ID: 977557710

View in Genome Browser
Species Human (GRCh38)
Location 4:98501741-98501763
Sequence AGCAAATGTCACACAGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977557708_977557710 11 Left 977557708 4:98501707-98501729 CCATAGGACACAGTGAGGAAGCA 0: 1
1: 0
2: 2
3: 22
4: 237
Right 977557710 4:98501741-98501763 AGCAAATGTCACACAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977557710 Original CRISPR AGCAAATGTCACACAGGCCA TGG Intronic
No off target data available for this crispr