ID: 977546614

View in Genome Browser
Species Human (GRCh38)
Location 4:98389527-98389549
Sequence ATGTGAGTATATAATGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977546612_977546614 26 Left 977546612 4:98389478-98389500 CCAACTGGATGGCTATATATTTT 0: 1
1: 0
2: 3
3: 22
4: 219
Right 977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG 0: 1
1: 0
2: 3
3: 25
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977546614 Original CRISPR ATGTGAGTATATAATGAATT TGG Intronic
905654924 1:39680364-39680386 ATGTGAGTATAGAATGAGATGGG + Exonic
906303152 1:44698392-44698414 ATGTGAGCAAATGATGAATCAGG - Intronic
907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG + Intronic
908287352 1:62621861-62621883 ATCTGAATATATTATGAATAAGG - Intronic
908711474 1:67020259-67020281 ATGTGAGGAAATAACGATTTGGG + Intronic
909430340 1:75581140-75581162 ATGTCATTATATGTTGAATTTGG - Intronic
909625832 1:77714934-77714956 CTATGAGTATATAATGTATTTGG - Intronic
909752931 1:79186273-79186295 ATCTGAGGATATAATGAAACAGG - Intergenic
910685644 1:89913306-89913328 ATGTTACTAAATAATGATTTTGG + Intronic
911441191 1:97927602-97927624 ATGTGAGGATATTATGAGGTGGG - Intergenic
911582078 1:99645555-99645577 ATGTGACTATATTAAGAAGTTGG - Intergenic
911803023 1:102168121-102168143 ATGTGAGAAGCTCATGAATTTGG + Intergenic
912176648 1:107166382-107166404 ATGGTAGTATATTATGTATTGGG - Intronic
912278726 1:108290052-108290074 ATGTGAGAAGAACATGAATTTGG - Intergenic
912289500 1:108404305-108404327 ATGTGAGAAGAACATGAATTTGG + Intronic
912312417 1:108636421-108636443 ATGTCAGAATAGAATGACTTTGG + Exonic
915435778 1:155904895-155904917 ATGTGGGCATTTAATGAATTTGG - Intronic
915993169 1:160538134-160538156 ATTATAGTATTTAATGAATTTGG + Intergenic
916151467 1:161796266-161796288 AGGTGTAAATATAATGAATTAGG - Intronic
916320259 1:163497865-163497887 ATGTGTGCATAAAATGAATTGGG + Intergenic
917074328 1:171188156-171188178 ATGTGAGTATGCAAGGATTTTGG - Intronic
918173597 1:182022745-182022767 ATCTGATTATCTAATTAATTAGG + Intergenic
918790419 1:188818937-188818959 ATGTGAATATATAAAAACTTTGG - Intergenic
918980669 1:191554518-191554540 ACGTTAGTATTTTATGAATTTGG - Intergenic
920659126 1:207900305-207900327 ATATGATTATATAATGATTATGG - Intronic
921422848 1:214968398-214968420 ATGAGAGTGAATAATGAATGTGG - Intergenic
1064102603 10:12476486-12476508 ATGTGACTATAAAATGAAGCTGG + Intronic
1065106083 10:22387077-22387099 ATATGAATATATTATGTATTTGG + Intronic
1065885751 10:30075445-30075467 ATGTGAATATTAAATCAATTGGG - Intronic
1065962043 10:30741773-30741795 ACGTGAGCATTTAAGGAATTTGG + Intergenic
1067950733 10:50735780-50735802 ATGAAATTATATATTGAATTTGG - Intergenic
1068016615 10:51524731-51524753 AGGTGAGTCTAAAATGAATAGGG + Intronic
1068595886 10:58902654-58902676 ATATCACTATATAATGAATTTGG + Intergenic
1068672161 10:59734083-59734105 ATGTGAATGTCAAATGAATTGGG - Intronic
1070280900 10:75047477-75047499 ATGTGAGCAGATAATGTATGTGG - Intronic
1070708891 10:78662741-78662763 ATGTGACAATATATTGAACTAGG - Intergenic
1071025680 10:81110136-81110158 ATGTGGGAATCTAATAAATTGGG - Intergenic
1071322352 10:84475816-84475838 ACTTGATTATATATTGAATTTGG + Intronic
1071351945 10:84755337-84755359 ATGTGAGAATATGAGGAAATGGG + Intergenic
1071776908 10:88799448-88799470 ATCTGAGTACATAAAGAAGTAGG - Intergenic
1071856947 10:89635579-89635601 ATGTGAGAAGAACATGAATTTGG - Intronic
1072293063 10:93983403-93983425 GTGTGTGTATATGATTAATTTGG - Intergenic
1072911219 10:99503159-99503181 GTGTGAGTACATAATCCATTGGG + Intergenic
1073213544 10:101823639-101823661 ATGTGTGTATATAATTACATAGG - Intergenic
1073999853 10:109359843-109359865 ATTTTATTATATAATCAATTGGG - Intergenic
1074256363 10:111806515-111806537 TTCTTAGTAAATAATGAATTTGG - Intergenic
1074845694 10:117395455-117395477 ATGTGAGTACATATGGTATTTGG - Intergenic
1075475952 10:122734046-122734068 TTGAGAGTATATAATGGAGTGGG - Intergenic
1076016114 10:127028742-127028764 CTGTGAGTATCACATGAATTAGG + Intronic
1078122858 11:8528030-8528052 ATGTAAGTATAATATGCATTGGG + Intronic
1079421626 11:20296317-20296339 ATTTCAGTATTTAATGCATTTGG + Intergenic
1079879788 11:25911940-25911962 ATATGTATATATAATAAATTAGG - Intergenic
1081021513 11:37954245-37954267 ATGTGTTTATAAAATGAATATGG + Intergenic
1081492033 11:43576768-43576790 GTGTATGTGTATAATGAATTTGG + Intronic
1083685748 11:64373938-64373960 TTGTGAGTATCTGATGAAATGGG - Intergenic
1085426322 11:76407902-76407924 ATGGGACTATATAATGCATGTGG - Exonic
1085695930 11:78704814-78704836 TCGTGTGTATATAATGTATTGGG - Intronic
1086992661 11:93322025-93322047 ATGTGAGGACATTATGAACTAGG + Intergenic
1087039940 11:93788778-93788800 ATGTGATGATATAATGGCTTTGG + Intronic
1087354350 11:97075070-97075092 ATGTGAGTATATCATAATTTAGG - Intergenic
1087529684 11:99363430-99363452 ATGTGAGTATCAAATAAACTTGG - Intronic
1087756900 11:102063876-102063898 ATGTGAGAAGAACATGAATTTGG + Intronic
1087858928 11:103129377-103129399 ATGTCTGTATATAAGAAATTAGG + Intronic
1092297909 12:7216267-7216289 GTGTGAGTGTTTAAGGAATTTGG - Intronic
1092318703 12:7447675-7447697 ATGTGAGAATAACATGAATTTGG + Intronic
1092649930 12:10623516-10623538 ATGTAGTTATATAATCAATTAGG + Intronic
1092721524 12:11446007-11446029 CTGTCAGTATAAAATAAATTAGG - Intronic
1093204195 12:16227274-16227296 AGGTGATTATATAATGAATTTGG - Intronic
1093226938 12:16496100-16496122 ACGTGAGTATATATTTGATTTGG - Intronic
1095625553 12:44310243-44310265 ATGACGGTATATAAAGAATTTGG + Intronic
1095916123 12:47480873-47480895 CTGTGAGTTTAAAATGGATTAGG + Intergenic
1096775704 12:53962403-53962425 ATGTGAGTATATACTCCATAAGG + Intergenic
1097628752 12:62033710-62033732 ATATGAGTATATAACATATTTGG - Intronic
1098053279 12:66476502-66476524 AAGTGAGCATAAAATGAGTTAGG - Intronic
1098120698 12:67234736-67234758 ATGTGAGAATATACAGTATTTGG + Intergenic
1098747857 12:74263604-74263626 ATGTGAGAAGAATATGAATTCGG - Intergenic
1099078435 12:78142789-78142811 AAGTGAGTAAAGAATGGATTAGG + Intronic
1099641654 12:85296376-85296398 AAATGAGTATTAAATGAATTAGG + Intronic
1099734180 12:86546737-86546759 ATCTGAAAATATACTGAATTGGG + Intronic
1099883832 12:88502366-88502388 ATGTGTGTATTTAATGTATTGGG - Intronic
1100178118 12:92053645-92053667 ATCTGAGTATATACAGATTTGGG - Intronic
1101770152 12:107742190-107742212 ATATGTGTTTATAATGAATCTGG - Intronic
1102055851 12:109895923-109895945 ATGTGAACATACAAAGAATTTGG - Intergenic
1102317173 12:111898518-111898540 ATGGGAGTATATAAAGGATCAGG - Intergenic
1102787343 12:115615410-115615432 ATGTATGTATAAAATGCATTCGG + Intergenic
1103286737 12:119808653-119808675 GTGTGATGATATAATGAATCAGG + Intronic
1104730059 12:131100182-131100204 AGGTGAGTTTATGATGAGTTTGG + Intronic
1106783458 13:33083695-33083717 ATTGATGTATATAATGAATTTGG - Intergenic
1107241245 13:38237017-38237039 ATTTAAGTATATAATTAATTAGG - Intergenic
1108464183 13:50697791-50697813 AGGTGAGTTTATAATGATTCTGG + Intronic
1109691071 13:65890193-65890215 ATGTGTGTATATATAGCATTAGG + Intergenic
1110829060 13:80009551-80009573 ATATGCTTATATAATGAATGTGG - Intergenic
1110894078 13:80727258-80727280 CTGTAAATATATAATGAATCTGG - Intergenic
1110957383 13:81571989-81572011 ATGTGAAGAAAAAATGAATTTGG + Intergenic
1111393230 13:87626643-87626665 GTGTGACTATATATTGAATGTGG + Intergenic
1111405793 13:87803343-87803365 ATGGGAGTCTTTAATGAATAAGG - Intergenic
1114305786 14:21421772-21421794 ATGTGAGTGTATTAGGAAATTGG + Intronic
1114877249 14:26735815-26735837 ATGTGAGAATATGGTGCATTTGG - Intergenic
1115580306 14:34751353-34751375 ATGGGAATAAATGATGAATTTGG + Intergenic
1115821424 14:37216189-37216211 ATGTCACTATATAATGAAAAAGG + Intronic
1116662221 14:47725267-47725289 ATGTAATTAAATAATGATTTGGG + Intergenic
1116721660 14:48504100-48504122 ATGTGAGTACATGCTGCATTTGG - Intergenic
1117986998 14:61396590-61396612 ATGGGACTACATAATCAATTTGG + Intronic
1118277533 14:64399064-64399086 TTGTAAGTTTATACTGAATTTGG + Intronic
1118561833 14:67093552-67093574 ATGTGAATAGATAAATAATTTGG + Intronic
1119469445 14:74885309-74885331 ATGAGATTATATAATCACTTTGG + Intronic
1120816576 14:88865772-88865794 TTGCAAGTATATAATAAATTTGG - Intronic
1121713562 14:96056794-96056816 GTGTGAGGCTATAAAGAATTTGG - Intronic
1122224908 14:100269778-100269800 ATGAGAGTTTAAAATGCATTTGG - Intronic
1122451220 14:101809482-101809504 AGGTGGGTATAAAATGAATTTGG + Intronic
1124951457 15:34325491-34325513 TGGTGAATATATAATGAATTTGG + Intronic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125208632 15:37184134-37184156 ATTTGGGGCTATAATGAATTGGG - Intergenic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1126031053 15:44498065-44498087 ATGTGACTATATATTAAATTTGG - Intronic
1126456449 15:48867140-48867162 ATGTGAGTAAATAAAATATTAGG + Intronic
1127180672 15:56413757-56413779 ATCTGTGTATATAATGAAGGTGG - Intronic
1127655947 15:61056046-61056068 ATGTGGGTCTTTTATGAATTTGG - Intronic
1129629420 15:77242143-77242165 ATGTGTGCAAATACTGAATTAGG - Intronic
1129886152 15:79038807-79038829 ATGTGAGTATGTAAGCAGTTTGG - Intronic
1131808397 15:96147381-96147403 CTGTGAGTATCTTAAGAATTGGG - Intergenic
1135334236 16:21587279-21587301 ATGTGTGTGTACAATAAATTTGG + Intergenic
1135630818 16:24034562-24034584 ATGTGCCTATACACTGAATTTGG - Intronic
1135665075 16:24328899-24328921 ATGTGTGTATGTGATGAAGTCGG - Intronic
1138154349 16:54688728-54688750 ATATAATTATATAATTAATTAGG - Intergenic
1138896965 16:61218367-61218389 AAGTGAGGATATAATTAAATGGG + Intergenic
1140399646 16:74660606-74660628 ATGCCAGTGAATAATGAATTTGG + Intronic
1140568391 16:76072247-76072269 AAGTGAGACCATAATGAATTAGG - Intergenic
1140947642 16:79784843-79784865 AAGTGAGAATATGAAGAATTTGG - Intergenic
1144251105 17:13417614-13417636 ATGTTTGTATATAACAAATTGGG + Intergenic
1151368951 17:73635389-73635411 ATGTGAGTTAATTATGAATCTGG - Intronic
1153826710 18:8881892-8881914 ATGTGAGTAGAGGAGGAATTTGG + Intergenic
1155129654 18:22919850-22919872 ATAAGAATATATAATTAATTAGG - Intronic
1156925810 18:42577037-42577059 AGGGAAGTATATAATCAATTTGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159614604 18:70567283-70567305 AAGTTAGTATATGATAAATTTGG - Intergenic
1159662245 18:71112523-71112545 ATGTGAGTATTATATAAATTTGG + Intergenic
1159759185 18:72403775-72403797 ATGTGTGAAGTTAATGAATTTGG + Intergenic
1164021945 19:21315535-21315557 ATGTAAGTATACAATTTATTTGG + Intronic
1164903198 19:31945887-31945909 TTCTGAGTAAGTAATGAATTCGG - Intergenic
1165529635 19:36387235-36387257 ATGTGAGAAGAACATGAATTTGG + Intronic
1165708030 19:37990179-37990201 ATGTGGGTATAAAATGACCTGGG - Intronic
1167221883 19:48204633-48204655 ATGTGACTATAGACGGAATTGGG + Intronic
1168531442 19:57132812-57132834 ATATAAGTTTATAAGGAATTTGG + Intergenic
925284298 2:2705854-2705876 ATGTGATTAAATTAAGAATTTGG + Intergenic
925636246 2:5943557-5943579 ATATGAGTACAAAATGAATCGGG - Intergenic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926549436 2:14283445-14283467 AGGTAGGTATAAAATGAATTTGG - Intergenic
928520889 2:32087605-32087627 ATGTGAATATATCATAATTTGGG - Intronic
928590085 2:32805498-32805520 TTGTGAGAATTTAATGAAATCGG + Intronic
929541955 2:42829497-42829519 TTATGAGTCTATAATGAATCTGG + Intergenic
930970701 2:57391981-57392003 ATGTGTGTATATCTTGATTTAGG - Intergenic
931924965 2:67062332-67062354 ATGTGAGAATCTAATTAATAAGG + Intergenic
932932332 2:76057075-76057097 ATGAGAGAATATGAAGAATTGGG + Intergenic
932990812 2:76784098-76784120 ATATTAATATATCATGAATTTGG - Intronic
935309366 2:101768154-101768176 ATTTTAATATATAATGAATTGGG + Intronic
939342289 2:140914276-140914298 ATGTGAGTAGAGAATGGAATGGG + Intronic
939618738 2:144391693-144391715 ATGTCATTATGTTATGAATTTGG + Intronic
940582893 2:155603086-155603108 AAGTGAGAATATAAGGTATTTGG + Intergenic
940923450 2:159336471-159336493 ATGTGCTTATATCATGTATTTGG - Intronic
940937121 2:159508675-159508697 ATGAGAGTATGTAATGCATAGGG - Intronic
941597923 2:167501621-167501643 ATGTAAATATAAAATCAATTTGG + Intergenic
942027945 2:171929026-171929048 ATGTGAGTATAAAAGTACTTTGG - Intronic
942138214 2:172950570-172950592 AAATGTTTATATAATGAATTTGG + Intronic
942139748 2:172966062-172966084 ATGAAAGTAAGTAATGAATTCGG + Intronic
942768501 2:179486396-179486418 ATGTGGGTATATAATTAAATAGG - Intronic
942961961 2:181840704-181840726 ACATGAGAATTTAATGAATTTGG - Intergenic
943122411 2:183753311-183753333 ATTTGTGTATGTAATTAATTGGG - Intergenic
943152184 2:184128396-184128418 ATGTGATTACATTATTAATTTGG + Intergenic
943701554 2:190993529-190993551 ATTTGAATAAATAATCAATTTGG + Intronic
944137981 2:196420996-196421018 GAGTTAGCATATAATGAATTGGG - Intronic
944294887 2:198050802-198050824 ATGGGAGAAGATAAAGAATTAGG - Intronic
945802867 2:214455080-214455102 CTGTCAGCATAGAATGAATTAGG + Intronic
947329120 2:229009714-229009736 GTGTGAGTATATGAGGAACTAGG + Intronic
948744471 2:240077088-240077110 AGGTGAGAATAAAATGTATTGGG + Intergenic
1169472516 20:5900206-5900228 TAGTGAGGATATAATGAAATTGG + Intergenic
1169835292 20:9871293-9871315 ATTTGAGCATAAAATGTATTAGG + Intergenic
1170262424 20:14424829-14424851 ATGTAAATCTATAATAAATTGGG + Intronic
1171997722 20:31745171-31745193 ATGTGAATATATACTGTTTTAGG - Intronic
1173302092 20:41812964-41812986 ATATGAGGATTTAATTAATTTGG + Intergenic
1173983596 20:47243903-47243925 ATATGAGTATGTTATGGATTGGG - Intronic
1177014135 21:15762851-15762873 AGTTGAGAATATAATGATTTTGG + Intronic
1177058843 21:16344902-16344924 ATGTGAGTAAAATATGTATTGGG - Intergenic
1182826529 22:33270053-33270075 CTGTGAATATTTAATGGATTTGG - Intronic
949870768 3:8586446-8586468 TTGGGAGAATATAAGGAATTTGG + Intergenic
950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG + Intronic
951198446 3:19850998-19851020 ATGGGTTTATATAATGATTTAGG - Intergenic
951227965 3:20142985-20143007 ATGTGACAATACAAGGAATTGGG + Intronic
951278939 3:20723285-20723307 ATGTCAGTCTTTAATGAACTCGG + Intergenic
951399233 3:22210920-22210942 ATGTGAGTATATTATGTTTATGG - Intronic
951797679 3:26558885-26558907 ATTTAGGTATATAATGAATTTGG - Intergenic
952725152 3:36575721-36575743 ATGTGACAATATTATGAAATAGG + Intergenic
953073906 3:39550453-39550475 AAGTGAGTCTAGAAGGAATTGGG - Intergenic
956538831 3:70310722-70310744 ATGTGAGGGTATGATGAAGTTGG + Intergenic
957178341 3:76842241-76842263 ATGTAAGTGAATATTGAATTTGG - Intronic
957449631 3:80362243-80362265 AGGTGACACTATAATGAATTCGG + Intergenic
957543744 3:81610004-81610026 ATGTGAGGAAATAATGCAATAGG + Intronic
957707435 3:83807000-83807022 ATATTAGAATATAATAAATTAGG - Intergenic
957713287 3:83891920-83891942 ATGTGAGTGTATTTTGAAATGGG + Intergenic
958491802 3:94784019-94784041 ATGTGAGTATATTTACAATTTGG + Intergenic
958602864 3:96321187-96321209 TTGGGAGTATAGAGTGAATTAGG - Intergenic
959140736 3:102483625-102483647 ATGTGATTAAATAAAAAATTCGG - Intergenic
959938650 3:112057425-112057447 ATGGGGGAATATAATAAATTGGG + Intronic
960641343 3:119826584-119826606 AAGTGAGAATACAATGAAATTGG + Intronic
962150934 3:132892818-132892840 ATGTGGGAATATAATGAATTTGG + Intergenic
962215226 3:133515196-133515218 ATGGTAGTATAGGATGAATTTGG - Intergenic
962296795 3:134197242-134197264 ATATGAGTTTATAATGCAGTGGG + Intronic
962455238 3:135559110-135559132 ATGTGAGAACATGAAGAATTAGG + Intergenic
963804667 3:149711067-149711089 AAATGAATATATAATCAATTTGG - Intronic
964640905 3:158909529-158909551 ATGTGAGTATTCATTGTATTTGG + Intergenic
965453637 3:168870021-168870043 ATGTGAGTATATAATGCTCAAGG - Intergenic
965993751 3:174853059-174853081 ATGTAAGTCTTTAATCAATTTGG - Intronic
967696339 3:192536021-192536043 ATGTAAGTACATATTGTATTAGG - Intronic
970189768 4:13503136-13503158 ATGTGACTTTATATAGAATTGGG - Intergenic
971405358 4:26317683-26317705 ATGTGAGTATATTCTGAAGGTGG + Intronic
971546887 4:27897389-27897411 ATGTGAGAAGAATATGAATTTGG + Intergenic
971673838 4:29598088-29598110 ATATAATTATATAATTAATTTGG + Intergenic
973103381 4:46300115-46300137 AGCTGAGCATATAATAAATTTGG - Intronic
973126016 4:46585696-46585718 ATATGAGGATTTAAGGAATTTGG + Intergenic
974525144 4:63041660-63041682 ATGTCAATATAGATTGAATTAGG + Intergenic
974667554 4:64984607-64984629 CTGAGAGTATATACTGAATATGG - Intergenic
975189443 4:71442846-71442868 AAGAGAGTAAATAATGAAATTGG - Intronic
976062787 4:81149409-81149431 ATTTTAGTATTTAATTAATTGGG - Intronic
976441286 4:85077926-85077948 ATGTTAGTTAAAAATGAATTTGG + Intergenic
976985799 4:91295868-91295890 ATTTGAGTATATTTTGTATTAGG + Intronic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
978428169 4:108603992-108604014 AAGTAAATACATAATGAATTTGG + Intergenic
978513530 4:109547523-109547545 ACGTTAGTATATAAGGGATTAGG + Intergenic
978933060 4:114340519-114340541 ATGAGAGTAAATAATAAATAGGG - Intergenic
979204897 4:118026933-118026955 ATGTGAATATATTAAGCATTTGG + Intergenic
979303857 4:119119802-119119824 ATGTGAGTATAAAATTAAATTGG + Intergenic
979753748 4:124313096-124313118 ATGTCAATATATAAAGAATGAGG - Intergenic
980225899 4:129985210-129985232 ATGTAAGTATATAATTAATGAGG - Intergenic
980287054 4:130793510-130793532 TTGAGAGGATATAATGCATTAGG + Intergenic
980648943 4:135684811-135684833 ATATGAATATATAATGAAACTGG + Intergenic
980808932 4:137850859-137850881 TTGTGAGTAGAAAAGGAATTGGG - Intergenic
980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG + Intergenic
981558047 4:146016682-146016704 ATGTGAGAAGACATTGAATTGGG - Intergenic
982373263 4:154657569-154657591 TTTTGAGTATATAATTAACTTGG + Intronic
982923013 4:161300170-161300192 ATGTTAATTTATAAAGAATTAGG + Intergenic
983267811 4:165525601-165525623 AGGTGAGTATATGAAGAATGTGG + Intergenic
983349494 4:166569956-166569978 ATGTGAGTAAAGAATTAATTAGG + Intergenic
983440419 4:167776090-167776112 ATATGAATATATAAAGAACTAGG - Intergenic
983983661 4:174030880-174030902 TTGTGAGTATACAACTAATTTGG - Intergenic
984088907 4:175345792-175345814 ATTTGAATATTTAATGTATTGGG - Intergenic
984357674 4:178684596-178684618 ATATGAATACATAAAGAATTTGG + Intergenic
984413143 4:179422489-179422511 ATGTTGCTATATAATTAATTAGG + Intergenic
985625043 5:981425-981447 ATGTAAGTTTGTAATAAATTGGG - Intergenic
987007749 5:13727836-13727858 ATGTTAGTATAGACTGACTTTGG - Intronic
987899895 5:23997902-23997924 ATGTGAGTTTTTAATTTATTTGG + Intronic
988249955 5:28744342-28744364 ATGAGAGTATATTTTGAATATGG - Intergenic
989794536 5:45450453-45450475 TTGTGAATAAATTATGAATTAGG - Intronic
990721533 5:58701299-58701321 ATGTGATTAAAAAATGAACTAGG - Intronic
991158970 5:63473089-63473111 ATGTATATATATAATGAATATGG - Intergenic
993353456 5:86877872-86877894 ATGTATGTATATAATTTATTGGG + Intergenic
994295878 5:98087665-98087687 ATGTGAGTCTTAAATGAGTTGGG - Intergenic
994893974 5:105677410-105677432 AGGAGAATATATAATGAAATAGG + Intergenic
995615649 5:113960375-113960397 ATTTGAGTATAATATGAATCAGG + Intergenic
996097306 5:119412300-119412322 ACGTGAGAATATAATTAGTTTGG + Intergenic
996730317 5:126711214-126711236 ATGTGAGTATCTAAAAATTTGGG - Intergenic
996771568 5:127092137-127092159 ATGTGAGTAAATGATGAAGGTGG - Intergenic
997760212 5:136439348-136439370 ATGTGAATATATAAACAAATTGG - Intergenic
998246676 5:140513320-140513342 ATGTAAATATATAATGAAAGAGG - Intronic
998306412 5:141081768-141081790 ATGAAAGTATCTACTGAATTTGG + Intergenic
998584353 5:143410973-143410995 TTGTGAGTTTATAAATAATTTGG - Intronic
1000818876 5:165958755-165958777 GTGTGCGTGTATAACGAATTTGG - Intergenic
1001620291 5:173078420-173078442 ATGAGAGTATTTTATGAATAAGG - Intronic
1001666722 5:173439322-173439344 ATGTGTGTATATATTGTGTTAGG + Intergenic
1003719689 6:8686939-8686961 GTGTGAGTATATGATGGACTTGG + Intergenic
1006664300 6:35679112-35679134 ATGTCAGTAATTAATGAATCTGG + Intronic
1008468760 6:51859554-51859576 ATGTGATAGTATAATCAATTGGG + Intronic
1009555588 6:65160882-65160904 ATGTCAGTAAATAGTAAATTGGG - Intronic
1009562719 6:65269938-65269960 ATGTGAGAATGACATGAATTTGG - Intronic
1010880303 6:81159799-81159821 ATGTTAGTATAAAATGAACAGGG - Intergenic
1011767075 6:90633647-90633669 ATGAGAGGATACAATGAATTTGG + Intergenic
1011972814 6:93248872-93248894 ATTTGAGCATATATTGTATTTGG - Intronic
1012394762 6:98783909-98783931 ATTAGTTTATATAATGAATTGGG + Intergenic
1012957051 6:105582377-105582399 GTGGGAGTATCTAATTAATTTGG - Intergenic
1013278627 6:108612256-108612278 ATGTAAAAATATAATTAATTGGG + Intronic
1014579502 6:123119144-123119166 ATGTCTGTATATTATCAATTAGG + Intergenic
1015416176 6:132951206-132951228 ATGTGAGTGGATACTAAATTAGG - Intergenic
1016399039 6:143658236-143658258 ATGTGATTTTAAAATAAATTTGG + Intronic
1017119681 6:151012543-151012565 ATGTGAGTTTAAAATGACTGAGG - Intronic
1017242554 6:152187117-152187139 ATTTGAGTTCAAAATGAATTTGG - Intronic
1017615043 6:156237610-156237632 ATGTGAGAATATACAGTATTTGG - Intergenic
1017668459 6:156745357-156745379 ATGTGAGTAAAGAGGGAATTTGG + Intergenic
1018016018 6:159713037-159713059 ATGAGAGTACATATTGAAATTGG - Intronic
1018483170 6:164212621-164212643 ATGTGAGAAGAACATGAATTTGG - Intergenic
1019841378 7:3449504-3449526 ATTTGACTATATGTTGAATTAGG + Intronic
1020491677 7:8793101-8793123 ATGTATTTTTATAATGAATTTGG - Intergenic
1023545163 7:41310992-41311014 ATGTGAGCAGATAACGAATTGGG + Intergenic
1023798775 7:43815033-43815055 ATGTGAGTAGAGAAGGACTTTGG - Intergenic
1024436722 7:49365306-49365328 ATGTGAGAAGAACATGAATTTGG - Intergenic
1027482121 7:78710967-78710989 CTCTGAGTATATAATTAATCTGG + Intronic
1027970081 7:85069008-85069030 ATATGAATGTATAATGAATATGG + Intronic
1028199701 7:87946960-87946982 ATGTGAGAATATACAGTATTTGG - Intronic
1028209532 7:88056259-88056281 ATTTCAGTATTAAATGAATTAGG - Intronic
1028590957 7:92494020-92494042 ATGTGAAAATATAATACATTAGG + Intronic
1028664654 7:93327428-93327450 GTGTCAGTATATAATGAGCTGGG - Intronic
1029934441 7:104408616-104408638 TTGTGATGATAAAATGAATTTGG - Intronic
1030010584 7:105162396-105162418 ACATGAATATATAATGAAATTGG - Intronic
1030128226 7:106175149-106175171 ATATAAGTATATAATAAATATGG - Intergenic
1030734962 7:113037275-113037297 AAATGAGTATATAATATATTAGG + Intergenic
1030817273 7:114053387-114053409 ATGTGAGAAGAACATGAATTTGG + Intronic
1031609555 7:123808946-123808968 ATGTGATTATATTAACAATTGGG - Intergenic
1033948695 7:146756562-146756584 CCGTGTGTATATATTGAATTTGG - Intronic
1035120039 7:156559402-156559424 ATGTGTGTAAAGGATGAATTTGG + Intergenic
1036041776 8:5091676-5091698 TTGTGCGTGTATACTGAATTTGG - Intergenic
1036711355 8:11081278-11081300 ATATGAGTGTTTAATGCATTAGG - Intronic
1037049211 8:14348817-14348839 ATGTTTGTATTTAATGTATTTGG - Intronic
1038606192 8:29007464-29007486 ATTTGAGAATATAATCACTTAGG + Intronic
1038759410 8:30372889-30372911 ATGTGAGAAAAACATGAATTTGG - Intergenic
1038824403 8:30985169-30985191 ATATATGTATATAATTAATTTGG + Intergenic
1039594115 8:38775647-38775669 ATGTGAGAATATTAAGAAGTGGG - Intronic
1041675960 8:60540101-60540123 ATATGAATATATACTGTATTTGG - Intronic
1041929503 8:63271517-63271539 AGTTGAGTCTATAATGAATGTGG - Intergenic
1043473173 8:80581044-80581066 AAGTGAGTTTATAATGATTTAGG + Intergenic
1045869966 8:106915127-106915149 ATGATAATATATAATGAGTTTGG - Intergenic
1047721224 8:127641788-127641810 ATGAGAGTATGTTCTGAATTGGG + Intergenic
1050814686 9:9795238-9795260 ATTTGAGAATATATTTAATTTGG + Intronic
1051162724 9:14226800-14226822 ATGTGAGTTTATGATAAATTGGG - Intronic
1051236154 9:15001371-15001393 ATTTGAGTATAAAAGCAATTAGG + Intergenic
1051500000 9:17765985-17766007 ATATGAGTATCTGATGATTTAGG - Intronic
1051552164 9:18342040-18342062 ATATGACCAAATAATGAATTAGG + Intergenic
1052007460 9:23366183-23366205 ATGTGGGTATCTAATTATTTTGG - Intergenic
1052064613 9:24001985-24002007 ATTGGAGTATATATTGACTTTGG + Intergenic
1052268286 9:26599707-26599729 ATGCAAGTATATAATGACATTGG - Intergenic
1052395515 9:27933541-27933563 ATGTGAAAATATAAGGAATTTGG + Intergenic
1053332728 9:37230429-37230451 GTGTGATCATATATTGAATTGGG + Intronic
1054965339 9:71019964-71019986 ATGTGAGTATCCAACCAATTTGG - Intronic
1056466932 9:86866454-86866476 TTGTGAGTATAAGATCAATTTGG + Intergenic
1057289794 9:93797876-93797898 CTGGGCTTATATAATGAATTGGG + Intergenic
1057811672 9:98261949-98261971 ATTTAAGTATGTAATGAATTTGG + Intergenic
1059144427 9:111885620-111885642 AGGTGACTATGTAATGAATGGGG - Intergenic
1061737691 9:132672882-132672904 AGGTGAAAATATAATGAGTTGGG + Intronic
1185518615 X:719648-719670 ATGTGATTAAATAAAGAAGTGGG + Intergenic
1186010918 X:5131763-5131785 AAGTGAGAATATATTGTATTTGG + Intergenic
1186605648 X:11087676-11087698 AAGTGAGAATATATGGAATTTGG + Intergenic
1186780757 X:12909718-12909740 ACCTGAGTAGTTAATGAATTGGG - Intronic
1187190098 X:17026262-17026284 ATGTGAGTATAAAATCTGTTTGG + Intronic
1187655499 X:21467025-21467047 ATGGGAAAAAATAATGAATTGGG + Intronic
1187799173 X:23041454-23041476 ATGGGAGTCTATATTGAACTTGG - Intergenic
1188258912 X:27999421-27999443 ATTTCAGTATATACTGATTTGGG - Intergenic
1189087530 X:38041638-38041660 ATGTAATTATATATTGAAATTGG - Intronic
1189111067 X:38289502-38289524 ATGCAAATATCTAATGAATTTGG + Intronic
1189193685 X:39134064-39134086 ATGTGACTTTGTAATGAAATGGG + Intergenic
1189777608 X:44484428-44484450 TTGTGAGTACACAATGAATCAGG - Intergenic
1190537405 X:51442633-51442655 ATGTGAGAATGACATGAATTTGG + Intergenic
1191052489 X:56209189-56209211 ATGTAAGTATATAATGATAAAGG - Intergenic
1191977072 X:66884933-66884955 ATCTGAGTTTATAACGTATTAGG + Intergenic
1192222149 X:69204540-69204562 ATGTGAGTAAATGATGAAAGGGG - Intergenic
1192383888 X:70645108-70645130 ATGTGAACAAATAATGAATAAGG + Intronic
1193013032 X:76698549-76698571 ATTTAAGTATATAATGAGCTTGG + Intergenic
1193013118 X:76699970-76699992 AGGTCAGTATATAATGAAAAAGG + Intergenic
1194141001 X:90209465-90209487 ATGTGTGTATATTATGTATGTGG - Intergenic
1194739296 X:97553268-97553290 TTGTGAATATTTAATTAATTAGG - Intronic
1195085832 X:101412931-101412953 ATGAGAGTACATATTGAAATTGG + Exonic
1195484366 X:105386798-105386820 ATGTGTTCATATAATGAATGTGG + Intronic
1195719792 X:107855893-107855915 ATGAGACTATAAAATGAAGTGGG + Intronic
1195765181 X:108288590-108288612 ATGTGAATAGTTCATGAATTTGG + Intronic
1196533784 X:116817376-116817398 ATGTGAGTATATAATCAGAGAGG + Intergenic
1196740868 X:119024654-119024676 ATGTGAGTATAGGTTGAAATGGG - Intergenic
1198323322 X:135541456-135541478 ATGTAAGTATAGAATGCATTTGG - Intronic
1200354577 X:155534776-155534798 ATGTGAGAAGAATATGAATTTGG + Intronic
1201367090 Y:13219236-13219258 ATGTGACTATATAATAATTAAGG + Intergenic
1201384440 Y:13423654-13423676 GTGTCAGTAAATAATGAAATTGG + Intronic