ID: 977556701

View in Genome Browser
Species Human (GRCh38)
Location 4:98494330-98494352
Sequence TGGGGTAGCCTGGACAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977556688_977556701 19 Left 977556688 4:98494288-98494310 CCAATATCCCCTGGGATCCAAGT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG 0: 1
1: 0
2: 1
3: 8
4: 239
977556687_977556701 22 Left 977556687 4:98494285-98494307 CCTCCAATATCCCCTGGGATCCA 0: 1
1: 0
2: 2
3: 17
4: 176
Right 977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG 0: 1
1: 0
2: 1
3: 8
4: 239
977556690_977556701 11 Left 977556690 4:98494296-98494318 CCCTGGGATCCAAGTAAATCCAA 0: 1
1: 0
2: 1
3: 14
4: 130
Right 977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG 0: 1
1: 0
2: 1
3: 8
4: 239
977556692_977556701 2 Left 977556692 4:98494305-98494327 CCAAGTAAATCCAAAACTCAGAA 0: 1
1: 0
2: 5
3: 49
4: 488
Right 977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG 0: 1
1: 0
2: 1
3: 8
4: 239
977556689_977556701 12 Left 977556689 4:98494295-98494317 CCCCTGGGATCCAAGTAAATCCA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG 0: 1
1: 0
2: 1
3: 8
4: 239
977556696_977556701 -8 Left 977556696 4:98494315-98494337 CCAAAACTCAGAAAGTGGGGTAG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG 0: 1
1: 0
2: 1
3: 8
4: 239
977556691_977556701 10 Left 977556691 4:98494297-98494319 CCTGGGATCCAAGTAAATCCAAA 0: 1
1: 0
2: 2
3: 8
4: 126
Right 977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG 0: 1
1: 0
2: 1
3: 8
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977556701 Original CRISPR TGGGGTAGCCTGGACAATGG GGG Intronic
900591605 1:3462761-3462783 GGGGGTAGGCTGGACCTTGGAGG - Intronic
902190417 1:14759034-14759056 TAGGCTACCCTGGACAATGAAGG + Intronic
903724177 1:25428954-25428976 TGGCGTAGCCTGGAAAAGGAGGG + Intronic
903791143 1:25893921-25893943 TGGGGTAGCCTGGATTGGGGAGG + Intronic
904203186 1:28835186-28835208 TGGGGCAGCAGGCACAATGGGGG - Intronic
904485600 1:30822937-30822959 TGGGGTGGCCTGCATAAAGGTGG - Intergenic
905270437 1:36783978-36784000 TGGGGTAGGCAGGACCAGGGGGG - Intergenic
908543381 1:65142557-65142579 TGTGGTAGCTGGAACAATGGGGG + Intergenic
909413030 1:75376268-75376290 TAGGCAAGCCTGGGCAATGGCGG - Intronic
915081362 1:153354796-153354818 TGGGCTAGCCTGGAACCTGGGGG + Intergenic
915734695 1:158077419-158077441 TGGGGGAGCCTGGAGGAAGGAGG + Intronic
915861863 1:159453398-159453420 TAAGCAAGCCTGGACAATGGTGG - Intergenic
915951061 1:160190322-160190344 TGAGGTGCCCTGGACACTGGAGG + Intergenic
917306093 1:173627232-173627254 TGGGGTGGGGTGGACAGTGGAGG - Intronic
917705919 1:177634363-177634385 TCAGGGAGCCTGGGCAATGGTGG - Intergenic
918317163 1:183331727-183331749 TGGGGTAGCCTGGGTGGTGGGGG - Intronic
918563085 1:185892871-185892893 TACGGAAGCCTGGTCAATGGCGG + Intronic
920611598 1:207444687-207444709 TGGGGTGGTCTGGAGGATGGGGG - Intergenic
920766340 1:208837244-208837266 TGGGGTAGGCTGGCCTCTGGGGG - Intergenic
923470324 1:234284550-234284572 TGTAGTGGCCTGGACAATGTTGG + Intronic
923474646 1:234321184-234321206 TGGGGGAGTCTGGGCCATGGTGG - Intronic
1063769077 10:9177023-9177045 TAGGGAAGCCTGGTCAAAGGAGG + Intergenic
1066034721 10:31469644-31469666 TAAGGAAGCCTGGGCAATGGCGG - Intronic
1066982918 10:42435826-42435848 TAAGGAAGCCTGGGCAATGGCGG - Intergenic
1067170479 10:43902252-43902274 TGAGGGAGGCTGGAAAATGGGGG - Intergenic
1068486741 10:57668209-57668231 TTGGGTGGCCTGGCCATTGGAGG - Intergenic
1069851424 10:71407608-71407630 TGAGCCAGCCTGGCCAATGGCGG - Intronic
1072405425 10:95147820-95147842 TAAGGGAGCCTGGGCAATGGTGG - Intergenic
1074852249 10:117448218-117448240 TGGAGCAGCCAGGACAATGCAGG - Intergenic
1076686508 10:132200609-132200631 TAGGGCAGCCCGGACAGTGGCGG + Intronic
1077771269 11:5221660-5221682 TGCTCAAGCCTGGACAATGGTGG + Intergenic
1079895487 11:26113951-26113973 TGAGTAAGCCTGGGCAATGGCGG - Intergenic
1080082560 11:28238291-28238313 TAAGGGAGCCTGGGCAATGGTGG + Intronic
1080908313 11:36569198-36569220 TGGGGTGGCTTGGACAGTGCAGG - Intronic
1081662594 11:44897060-44897082 TGGGGAAGCCTGGGCTGTGGGGG - Intronic
1081733046 11:45384882-45384904 AGGGGTCTCCTGGGCAATGGAGG + Intergenic
1083701695 11:64483545-64483567 GGGGCTGTCCTGGACAATGGGGG + Intergenic
1087127395 11:94641348-94641370 TGGTGTATTCTGGCCAATGGGGG - Intergenic
1087202860 11:95363849-95363871 TATGGGAGCCTGGACAATGCAGG - Intergenic
1088800924 11:113306271-113306293 TGGGGTAGCCTGAGCTCTGGTGG + Intergenic
1089051838 11:115552397-115552419 TGTGGTTGCCTGCAAAATGGAGG - Intergenic
1091347167 11:134863307-134863329 TGAGGAAGCCAGGACAGTGGAGG - Intergenic
1092526879 12:9314871-9314893 AGAGGGAGCCTGGACAAGGGTGG - Intergenic
1092540395 12:9416908-9416930 AGAGGGAGCCTGGACAAGGGTGG + Intergenic
1093325902 12:17773928-17773950 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1094512653 12:31105571-31105593 AGAGGGAGCCTGGACAAGGGTGG - Intergenic
1096039111 12:48498920-48498942 TGAAGGAGCCAGGACAATGGAGG + Intergenic
1096061785 12:48707482-48707504 TTGAGCAGCCTGGACAATGTAGG - Intronic
1096176778 12:49526544-49526566 TGAGACAGCCTGGACAGTGGAGG - Exonic
1101746592 12:107546381-107546403 TGGGGTGACCAGGCCAATGGTGG - Intronic
1102532690 12:113558419-113558441 TGGGATGGGCTGGATAATGGTGG + Intergenic
1104556123 12:129801146-129801168 TGAGCAAGCCTGGGCAATGGCGG - Intronic
1104959905 12:132483742-132483764 TGGGGTGGCCGGGACACTGCGGG + Intergenic
1108296083 13:49019162-49019184 TGAGCAAGCCTGGGCAATGGCGG + Intronic
1108462260 13:50678413-50678435 AGGGGTAGCAGTGACAATGGAGG - Intronic
1108565795 13:51695863-51695885 TAAGCAAGCCTGGACAATGGTGG + Intronic
1109138018 13:58678183-58678205 TAAGCTAGCCTGGGCAATGGCGG + Intergenic
1110180419 13:72610699-72610721 TAGGCAAGCCTGGGCAATGGCGG - Intergenic
1110682931 13:78337536-78337558 TGGGGCAGCCTGGGCAACAGAGG + Intergenic
1110919839 13:81069774-81069796 TAAGCAAGCCTGGACAATGGTGG + Intergenic
1112092257 13:96093850-96093872 TAGATTAGCCTGGATAATGGAGG + Intronic
1113796834 13:113063291-113063313 TGGGGGCGCCTGGACATTGTGGG - Intronic
1114869177 14:26634833-26634855 TACGGGAGCCTGGGCAATGGCGG + Intergenic
1114872852 14:26678880-26678902 TACGGGAGCCTGGGCAATGGCGG + Intergenic
1114993538 14:28318062-28318084 TACGGGAGCCTGGGCAATGGCGG + Intergenic
1121129856 14:91436428-91436450 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1121773714 14:96576260-96576282 TGGGGGAGCCTGGACCTAGGAGG + Intergenic
1125226791 15:37405010-37405032 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1127066721 15:55247893-55247915 TTGGGTAGGCAGGACAAGGGAGG - Intronic
1127885717 15:63198448-63198470 TGAGAAAGCCTGGATAATGGTGG + Intronic
1128245044 15:66127379-66127401 TGGGGTAGCCTGGACACTTGTGG - Intronic
1129713331 15:77832657-77832679 TGGGGTAGCTGGGAGAATGTGGG - Intergenic
1129846214 15:78768817-78768839 TGGGCCAGCCTGGACACTTGTGG - Intronic
1129980729 15:79867074-79867096 TAGGGGAGGCTGGAGAATGGGGG - Intronic
1131014784 15:89049449-89049471 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1131295156 15:91141445-91141467 TGAGGTATCCTGGTCAAGGGTGG + Intronic
1131929080 15:97419008-97419030 TAAGGGAGCCTGGGCAATGGCGG + Intergenic
1132416897 15:101626893-101626915 TAAGGAAGCCTGGGCAATGGCGG - Intronic
1132603065 16:782476-782498 TGGGGTAGCCTCAACCATGCTGG + Intronic
1134184717 16:12075851-12075873 TAAGGGAGCCTGGGCAATGGTGG + Intronic
1134980958 16:18608489-18608511 TAAGCAAGCCTGGACAATGGTGG - Intergenic
1137041119 16:35614041-35614063 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1141649161 16:85384052-85384074 TGGAGCAGCCTGGAAAAAGGAGG - Intergenic
1145800007 17:27676799-27676821 TGGGCTTGCCTGGACCATGGTGG + Intergenic
1146159196 17:30550800-30550822 TAGGCTTGCCTGGACCATGGTGG - Intergenic
1146265625 17:31450819-31450841 GGGTGTAGCCTGGAACATGGTGG - Intronic
1146657667 17:34644638-34644660 AGAGGTAGCCTGGAGAAGGGTGG + Intergenic
1147065763 17:37922028-37922050 TGGGCTAGCCTGGAGCAGGGTGG - Intergenic
1147256429 17:39184921-39184943 TGGGGGAGCCTGGAGTCTGGGGG - Intronic
1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG + Intergenic
1148074218 17:44926373-44926395 AGGGATAGCCTGGGCCATGGAGG - Intronic
1154136115 18:11779716-11779738 GGGGGTAGTCTGGAAACTGGGGG + Intronic
1155264450 18:24077251-24077273 TGAGGTAGCCTGGAAAATACAGG + Intronic
1155864940 18:30953252-30953274 TGGTGTAGAAAGGACAATGGAGG + Intergenic
1156206830 18:34895219-34895241 TAAGTGAGCCTGGACAATGGTGG - Intergenic
1160036022 18:75302512-75302534 GGGGGAACCCTGGACAGTGGGGG + Intergenic
1161036560 19:2088187-2088209 TGGGGTATCCTGGGCACTGCAGG - Intronic
1162844601 19:13382540-13382562 TTGGGTAAGCTGGACAGTGGAGG + Intronic
1163517608 19:17774526-17774548 TGGGATAGCCTGGGCAGGGGAGG - Intronic
1164188532 19:22894311-22894333 TGGGCGAGCCTGGAAAGTGGAGG - Intergenic
1164318579 19:24117379-24117401 TAAGGAAGCCTGGGCAATGGCGG + Intronic
1164333637 19:24285459-24285481 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1165563612 19:36703615-36703637 TAAGTGAGCCTGGACAATGGAGG + Intronic
1167429508 19:49446510-49446532 TGGGGAAGCTGGGACATTGGCGG - Intronic
1168131763 19:54325705-54325727 TGGGGTGGCGTGGGCAATGGTGG + Intergenic
925282367 2:2693568-2693590 TGTGCTAGGCAGGACAATGGTGG - Intergenic
927128515 2:20036206-20036228 TGGGGAAGCCTGGAGAAAGGTGG - Intronic
927204650 2:20599414-20599436 TTGGGTGGCCTGGACAATTGGGG - Intronic
927453581 2:23230417-23230439 TAGGCAAGCCTGGGCAATGGCGG + Intergenic
928030705 2:27776349-27776371 TTTGGTACCCTGGGCAATGGGGG - Intronic
931030748 2:58172055-58172077 TAAGCTAGCCTGGGCAATGGCGG - Intronic
931846229 2:66206763-66206785 TAAGCTAGCCTGGGCAATGGCGG - Intergenic
932077589 2:68679608-68679630 TAAGCTAGCCTGGGCAATGGCGG + Intronic
934658323 2:96129507-96129529 TGGAGTAGATGGGACAATGGTGG + Intronic
937616981 2:123935928-123935950 CAGGGTAGTGTGGACAATGGTGG + Intergenic
938064678 2:128274775-128274797 GAGGCTAGCCTGGCCAATGGTGG + Intronic
939254499 2:139724781-139724803 TGGGGAGGCCTGGACAATCATGG + Intergenic
939485985 2:142811828-142811850 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
941962590 2:171268671-171268693 TGGGGTTGCCTTAACAATAGGGG + Intergenic
942503450 2:176616750-176616772 TGGGGGTGACTGGACCATGGAGG - Intergenic
942633176 2:177973518-177973540 TAAGCAAGCCTGGACAATGGCGG - Intronic
944077074 2:195744319-195744341 TAGGCAAGCCTGGGCAATGGCGG - Intronic
944257644 2:197640295-197640317 TAAGGAAGCCTGGGCAATGGCGG + Intronic
946401106 2:219468845-219468867 TGGGGCAGCCTGCAGAAAGGAGG - Exonic
947655347 2:231821898-231821920 TGTGGTTGCCAGGATAATGGAGG - Intergenic
948932737 2:241142367-241142389 TTGGGGTGCCTGGACAAAGGAGG + Intronic
1168854415 20:998659-998681 TGGGGGAGGCTGGAGAAAGGTGG + Intronic
1169334483 20:4744365-4744387 TAGGCCAGCCTGGGCAATGGGGG + Intergenic
1171232055 20:23494968-23494990 TGGGGCCTCCTGGAGAATGGAGG - Intronic
1171281438 20:23902534-23902556 TAAGGGAGCCTGGGCAATGGCGG + Intergenic
1171295436 20:24012774-24012796 TAGGGAAGCCTGGGCAAGGGGGG - Intergenic
1172013266 20:31858608-31858630 TGGGGTAGCCTGGGCTCTGCGGG + Intronic
1172646056 20:36470311-36470333 TGAGGAAGCCTGGACACTGTGGG - Intronic
1174281264 20:49441199-49441221 TGGGGGAGGCTGGGCCATGGTGG + Intronic
1175119309 20:56706127-56706149 TGGGGGAGGCTGGACTCTGGGGG + Intergenic
1181010482 22:20037382-20037404 TGGGGTGTCCTGGGGAATGGAGG - Intronic
1181832748 22:25575313-25575335 TGGGGTAGCATAGATGATGGTGG + Intronic
1182969136 22:34555242-34555264 TGAGCAAGCCTGGGCAATGGCGG + Intergenic
1183110347 22:35644195-35644217 TGTGGTAGCCTGGCCAGGGGTGG - Intergenic
1184927545 22:47653843-47653865 TGAGGCCGCCTGGACAGTGGTGG + Intergenic
950014358 3:9745376-9745398 TGGGTTAGCCTGAGCAGTGGCGG - Intronic
950050646 3:9986476-9986498 TGAGGTAGGCTGGAGAAGGGAGG + Intronic
950940888 3:16890221-16890243 TGGGGGAGGCTGGAAAATGGAGG - Intronic
952987581 3:38799962-38799984 AGGGGTTGCCTGGACCATGATGG - Intergenic
954653418 3:52178916-52178938 TGGGGAAGCCAGGACCCTGGGGG + Intergenic
954688855 3:52385199-52385221 TGGGGTCGGCTGGGCAATGTGGG + Intronic
955346127 3:58163256-58163278 TTGGGGAGCCTGGACAAGCGGGG + Exonic
958961046 3:100510050-100510072 TAAGCAAGCCTGGACAATGGCGG - Intronic
961653026 3:128426705-128426727 TGGGGTAGCCCGGAGACGGGTGG - Intergenic
963024429 3:140904733-140904755 TGAGGGAGCCTGGGCTATGGTGG + Intergenic
964563134 3:158020121-158020143 TGAGCAAGCCTGGGCAATGGCGG - Intergenic
965071655 3:163923220-163923242 TGGGGAAGCCAGGCCACTGGAGG - Intergenic
968668235 4:1833354-1833376 TGGGCTAGCCTGGGGAAAGGTGG + Intronic
969222069 4:5767460-5767482 TAAGGAAGCCTGGGCAATGGCGG + Intronic
972132826 4:35859463-35859485 TGGGGTGTCCTGTATAATGGGGG - Intergenic
973689382 4:53409675-53409697 TAAGGAAGCCTGGGCAATGGCGG + Intronic
974073772 4:57149871-57149893 TGGGGTATCCAGGACAAGTGTGG + Intergenic
974426017 4:61744168-61744190 TAAGCTAGCCTGGGCAATGGTGG - Intronic
974690669 4:65293798-65293820 TAAGCTAGCCTGGGCAATGGCGG + Intergenic
976039118 4:80861095-80861117 TAAGCAAGCCTGGACAATGGCGG + Intronic
976202931 4:82597686-82597708 TGCGTTAGCCTGGACAATTCAGG - Intergenic
976490731 4:85667183-85667205 TAAGGAAGCCTGGGCAATGGCGG + Intronic
976694472 4:87904227-87904249 TGGGGTAGCTAGGACATTGTAGG + Intergenic
977164355 4:93677234-93677256 TAAGGGAGCCTGGGCAATGGCGG - Intronic
977556701 4:98494330-98494352 TGGGGTAGCCTGGACAATGGGGG + Intronic
977881499 4:102210492-102210514 TAAGCAAGCCTGGACAATGGCGG + Intergenic
978736196 4:112086912-112086934 TAAGGAAGCCTGGGCAATGGCGG - Intergenic
978864781 4:113494700-113494722 TAAGGAAGCCTGGGCAATGGCGG + Intronic
983407525 4:167349095-167349117 TAAGGAAGCCTGGGCAATGGTGG + Intergenic
988375401 5:30429041-30429063 TAAGGGAGCCTGGGCAATGGCGG + Intergenic
989816958 5:45748728-45748750 TGAGCAAGCCTGGGCAATGGCGG + Intergenic
990783639 5:59395162-59395184 TAAGCAAGCCTGGACAATGGTGG - Intronic
991402106 5:66262546-66262568 TAGGCAAGCCTGGGCAATGGCGG + Intergenic
992504712 5:77375581-77375603 TGGGGTGGCCTGGCTGATGGAGG - Intronic
992754950 5:79895432-79895454 TGGGGTCCCCTGGCCAAGGGGGG + Intergenic
994203095 5:97001195-97001217 AATGGTAGCCTGGACAAGGGTGG + Intronic
994571030 5:101513943-101513965 TTGGGTAGCATGGAGAATGAAGG - Intergenic
994983398 5:106904720-106904742 TAAGGGAGCCTGGGCAATGGCGG + Intergenic
995998868 5:118333519-118333541 TAGGGTGGCATGAACAATGGTGG - Intergenic
1002551273 5:179994693-179994715 TGGGGTGGCATGAGCAATGGTGG + Intronic
1004438689 6:15624593-15624615 TGAAGCAGCCTGGAAAATGGAGG + Intronic
1004763833 6:18701538-18701560 TGGGGTAACATGGCCAAAGGGGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007310066 6:40938245-40938267 TGGGCCCTCCTGGACAATGGGGG - Intergenic
1007714996 6:43850726-43850748 TGGGGTAGGCTGCAGAGTGGGGG + Intergenic
1008498171 6:52153588-52153610 TGGGGAAGCATGGTGAATGGAGG - Intergenic
1009984957 6:70771436-70771458 TAGGCAAGCCTGGGCAATGGCGG + Intronic
1012923554 6:105244819-105244841 TAAGGGAGCCTGGGCAATGGTGG - Intergenic
1013712706 6:112919930-112919952 TAAGCTAGCCTGGGCAATGGCGG + Intergenic
1015392771 6:132701793-132701815 TGTGGTAACCTGGAGGATGGGGG - Intronic
1016239856 6:141917302-141917324 TAAGGAAGCCTGGGCAATGGCGG - Intergenic
1017173657 6:151481370-151481392 TTGGGTGGCATGGACAATGGAGG + Intergenic
1017174570 6:151491162-151491184 TGGGCTAGCTGGGACCATGGTGG - Intergenic
1018812562 6:167308416-167308438 TGGGGCATCCTGGGCAGTGGTGG + Intronic
1019984081 7:4642306-4642328 TGGGGTCGCCTGCCCAATGTCGG + Intergenic
1022066421 7:26863930-26863952 TTGGGTGGTCTGGCCAATGGAGG - Intronic
1022542138 7:31147066-31147088 TGGGGTGGCGGGGAGAATGGTGG + Intergenic
1022765611 7:33408122-33408144 TAAGGGAGCCTGGGCAATGGCGG + Intronic
1023699724 7:42881227-42881249 TGAGGGAGCCTAGCCAATGGGGG - Intergenic
1025907961 7:65803318-65803340 TATGGTAGCCAGTACAATGGTGG - Intergenic
1027419543 7:78005993-78006015 TGGGGTAGGGAGCACAATGGTGG + Intergenic
1028873103 7:95790396-95790418 GGGGGAAGCATGGACAAAGGTGG - Intronic
1029386461 7:100246785-100246807 AGGGAGAGCCTGGACCATGGTGG - Intronic
1030048838 7:105521164-105521186 TGGGGGAGCCTCGACTATTGAGG - Intronic
1032267546 7:130379854-130379876 CGGGGCAGCCTGGACAAAGCCGG + Intergenic
1032881876 7:136099230-136099252 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1033652393 7:143352875-143352897 GGGAGTAACCTGGACACTGGAGG - Intergenic
1033891587 7:146019127-146019149 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1033970994 7:147039368-147039390 TGGGGTCTCCTGGAGAGTGGAGG - Intronic
1034301053 7:150015738-150015760 TGGAGTAGGCTGGGCAATGAAGG - Intergenic
1034805001 7:154081564-154081586 TGGAGTAGGCTGGGCAATGAAGG + Intronic
1036203791 8:6790917-6790939 TGGGGGAGCTTGGACAGTGGAGG + Intergenic
1038899545 8:31826682-31826704 GGAGGTGGCCTGGAGAATGGAGG + Intronic
1039238943 8:35533607-35533629 TAAGCAAGCCTGGACAATGGCGG + Intronic
1039430293 8:37520332-37520354 TGGGGAAGCCTGGAAAATTCGGG + Intergenic
1042620701 8:70700870-70700892 TGAGCAAGCCTGGGCAATGGTGG + Intronic
1044284831 8:90399064-90399086 TAAGCAAGCCTGGACAATGGCGG + Intergenic
1046370001 8:113291629-113291651 TTGGGTTTCCAGGACAATGGTGG - Intronic
1047804410 8:128344087-128344109 TAAGCAAGCCTGGACAATGGCGG - Intergenic
1049018119 8:139935972-139935994 TGGGGAAGCCTGCACCATGTGGG + Intronic
1051458743 9:17290569-17290591 TAAGGAAGCCTGGGCAATGGCGG + Intronic
1052594428 9:30539908-30539930 TAAGCAAGCCTGGACAATGGCGG - Intergenic
1053666601 9:40321995-40322017 TGGGGTGACCTGGTCAACGGGGG + Intronic
1053714566 9:40874033-40874055 TAAGCAAGCCTGGACAATGGCGG - Intergenic
1053916188 9:42947041-42947063 TGGGGTGACCTGGGCAACGGGGG + Intergenic
1054377753 9:64462023-64462045 TGGGGTGACCTGGTCAACGGGGG + Intergenic
1054518008 9:66054288-66054310 TGGGGTGACCTGGTCAACGGGGG - Intergenic
1056912242 9:90712589-90712611 TGGGGTGGTCTGTAGAATGGTGG + Intergenic
1056924836 9:90825639-90825661 AAGGGTAGCCTGGACAGTGGAGG + Intronic
1060113146 9:120920835-120920857 TGGGGCAACCTGGGAAATGGAGG - Intronic
1061193101 9:129093703-129093725 AGGTGTAGCCCAGACAATGGAGG - Intergenic
1062249617 9:135587665-135587687 TTGGGGCTCCTGGACAATGGCGG - Intergenic
1185764060 X:2710202-2710224 TGGGGTGTCCTGGGGAATGGAGG + Intronic
1191728031 X:64302126-64302148 TGAGCAAGCCTGGGCAATGGCGG + Intronic
1192950871 X:76014782-76014804 TGTGGTTCCCAGGACAATGGAGG - Intergenic
1194265901 X:91753245-91753267 TAAGGAAGCCTGGGCAATGGCGG - Intergenic
1194271831 X:91825235-91825257 TAAGGAAGCCTGGGCAATGGCGG + Intronic
1194303556 X:92215508-92215530 TAAGGAAGCCTGGGCAATGGCGG - Intronic
1194306498 X:92255994-92256016 TAAGGAAGCCTGGGCAATGGCGG + Intronic
1194836884 X:98693060-98693082 TAAGGAAGCCTGGGCAATGGCGG + Intergenic
1196146733 X:112326587-112326609 TAGGCAAGCCTGGGCAATGGTGG - Intergenic
1198127577 X:133661393-133661415 AGGGGTAGCTTGGAAAATAGAGG - Intronic
1199877577 X:151946586-151946608 AGAGGTAGCCTGCACACTGGAGG - Intergenic
1200067224 X:153509668-153509690 TGGGCTAGCCCGGACTAGGGAGG + Intergenic
1200357618 X:155568292-155568314 TAAGGAAGCCTGGGCAATGGTGG - Intronic
1200589080 Y:5046672-5046694 TAAGGAAGCCTGGGCAATGGCGG + Intronic
1201118502 Y:10855201-10855223 TAAGCAAGCCTGGACAATGGCGG + Intergenic
1202383480 Y:24299975-24299997 TAAGCAAGCCTGGACAATGGTGG + Intergenic
1202487304 Y:25370146-25370168 TAAGCAAGCCTGGACAATGGTGG - Intergenic