ID: 977554201

View in Genome Browser
Species Human (GRCh38)
Location 4:98472168-98472190
Sequence ATCTTCCGTAATTGGAGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977554201_977554207 19 Left 977554201 4:98472168-98472190 CCAGCCCTCCAATTACGGAAGAT 0: 1
1: 0
2: 1
3: 5
4: 75
Right 977554207 4:98472210-98472232 CTGCACATTCAAGTACATCTGGG 0: 1
1: 0
2: 1
3: 12
4: 145
977554201_977554206 18 Left 977554201 4:98472168-98472190 CCAGCCCTCCAATTACGGAAGAT 0: 1
1: 0
2: 1
3: 5
4: 75
Right 977554206 4:98472209-98472231 TCTGCACATTCAAGTACATCTGG 0: 1
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977554201 Original CRISPR ATCTTCCGTAATTGGAGGGC TGG (reversed) Exonic
900131621 1:1089640-1089662 TTCTTCCATCATGGGAGGGCTGG + Intronic
907930095 1:58991032-58991054 ATCTCCTGCAGTTGGAGGGCAGG - Intergenic
911927350 1:103851533-103851555 ATATTCAGTAATGGGATGGCTGG + Intergenic
1068566515 10:58581749-58581771 ATCTTCCCAAATTGGAGGGAGGG - Intronic
1071139721 10:82494220-82494242 AACTTCAGTAATGGGAGTGCTGG - Intronic
1071418859 10:85468678-85468700 ATTTCCAGTAATTGGATGGCTGG - Intergenic
1078861284 11:15249500-15249522 ATCTTCCTTACTTTGAGGCCCGG - Intergenic
1081412268 11:42773878-42773900 ATATTCCGCAATTCGAGGGCAGG - Intergenic
1083315464 11:61812362-61812384 ATCTGCCCTGCTTGGAGGGCAGG + Intronic
1083526202 11:63367910-63367932 ATATTCAGTAATGGGATGGCTGG - Intronic
1086029675 11:82338949-82338971 ATATTCAGTAATGGGATGGCTGG + Intergenic
1091242659 11:134064335-134064357 ATTATCTCTAATTGGAGGGCTGG + Intergenic
1092186533 12:6483746-6483768 ATGTTCTGGAAGTGGAGGGCGGG + Intergenic
1092265622 12:6978272-6978294 GTCTTCCCAGATTGGAGGGCAGG - Intronic
1092521851 12:9283923-9283945 ACATTCCGGAAGTGGAGGGCCGG + Intergenic
1094507521 12:31074118-31074140 ACATTCCGGAAGTGGAGGGCCGG + Intronic
1101384951 12:104248703-104248725 ATCTGCCGTAAGTGGAAGGGAGG - Intronic
1108082922 13:46755877-46755899 ATATTCAGTAATGGGATGGCTGG + Intergenic
1111811827 13:93100779-93100801 ATCTTCTGTAGCTGCAGGGCTGG - Intergenic
1114640867 14:24219601-24219623 TTCTTCCGTAAGTTAAGGGCTGG + Intronic
1116264421 14:42668358-42668380 ATCTCCTGTATTTGGAGGACAGG - Intergenic
1202887864 14_KI270722v1_random:125249-125271 ATGTCCAGTAATTGGACGGCTGG - Intergenic
1125835793 15:42749546-42749568 ATCCCCAGTAATTGGAGGACAGG - Intronic
1128087163 15:64894350-64894372 ATCGTCCCTACTTGGGGGGCAGG - Intronic
1130818780 15:87469218-87469240 ATACTCAGTAATTGGATGGCTGG - Intergenic
1131298809 15:91176400-91176422 ATACCCCGTAATTGGATGGCTGG + Intronic
1131680303 15:94714925-94714947 ACCTTCTGTCATTGGAAGGCAGG + Intergenic
1135580516 16:23622078-23622100 ATCTTCTAAAAATGGAGGGCAGG - Intronic
1138855408 16:60685598-60685620 ATATTCCAGAATTTGAGGGCAGG + Intergenic
1141035996 16:80626358-80626380 ATATTCATTAATTTGAGGGCAGG + Intronic
1150723474 17:67633148-67633170 ATCTGCTGTCATTGCAGGGCTGG - Intronic
1164266101 19:23619130-23619152 ATATCCCGTAATGGGATGGCTGG - Intronic
1165212341 19:34245875-34245897 ATTTTACTTAATTGTAGGGCAGG - Intergenic
1202663265 1_KI270708v1_random:92087-92109 ATGTCCAGTAATTGGACGGCTGG - Intergenic
930564826 2:53005581-53005603 AGATTCCGTATTTGGAGGGATGG - Intergenic
932871876 2:75409123-75409145 ATGTTCCATAATGGCAGGGCTGG - Intergenic
933359855 2:81267748-81267770 ATCTTCAATATTTGGAGGACAGG - Intergenic
934710634 2:96511914-96511936 CTCTTCAGTAAGTGGGGGGCGGG - Intergenic
936128573 2:109813199-109813221 TTATTCTGTGATTGGAGGGCTGG + Intronic
936216124 2:110558286-110558308 TTATTCTGTGATTGGAGGGCTGG - Intronic
943095378 2:183422052-183422074 ATCCCCAGTAATTGGAGTGCTGG - Intergenic
945943526 2:215972849-215972871 CTCTTCCAAAATTGGAGAGCAGG + Intronic
949024118 2:241757287-241757309 ATCTTCTGTGATAGGAAGGCAGG + Intronic
949063671 2:241975942-241975964 ATTTTCAGTCATTGGAGGGGGGG + Intergenic
1180330007 22:11468971-11468993 ATGTCCAGTAATTGGACGGCTGG - Intergenic
1183732120 22:39624381-39624403 CTCCTCTGTAATTGGAGCGCAGG - Intronic
1185158007 22:49205730-49205752 ATCCTCCATGATGGGAGGGCAGG + Intergenic
951836323 3:26987194-26987216 ATCTTCCCTACTTGAAGGGCAGG + Intergenic
952386136 3:32842998-32843020 GTCTTCTGTAATTGGAGGGCGGG + Intronic
961326262 3:126111152-126111174 ATCTTCCATAGTTGGGGAGCTGG - Intronic
965474404 3:169137167-169137189 AACTTCAGCAATTGGAGGGTGGG + Intronic
974152147 4:58023786-58023808 ATCTCCAGTAATGGGATGGCTGG + Intergenic
974377260 4:61094868-61094890 ATCCACCGTAATTGAAGTGCTGG - Intergenic
974530611 4:63102526-63102548 ATACTCAGTAATTGGATGGCTGG - Intergenic
975409808 4:74037376-74037398 ACCTTCCCTGAGTGGAGGGCTGG - Intronic
977554201 4:98472168-98472190 ATCTTCCGTAATTGGAGGGCTGG - Exonic
978613235 4:110567368-110567390 GTCTTCCTTAACTGCAGGGCTGG + Intergenic
979459942 4:120970510-120970532 ATCTTCGGTTCTTTGAGGGCAGG + Intergenic
980540495 4:134187174-134187196 ATGTCCCGTAATGGGATGGCTGG - Intergenic
988413262 5:30913701-30913723 ATCTTCAGAAATTTCAGGGCAGG + Intergenic
989783636 5:45300972-45300994 ATTTTCCTTAATTGGTGAGCAGG + Intronic
991076580 5:62546079-62546101 ATCTCCAGTAATGGGACGGCTGG - Intronic
993595424 5:89848767-89848789 ATCCTCCGTAGTTGAAGAGCTGG - Intergenic
1000127771 5:158263596-158263618 AGCATCCTTGATTGGAGGGCAGG + Intergenic
1000995013 5:167950021-167950043 ATCTTGCTTTATAGGAGGGCTGG + Intronic
1002270474 5:178068514-178068536 ACCTCCCGTATTTGGAGGACAGG - Intergenic
1007500428 6:42292918-42292940 ATTTTCTGGAATTGGAGAGCTGG - Intronic
1009061159 6:58399415-58399437 ATATTCAGTAATGGGATGGCTGG - Intergenic
1015127078 6:129767170-129767192 ATCTTCCGCAAGTGGAGAGCAGG + Intergenic
1016928533 6:149379027-149379049 CTCATCCGTATTTGGGGGGCTGG - Exonic
1019456379 7:1129904-1129926 ATATTCAGTAATTAGAGAGCAGG - Intronic
1032540075 7:132695514-132695536 ATATTCAGTAATGGGATGGCTGG - Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1044625923 8:94235021-94235043 ATTTTCCAGACTTGGAGGGCTGG - Intergenic
1044690042 8:94868483-94868505 AGCCTCAGTAAGTGGAGGGCAGG - Intronic
1045819981 8:106325058-106325080 ATCTTCTGTAAGTGGATAGCAGG + Intronic
1048138174 8:131766612-131766634 AGCTTCTGTAAAAGGAGGGCTGG - Intergenic
1052154975 9:25175305-25175327 ATGAACTGTAATTGGAGGGCTGG + Intergenic
1061992298 9:134166074-134166096 ATCTTCAGCAATGGGAGGCCTGG + Intergenic
1189189174 X:39082766-39082788 ATCCTCAGTATTTGGAGGGCAGG - Intergenic
1193650581 X:84125915-84125937 ACCTTCAGTAAAAGGAGGGCAGG + Intronic
1202020301 Y:20457790-20457812 ATATTCAGTAATGGGATGGCTGG + Intergenic