ID: 977546477

View in Genome Browser
Species Human (GRCh38)
Location 4:98387818-98387840
Sequence CTCTGATAACATTCTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977546475_977546477 15 Left 977546475 4:98387780-98387802 CCTGGGTTACATTTTTGTGAATT 0: 1
1: 0
2: 0
3: 25
4: 291
Right 977546477 4:98387818-98387840 CTCTGATAACATTCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977546477 Original CRISPR CTCTGATAACATTCTCCTGG AGG Intronic
No off target data available for this crispr