGGAGG - Intronic
1203060473 16_KI270728v1_random:964188-964210 AAGGTTGGACAGGCATTTGCTGG + Intergenic
1143657248 17:8302532-8302554 CAGGTTGGAGATGGAATTGCAGG + Intergenic
1144106968 17:11994987-11995009 AGGGTTGGTCTTGCAGTCGCAGG + Intronic
1146541254 17:33697362-33697384 CAGGTTGGTCTTGCTGTCTCAGG + Intronic
1146609544 17:34292102-34292124 CAGGTTGGACATTCAGCTACAGG + Intergenic
1148213391 17:45821293-45821315 CAGGATGGTCAGGCAGGGGCCGG + Intronic
1151601455 17:75108779-75108801 AAGGTTGGACAAGCGGTTGCTGG + Intergenic
1151798153 17:76360537-76360559 CAGGTTGTACAGGCAGTTGCTGG + Intronic
1152045511 17:77932521-77932543 CAGGTTGGTCTTGAACTTCCGGG + Intergenic
1153269233 18:3303224-3303246 CAGGCTGGTCATGAACTTGTGGG + Intergenic
1153948390 18:10036872-10036894 CAGGTTGGTCTTGAACTTGTGGG + Intergenic
1155211544 18:23606519-23606541 CAGGTTGGTCTTGAACTTCCAGG + Intronic
1158265252 18:55654280-55654302 CAGGCTGGGCATGCAGTTGAGGG + Intronic
1159062362 18:63529307-63529329 AAGGTTGGTCAGGCGGTTGCTGG + Intergenic
1160195608 18:76752599-76752621 AAGTTTGGACAGGCAGTTGCTGG + Intergenic
1160546689 18:79661783-79661805 AAGGTTGGACAGGCAGGTGCTGG - Intergenic
1160588042 18:79923344-79923366 CAGGTGGGTCATGCATGGGCAGG + Intronic
1161762793 19:6186905-6186927 CAGGTTGGTCTAGCACTTGTGGG + Intronic
1164142359 19:22484112-22484134 ACGGTTGCTCATGCTGTTGCAGG + Intronic
1164749491 19:30641970-30641992 GAGATTGGCCATGCACTTGCAGG + Intronic
1165836447 19:38759771-38759793 AAGGTTGGACAGGCAGTTACTGG - Intronic
1165902428 19:39175005-39175027 CTGGGTGGTCATGGAGTTCCTGG + Exonic
1166515275 19:43441928-43441950 GGGGTTGGACAGGCAGTTGCTGG + Intergenic
1166517142 19:43455654-43455676 ATGGTTGGTCAATCAGTTGCAGG - Intergenic
1166536245 19:43576723-43576745 CAGGCTGGTCCTGCGGGTGCGGG - Intronic
1166610454 19:44188975-44188997 AAGGTTGGACAGCCAGTTGCTGG + Intergenic
1166610935 19:44195621-44195643 AAGGTTGGACAGCCAGTTGCTGG + Intergenic
1166912371 19:46168309-46168331 GAGTTTGGACAGGCAGTTGCTGG + Intergenic
1166968082 19:46543118-46543140 CAGGTTGGTCTTGCAGTCTTGGG - Intronic
1167226867 19:48250324-48250346 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1167227275 19:48254892-48254914 TAGGTTGGACCAGCAGTTGCTGG - Intronic
1168012321 19:53543212-53543234 CAGGTTGGTCTTGAACTTGTGGG - Intronic
925008096 2:461127-461149 CAGGCTGCGCAAGCAGTTGCTGG - Intergenic
925698237 2:6605753-6605775 TAGATTGTTCATGCAGGTGCAGG - Intergenic
925961023 2:9016377-9016399 CAGATGGCTCATTCAGTTGCTGG + Intergenic
926459123 2:13106546-13106568 AAGGTTAGGCAAGCAGTTGCCGG - Intergenic
927298193 2:21479308-21479330 GAGGTTGGAGAGGCAGTTGCTGG + Intergenic
927578711 2:24222479-24222501 GAGGTTGGACAGGCAGTTGCTGG - Intronic
928612454 2:33003911-33003933 AACGTTGGACAGGCAGTTGCTGG - Intronic
928818475 2:35329126-35329148 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
930086094 2:47498300-47498322 CAGTGTGGTCTTGCAGTTGTGGG - Intronic
930188314 2:48432212-48432234 AGGGTTGGGCAGGCAGTTGCTGG + Intergenic
930520734 2:52463647-52463669 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
930899231 2:56483316-56483338 GAGGTTGGACAGGCAGTTACTGG - Intergenic
933245838 2:79973814-79973836 AAGGTTGGACAGGCAGTTGCTGG + Intronic
933868128 2:86543524-86543546 AAGTTTGGACAGGCAGTTGCTGG - Intronic
934612389 2:95750934-95750956 CAGAATGGACTTGCAGTTGCTGG - Intergenic
934841764 2:97628513-97628535 CAGAATGGACTTGCAGTTGCTGG + Intergenic
935141690 2:100358811-100358833 GGGGTTGGACAGGCAGTTGCTGG - Intergenic
936274217 2:111079476-111079498 CAGGATGGTCATGGAGAGGCAGG - Intronic
936473609 2:112820537-112820559 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
936559373 2:113523449-113523471 CAGGTTGGACAGGCAGTTGTTGG - Intergenic
936608660 2:113980480-113980502 AAGGTTAGACAGGCAGTTGCTGG + Intergenic
936964135 2:118110455-118110477 GGGGTTGGTCTTGCTGTTGCGGG + Intronic
938790907 2:134674836-134674858 GAGGTTGGATAGGCAGTTGCTGG - Intronic
939065547 2:137479481-137479503 CAGGTTGGAGCAGCAGTTGCTGG + Intronic
939231929 2:139438609-139438631 AAGTTTGGACAGGCAGTTGCTGG + Intergenic
940678299 2:156752310-156752332 GAGGTTGGACCAGCAGTTGCTGG - Intergenic
941190647 2:162377555-162377577 GAGATTGGACAGGCAGTTGCTGG + Intronic
944177704 2:196851347-196851369 GAGGTTGGACAAGTAGTTGCTGG - Intronic
944178230 2:196857791-196857813 GAGGTTGAGCAGGCAGTTGCTGG - Intronic
944247592 2:197547207-197547229 GGGGTTGGTCTTGCCGTTGCTGG + Intronic
944795923 2:203185098-203185120 AAGGTTGAACAGGCAGTTGCTGG + Intronic
945287875 2:208100258-208100280 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
945673464 2:212830040-212830062 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
945860122 2:215111596-215111618 CAAGTTGGTTTTGCAGTTGGAGG + Exonic
946618975 2:221540665-221540687 CTGGCTGGTTATCCAGTTGCAGG - Intronic
946829878 2:223717688-223717710 GAGGTGGGACAAGCAGTTGCTGG + Intergenic
947295188 2:228623072-228623094 CAGGTTAGACAGGCAGTTGCTGG - Intergenic
947531399 2:230910765-230910787 CAGGTTGATCATGTAGATGGAGG + Exonic
947718534 2:232353694-232353716 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
948667359 2:239545061-239545083 GAGGTTGGTCTTGCAGTGGGCGG + Intergenic
948715015 2:239855573-239855595 AAGGGTGGACAGGCAGTTGCTGG - Intergenic
948836867 2:240630116-240630138 CAGGTTGGTCATGTAGATGCGGG - Exonic
1169325870 20:4676035-4676057 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1170644253 20:18182656-18182678 CAGGGTGATCATGGAGCTGCAGG - Intronic
1171320281 20:24237138-24237160 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
1172035653 20:32009081-32009103 AAAGTTGGACAGGCAGTTGCTGG - Intergenic
1172608630 20:36232583-36232605 GATGTTGCTCATGCAGTTTCAGG - Exonic
1174349858 20:49959262-49959284 GAGGTTGTACAGGCAGTTGCTGG - Intergenic
1174924922 20:54749061-54749083 ATGGTTGGACAGGCAGTTGCTGG + Intergenic
1175306752 20:57981500-57981522 GAGGCGGGTCATGCAGGTGCAGG + Intergenic
1175619805 20:60433924-60433946 GAGGTTGGACAGGAAGTTGCTGG + Intergenic
1175676686 20:60952193-60952215 CAGGTTTGAAATGCAGCTGCAGG - Intergenic
1175702394 20:61149332-61149354 CAGGATGGGCAGGCAGCTGCCGG + Intergenic
1176742196 21:10615169-10615191 CAGGTATGTAAGGCAGTTGCCGG - Intergenic
1178034893 21:28569670-28569692 AAGGTTGGACAAGCAGTTGCTGG - Intergenic
1178445546 21:32638274-32638296 CAGGCTGGTCTTGAACTTGCAGG + Intronic
1179519999 21:41936671-41936693 GGGGTTGGTCATGCTGTAGCAGG - Intronic
1179649353 21:42796834-42796856 AAGGTTGGGCAGGCAGTCGCTGG + Intergenic
1180210019 21:46289843-46289865 AAGGTTAGACAGGCAGTTGCTGG + Intronic
1181383941 22:22529575-22529597 AAGGTTGGAGAGGCAGTTGCTGG + Intergenic
1184018265 22:41801988-41802010 GAGGTTGGACAGGCAGTTGCAGG + Intronic
1184128533 22:42503524-42503546 CAGGCTGATCACGCAGTGGCAGG + Intergenic
1184137327 22:42556839-42556861 CAGGCTGATCACGCAGTGGCAGG + Intronic
1184602903 22:45553957-45553979 CAGGCTGGTCCTGAAGTTGCTGG + Intronic
1184724192 22:46333872-46333894 AGGGTTGGACAAGCAGTTGCTGG - Intronic
1184822010 22:46916449-46916471 CAGTTTGGTCCTGCTGTTGATGG + Intronic
1184915824 22:47568338-47568360 AAGGTTGGACAGGCAGCTGCTGG - Intergenic
1184957839 22:47903766-47903788 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
949549753 3:5103086-5103108 GAGGTTGGACAGGCAGTTACTGG + Intergenic
951615908 3:24543722-24543744 GAGGTTGGACAGGCAGTTACTGG + Intergenic
952591238 3:34956634-34956656 AAGGTTGAACAGGCAGTTGCTGG + Intergenic
953042276 3:39266087-39266109 CCGGTTGTTCATGGAGTTGGCGG + Exonic
953146923 3:40286154-40286176 GAGGTTGGAGAGGCAGTTGCTGG - Intergenic
953220728 3:40969430-40969452 CTGGTTGCACATGCAGGTGCTGG + Intergenic
955444961 3:59000025-59000047 AAGGTTGGACAGGCAGTTTCTGG - Intronic
955545901 3:60029835-60029857 GAGGTTGGACAGGCAGTTGTTGG + Intronic
956478645 3:69650771-69650793 GATGTTGGACAGGCAGTTGCTGG - Intergenic
958982121 3:100734006-100734028 GAGGTTGGACAGGCAGTTTCTGG + Intronic
961237243 3:125377527-125377549 GAGGTTGGACAGGCATTTGCTGG + Intergenic
961400807 3:126641036-126641058 GAGGCTGGACAGGCAGTTGCTGG - Intronic
962146689 3:132847056-132847078 AAGGTTAGACAGGCAGTTGCTGG - Intergenic
962247075 3:133804544-133804566 TAGGTTGGACAGGGAGTTGCTGG + Intronic
963024626 3:140906918-140906940 CAGGTTGGACAGGCAGTTGCTGG + Intergenic
963538559 3:146559061-146559083 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
965643074 3:170852131-170852153 CAGGTTGGTCTTGAACTTGTGGG - Intronic
966157672 3:176934741-176934763 AAGGGTGGTCATGAATTTGCAGG - Intergenic
966502020 3:180653287-180653309 AAGGTTGATCAGTCAGTTGCTGG - Intronic
966831032 3:184009073-184009095 CAGGTTGGTCTTGCACTCCCAGG + Intronic
968780684 4:2578902-2578924 GAGGTTGGTCTTGCTGTTTCAGG + Intronic
968887894 4:3345169-3345191 AAGGTTGGACAGGCAGTTGCGGG + Intronic
969324439 4:6432875-6432897 CGGGTTGGTCTTGCAGTCTCAGG - Intronic
969860738 4:10033723-10033745 CAGGTCGGCCAGGCAGCTGCAGG - Intronic
970393498 4:15641358-15641380 GGGGTTGGTCTTGCTGTTGCAGG - Intronic
970797004 4:19924638-19924660 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
972476522 4:39455477-39455499 CAGGCTGGTCTTGAACTTGCAGG - Intronic
973336346 4:48960296-48960318 CATGTTGGTCAGGCAGTGGTGGG + Intergenic
973544036 4:51962370-51962392 CAGGTTGGACAGGCAGTTATTGG + Intergenic
974774791 4:66465540-66465562 CATGTTGGTCAGGCTGTTCCTGG - Intergenic
975241964 4:72070497-72070519 AAAGTTGGACAGGCAGTTGCTGG + Intronic
975721602 4:77253882-77253904 GAAGTTGGCCATGCTGTTGCAGG + Intronic
976287926 4:83387971-83387993 AAGGTTGGACTGGCAGTTGCTGG + Intergenic
976735691 4:88306657-88306679 GACATTGGTCAAGCAGTTGCTGG + Intergenic
976857424 4:89621517-89621539 GAGATTGGACAGGCAGTTGCTGG + Intergenic
976920803 4:90440556-90440578 AAGGTTGGACAGGCAGTTGGTGG + Intronic
977281092 4:95041257-95041279 CAGGTTGGTCTTGAACTTCCGGG + Intronic
977541825 4:98327391-98327413 GAGGTTGGACAGACAGTTGCTGG + Intronic
977542568 4:98335307-98335329 CAGGTTGGTCATGCAGTTGCTGG + Intronic
977764388 4:100779444-100779466 AAGGTTGGACAGGAAGTTGCTGG - Intronic
978075691 4:104526893-104526915 CAGGTTGCTGGTGCATTTGCTGG + Intergenic
980929228 4:139169455-139169477 GAGGTTGGACATGAAGTTACTGG - Intronic
981307791 4:143264816-143264838 CAGGTTTATCATGCAGGTCCTGG - Intergenic
982170371 4:152655892-152655914 CTGGTGGGGCATGCAGTAGCTGG - Intronic
982418130 4:155161300-155161322 AAAGTTGGACAGGCAGTTGCTGG - Intergenic
982489129 4:156006508-156006530 CAGGTTGATCTGGCAGTTGATGG - Intergenic
983816243 4:172130141-172130163 CAGGTTGGACAGGCAGTTGTTGG + Intronic
983857737 4:172666543-172666565 AAGGTTGAACAAGCAGTTGCTGG - Intronic
983937285 4:173510732-173510754 CAGCTAGGTCTTCCAGTTGCCGG - Intergenic
985697689 5:1350340-1350362 GAGGTTGGACAGGCAATTGCTGG - Intergenic
985922928 5:2993654-2993676 CAGGTTGGGCTTGCAGAGGCAGG - Intergenic
986131080 5:4930956-4930978 AAGGTTGGACAGGCAGCTGCTGG + Intergenic
986213112 5:5692644-5692666 GAGGTTGGACAGGCAGTTGTTGG - Intergenic
986341385 5:6792211-6792233 GAGGTTGGACAGGCAGCTGCTGG + Intergenic
986518939 5:8593478-8593500 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
988696791 5:33629661-33629683 AAGGTTGCTCAGGAAGTTGCTGG - Intronic
992293807 5:75306917-75306939 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
992701988 5:79350091-79350113 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
993820424 5:92608176-92608198 GGGGATGGTCATTCAGTTGCAGG + Intergenic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
994690914 5:103018631-103018653 CACTTTAGTCATGCAGTTGGGGG - Intronic
995035500 5:107529756-107529778 GGGGTTGGCCATGCAGTTCCAGG - Intronic
995743997 5:115384551-115384573 AAGTTTGGACATGCATTTGCAGG + Intergenic
995797033 5:115952276-115952298 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
997117397 5:131139808-131139830 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
997784592 5:136697907-136697929 GAGGTTGGACAAGCAGTTGTTGG + Intergenic
997902772 5:137783293-137783315 AAGGTTGCACAGGCAGTTGCTGG - Intergenic
998000079 5:138618172-138618194 GAGCTTGGACAGGCAGTTGCTGG + Intronic
999174439 5:149621957-149621979 CCAGCTGGTCATGCAGTGGCTGG + Exonic
1000503919 5:162089905-162089927 AAGATTAGTCATGCAGTTTCTGG - Intronic
1001136025 5:169103615-169103637 CAGGGTGGGCATGCTGTTACCGG + Intronic
1001508885 5:172303471-172303493 AAGTTTGGACAGGCAGTTGCTGG - Intergenic
1003612307 6:7624971-7624993 GTGGTTGGACAGGCAGTTGCTGG - Intergenic
1004231467 6:13837539-13837561 GAGGTTGGACAGGTAGTTGCTGG - Intergenic
1005148182 6:22716711-22716733 CAGGTTATTCTTCCAGTTGCAGG - Intergenic
1005520104 6:26593621-26593643 GAGGTTGGACAGGCAGTTGTGGG - Intergenic
1006374788 6:33665832-33665854 CAGGTTTGTCATCCAGCTGCTGG + Exonic
1009059568 6:58381884-58381906 CACTTTAGTCCTGCAGTTGCAGG + Intergenic
1009198629 6:60717321-60717343 CAGGCTGGTCAAAGAGTTGCAGG + Intergenic
1009231345 6:61065532-61065554 CACTTTAGTCCTGCAGTTGCAGG - Intergenic
1010055463 6:71558915-71558937 CAGGTTGGTCAGGAAGCTGAGGG + Intergenic
1010500538 6:76594058-76594080 CAGGTTGCTCAGGCAGTGGGCGG - Intergenic
1011134559 6:84086303-84086325 CAGGTTGGACAGGCAGTTGCTGG + Intronic
1011197036 6:84792209-84792231 CCAGTCAGTCATGCAGTTGCAGG - Intergenic
1011415487 6:87115548-87115570 GAGGTTGAGCAAGCAGTTGCTGG - Intergenic
1012652249 6:101769933-101769955 GAGGTTAGACAGGCAGTTGCTGG + Intronic
1014849383 6:126322711-126322733 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1014850487 6:126334747-126334769 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1015204824 6:130624364-130624386 GAGGTTGGACAGGTAGTTGCTGG - Intergenic
1015214505 6:130734378-130734400 GAGCTTGGACAGGCAGTTGCTGG - Intergenic
1018629135 6:165806860-165806882 AAGGTTGGTCATAAAGTAGCAGG + Intronic
1018753414 6:166827309-166827331 GAGGTTGGACAGGCAGTTTCGGG - Intronic
1018825279 6:167404160-167404182 CAGGTTGGTCATGGAGCTCATGG + Intergenic
1018920662 6:168170258-168170280 CGGGTTGGACAGGCAGTTGCTGG - Intergenic
1021191904 7:17630523-17630545 CACATTTGACATGCAGTTGCAGG - Intergenic
1021869262 7:24987451-24987473 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1022361408 7:29663123-29663145 CAGTTTGGTCAGGCAGAAGCAGG + Intergenic
1022565264 7:31393387-31393409 GAGGTTGGAAAGGCAGTTGCTGG - Intergenic
1022935923 7:35176308-35176330 CAGTTTGGTCAGGCAGAAGCAGG - Intergenic
1023476283 7:40581926-40581948 CAGATTAGTCATGCAGGAGCAGG - Intronic
1023901976 7:44488610-44488632 CAGGTTGAACTTGAAGTTGCAGG - Intronic
1024403175 7:48948271-48948293 AAGATTGGACAGGCAGTTGCTGG - Intergenic
1024470223 7:49761789-49761811 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1024616932 7:51123692-51123714 CAGGGAAGTCATGCATTTGCTGG - Intronic
1025608794 7:63058702-63058724 CAGGCTGGTCTTGAACTTGCAGG + Intergenic
1026058203 7:67003634-67003656 AAGGTTGGACATGAAGTTGCTGG + Intronic
1026186524 7:68086003-68086025 CAGGCTGGTCATGAACTTGTGGG - Intergenic
1026712826 7:72757824-72757846 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1026719886 7:72821378-72821400 AAGGTTGGACATGAAGTTGCTGG - Intronic
1028325442 7:89518519-89518541 GAGGTTGGTCATGCAGCAGAGGG - Intergenic
1028429198 7:90727691-90727713 CAGTTTTGTCATATAGTTGCAGG - Intronic
1029136749 7:98378385-98378407 CAGGTGGAGCATGCAGCTGCAGG - Intronic
1029311802 7:99674186-99674208 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029313028 7:99685482-99685504 AAGGTTGGACAGGCAGTCGCTGG + Intronic
1029316671 7:99721946-99721968 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029322564 7:99777676-99777698 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029328163 7:99827708-99827730 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1029579840 7:101428561-101428583 AAGGTTGGACAGGCAGTCGCTGG + Intronic
1030412348 7:109197362-109197384 AAGGCTGGACAGGCAGTTGCTGG + Intergenic
1033344380 7:140515906-140515928 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1034700314 7:153089579-153089601 GAGGCTGGACAGGCAGTTGCAGG + Intergenic
1034940516 7:155227429-155227451 CAGGTTGGACAGGCACTGGCAGG + Intergenic
1035384298 7:158459966-158459988 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1035384311 7:158460039-158460061 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1035384321 7:158460112-158460134 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1035384334 7:158460185-158460207 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1036849302 8:12190565-12190587 CAGGCTCTTCATGCTGTTGCTGG + Intronic
1039707876 8:40025858-40025880 CATGTTGGTCAGGCTGTTGTGGG + Intergenic
1039901320 8:41754799-41754821 CAGTTTGGTTTTGCTGTTGCAGG - Intronic
1040627869 8:49172611-49172633 CAGGTTGATCATGCTGTACCAGG + Intergenic
1040935881 8:52781584-52781606 AAGTTTGGACAGGCAGTTGCTGG - Intergenic
1040959413 8:53015341-53015363 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1040965691 8:53078643-53078665 AAGGTTGGACAGTCAGTTGCTGG - Intergenic
1042069048 8:64910620-64910642 GAGATTAGACATGCAGTTGCTGG - Intergenic
1042124399 8:65523096-65523118 AATGTTGGACAGGCAGTTGCTGG - Intergenic
1042716733 8:71781353-71781375 GAGATTGGACAGGCAGTTGCTGG + Intergenic
1043909612 8:85846481-85846503 GAGGTTGGATAAGCAGTTGCTGG + Intergenic
1043909991 8:85852989-85853011 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1044057165 8:87585657-87585679 GAGGTTGGACAGGCAGTTGTTGG - Intronic
1047964169 8:130033397-130033419 GAGATTGGACAGGCAGTTGCTGG - Intergenic
1048921531 8:139235704-139235726 AAGGTTGGACAAGTAGTTGCTGG - Intergenic
1049893484 9:92748-92770 CAGGCTGGACAGGCAGTTGTTGG + Intergenic
1050454407 9:5819482-5819504 GAGATTGGACAGGCAGTTGCTGG - Intronic
1052368097 9:27636220-27636242 AAGGTTGGATAGGCAGTTGCAGG - Intergenic
1052580082 9:30344131-30344153 AAGATTGGACATGCAGTTGTTGG - Intergenic
1052931527 9:34059472-34059494 GAGGTTGGGCAGGCAGTTGTTGG + Intergenic
1053734703 9:41092816-41092838 CAGGTTGGACAGGCAGTTGTTGG + Intergenic
1054693677 9:68338581-68338603 CAGGTTGGACAGGCAGTTGTTGG - Intronic
1054830257 9:69617078-69617100 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1055879244 9:80978957-80978979 CAGGTTGGATAGGTAGTTGCTGG - Intergenic
1056213060 9:84382929-84382951 CAGGCTGGACAAGCAGTTGCTGG - Intergenic
1056863008 9:90204552-90204574 CAGGTTGGTGGTGCATTAGCAGG + Intergenic
1057078798 9:92156400-92156422 GAGGTTGGACAGGCAGTTGTTGG + Intergenic
1058033713 9:100227796-100227818 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1058154484 9:101499597-101499619 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1061740212 9:132697982-132698004 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1185850825 X:3484905-3484927 CAGGTGTCTCATGAAGTTGCAGG + Intergenic
1186089936 X:6035721-6035743 GAGGTTGGTCTTGCAGTCTCAGG - Intronic
1186149518 X:6659519-6659541 CAGGTCAGTCATGCAGATTCAGG + Intergenic
1189838829 X:45049463-45049485 CAGGTCTTTAATGCAGTTGCTGG + Intronic
1191677715 X:63809253-63809275 CAGGGTAGCCAGGCAGTTGCTGG - Intergenic
1196561495 X:117154554-117154576 CAAGTAGGTCATGCAGGAGCAGG - Intergenic
1196798189 X:119519211-119519233 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1198154343 X:133943996-133944018 CTGTTTGGTCATACTGTTGCAGG + Intronic
1198559886 X:137838097-137838119 CAGGTTTCTCAGGCAGTGGCAGG + Intergenic
1198691930 X:139293841-139293863 CAGGCTTGGCATTCAGTTGCAGG + Intergenic
1199456489 X:148035186-148035208 AAGGTTGGACAGGCAGTTGTTGG + Intergenic
1201512105 Y:14775766-14775788 CAGGTTGGCGATGCATGTGCTGG + Intronic
1201752064 Y:17443867-17443889 CAGTTTCGTCATACAGTTGATGG + Intergenic