ID: 977557912

View in Genome Browser
Species Human (GRCh38)
Location 4:98503431-98503453
Sequence CTGGAAACTCAGAAGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977557908_977557912 1 Left 977557908 4:98503407-98503429 CCTAGAGAGAAGCAGATGTTTAG 0: 1
1: 0
2: 5
3: 31
4: 246
Right 977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG 0: 1
1: 0
2: 3
3: 29
4: 314
977557903_977557912 25 Left 977557903 4:98503383-98503405 CCAGCCCACATCCTGTGAGGACC 0: 1
1: 1
2: 1
3: 18
4: 227
Right 977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG 0: 1
1: 0
2: 3
3: 29
4: 314
977557906_977557912 14 Left 977557906 4:98503394-98503416 CCTGTGAGGACCACCTAGAGAGA 0: 1
1: 0
2: 0
3: 10
4: 129
Right 977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG 0: 1
1: 0
2: 3
3: 29
4: 314
977557907_977557912 4 Left 977557907 4:98503404-98503426 CCACCTAGAGAGAAGCAGATGTT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG 0: 1
1: 0
2: 3
3: 29
4: 314
977557905_977557912 20 Left 977557905 4:98503388-98503410 CCACATCCTGTGAGGACCACCTA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG 0: 1
1: 0
2: 3
3: 29
4: 314
977557904_977557912 21 Left 977557904 4:98503387-98503409 CCCACATCCTGTGAGGACCACCT 0: 1
1: 0
2: 1
3: 10
4: 163
Right 977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG 0: 1
1: 0
2: 3
3: 29
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977557912 Original CRISPR CTGGAAACTCAGAAGGAACC AGG Intronic
901205008 1:7489599-7489621 GTGGAGACTCACAAGGGACCTGG + Intronic
901584851 1:10280880-10280902 ATGGAAACTGAGAAGGAGTCAGG - Intronic
902573824 1:17364170-17364192 TGGGAAACTCAGAACGAACTAGG - Intergenic
903104444 1:21063244-21063266 CTGAAAAATCAAAAGTAACCAGG + Intronic
904322986 1:29708674-29708696 GTGGGAACTCAGAAGGGACTTGG + Intergenic
907487304 1:54786909-54786931 CTCTAAACTGAGAAGGAGCCTGG - Intronic
907595868 1:55719267-55719289 CTGAAACCAGAGAAGGAACCTGG - Intergenic
907989388 1:59564805-59564827 CTGGAAACCCACTAGGAACACGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908626717 1:66052835-66052857 CTGGATTCTCAGAGGAAACCTGG - Intronic
908801930 1:67889265-67889287 CTGGAGAGTGAGGAGGAACCTGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909735262 1:78951161-78951183 CTGTAAGCTGAGATGGAACCTGG - Intronic
910449807 1:87333748-87333770 TTGGAAAATCAGCAGGAACATGG + Intronic
910568060 1:88667548-88667570 GTGGAAAGACAGAAAGAACCTGG - Intergenic
910754885 1:90678636-90678658 ATGGAAAATCACAAGGAACAAGG + Intergenic
911084705 1:93966668-93966690 CTGGAGACTCAGGAGGCACCTGG - Intergenic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
913066052 1:115256079-115256101 CTGGATACTCATCAGGGACCAGG - Intergenic
913134178 1:115872126-115872148 CCAGAAACTCAGAAGAAAACAGG + Intergenic
913184774 1:116360242-116360264 CTGGAAACTCTGGAGGAACAGGG + Intergenic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
915096989 1:153470177-153470199 CTGAAACCTGAGAAGGGACCCGG + Intergenic
916404957 1:164489153-164489175 CTAAAAACTGAGAAGGAGCCGGG + Intergenic
917877025 1:179295174-179295196 CTGGAAAGCCAGAAGGAAAGTGG - Intronic
918052959 1:180990664-180990686 CTGGAAAGCCTGAAGGACCCTGG - Intronic
918214017 1:182377222-182377244 CTGGAAACTCAGCAGCTTCCAGG + Intergenic
919818278 1:201455814-201455836 CTGGGAGCTCAGAAGGCACTGGG + Intergenic
920450463 1:206057301-206057323 CTGGGAATTCATCAGGAACCGGG - Intronic
921753922 1:218830602-218830624 TTGGAAACACAAAATGAACCTGG + Intergenic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
1063572141 10:7225594-7225616 CTGAAAGCTCAGAAGCCACCTGG + Intronic
1063699374 10:8369800-8369822 CTGGTGACTCAGAAGGCTCCTGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1065814419 10:29471193-29471215 CTGGAAACACTGCAGGAAACAGG + Exonic
1067031284 10:42879909-42879931 CTGGCAAATCTGAAGGACCCTGG - Intergenic
1067489260 10:46682575-46682597 TTGGAAAGCCAGAAGGAAACTGG + Intergenic
1067578733 10:47425795-47425817 CTGGAAAATCAGAGGTAACTAGG + Intergenic
1067605411 10:47657810-47657832 TTGGAAAGCCAGAAGGAAACTGG - Intergenic
1067699571 10:48559176-48559198 TTTGTATCTCAGAAGGAACCAGG + Intronic
1067801452 10:49361984-49362006 CTGGAAAGTCACAATGATCCCGG + Intergenic
1071620970 10:87119205-87119227 TTGGAAAGCCAGAAGGAAACTGG - Intronic
1071664253 10:87538357-87538379 CTGGAAACTCGGCAGTAAGCTGG + Intronic
1072078038 10:91998573-91998595 CTTGAAACACAGAAAGAGCCAGG + Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074258593 10:111829169-111829191 ATGAAACCTCAGAAGGAACTTGG - Intergenic
1075419786 10:122292108-122292130 CTGCAAAGTCAAAAGTAACCTGG + Intronic
1075674010 10:124283315-124283337 CTGAAAACTCAAAAGGCACCAGG + Intergenic
1075876511 10:125810685-125810707 CTAGAATCTCAGCAGGAGCCTGG - Intronic
1076266275 10:129111971-129111993 CTGCAAAGTAACAAGGAACCTGG - Intergenic
1076870339 10:133189799-133189821 CTGGTAACTGAAAAGGTACCCGG + Exonic
1079124230 11:17707657-17707679 CAGGAATCTCTGAAGGAACAAGG - Intergenic
1079152078 11:17909015-17909037 CTGGAATCACAGAAAAAACCTGG + Intronic
1079751191 11:24200296-24200318 CAGGAAACTCATAAGCAATCAGG - Intergenic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1081734637 11:45394363-45394385 CTGGAACCTCAGAGGCAGCCAGG - Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082833160 11:57634348-57634370 CTGGAGATTCAGTGGGAACCTGG - Intergenic
1084631352 11:70353353-70353375 CTGGAATCACAGCAAGAACCTGG + Intronic
1085201820 11:74706543-74706565 CTGAAAACTCAAAGGGAAGCTGG + Intronic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1086770211 11:90753049-90753071 CAGGAAACCCAGAAACAACCAGG + Intergenic
1089485268 11:118840830-118840852 TTAGAAACTAAGAAGGAACCGGG + Intergenic
1090705427 11:129332067-129332089 CAGGAAAATCAGCAGGAACCGGG - Intergenic
1092228210 12:6762665-6762687 CTGCAAAGTCAGGAGGAATCAGG + Intronic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092570348 12:9714704-9714726 CTGGAAATTCATCAGGAACTGGG + Intergenic
1092925396 12:13267651-13267673 GGGGAAAGTCAGAAAGAACCGGG + Intergenic
1093379684 12:18477565-18477587 TTGGAAACTCAGTAAGAAACTGG - Intronic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099666270 12:85633380-85633402 CTGGAAACTATGGAGCAACCCGG - Intergenic
1099887801 12:88553292-88553314 CTGGAAACTCTGAGGGAATAGGG + Intronic
1100575663 12:95889710-95889732 CTGCAAACTCAGATGGATACAGG + Intronic
1101994010 12:109511776-109511798 CTGGAAGCTTAGGAGGCACCTGG + Intronic
1102900608 12:116633633-116633655 CTGCACTCTCAGAAGGACCCTGG - Intergenic
1102996083 12:117351580-117351602 GAGGAATATCAGAAGGAACCTGG + Intronic
1103341821 12:120224904-120224926 CTAGAGCCTCAGGAGGAACCTGG - Intronic
1104304580 12:127597922-127597944 CTGGATCCTGAGAAGGAATCTGG - Intergenic
1104316360 12:127706143-127706165 CAGAAATCACAGAAGGAACCCGG - Intergenic
1104409494 12:128546473-128546495 CTGGAAGCTCAGAACAAACAGGG - Intronic
1107102757 13:36611897-36611919 CTGGAAAGTGTGAAGGAACCTGG + Intergenic
1107553406 13:41497265-41497287 CGACAACCTCAGAAGGAACCAGG + Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109982188 13:69923796-69923818 CTGCCAACTCAGAAGGCAGCAGG - Intronic
1111693066 13:91589391-91589413 CTACAAACTCAGGAGGAAACAGG + Intronic
1111880133 13:93945555-93945577 TTTGCAACTCAGGAGGAACCAGG - Intronic
1112668983 13:101613336-101613358 CTGGGAACACAGGAGGACCCTGG - Intronic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113251713 13:108460675-108460697 AAGGAAACTCTGAAGTAACCAGG + Intergenic
1113572702 13:111370154-111370176 CAGGACCCTCAGAAAGAACCCGG + Intergenic
1115453693 14:33577540-33577562 ATGGAAACACAGAGAGAACCAGG + Intronic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1119771748 14:77224485-77224507 CTGGGATCCCAGAAGGAAGCAGG + Intronic
1121647924 14:95534085-95534107 CTGGAAACTCAGAGGCGGCCGGG + Intronic
1122954967 14:105066280-105066302 CCTGAAACTCAGAAGCAGCCTGG - Intergenic
1123105273 14:105838520-105838542 CTGGAAATTGAGAAAGAAGCCGG + Intergenic
1124174471 15:27409636-27409658 CTGGAATTTTATAAGGAACCAGG + Intronic
1126711623 15:51463471-51463493 CTGGAAATGCAGAAGAATCCCGG + Exonic
1127327834 15:57912709-57912731 TTGGAAACACAGACAGAACCTGG - Intergenic
1129050218 15:72774880-72774902 CTGGGAACTCTGATGCAACCTGG + Exonic
1130423155 15:83768566-83768588 CTGGGAACGTAGAAGGAACTAGG + Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1131983224 15:98016402-98016424 GTGGACACTCAGAGGAAACCTGG - Intergenic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1132897047 16:2234042-2234064 CTGGACACCCAGAAGCACCCCGG - Intronic
1134384363 16:13758153-13758175 CAGTAAGCTCTGAAGGAACCTGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1136004276 16:27317888-27317910 CTGGATACGCAGAAGGGACTCGG - Intronic
1138127419 16:54450139-54450161 CTGAAAGGTGAGAAGGAACCAGG + Intergenic
1139311661 16:66032915-66032937 CTGGAACCTCAGACAGGACCTGG + Intergenic
1140341316 16:74166417-74166439 TTAGCAACTCACAAGGAACCTGG - Intergenic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1143948376 17:10614157-10614179 CTCCAAATTCAGAATGAACCTGG - Intergenic
1144168840 17:12638823-12638845 CTGACAACTCATTAGGAACCTGG + Intergenic
1145211227 17:21014816-21014838 CAGGAAACTCACAAGCAGCCAGG + Intronic
1146182135 17:30705315-30705337 CTGGAAAGTCAGCAGGTGCCAGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148289467 17:46431541-46431563 ATGGAAAGTCAGCAGGAAACAGG + Intergenic
1148311636 17:46649113-46649135 ATGGAAAGTCAGCAGGAAACAGG + Intronic
1148382318 17:47209100-47209122 GTGGAAACCCAGAAGGACCAGGG - Exonic
1149088614 17:52751184-52751206 CTGCCAACTCAGAAGGGGCCGGG - Intergenic
1149642262 17:58210830-58210852 CTGGAAACGCAGAGGGTTCCTGG - Intronic
1149994324 17:61399110-61399132 CGGAAGACTCGGAAGGAACCTGG - Intergenic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1151680646 17:75620992-75621014 CTGGACACTCAGGTGGCACCAGG + Intergenic
1152390687 17:80002061-80002083 CAGGAAACGCAGAAGGGATCCGG + Intronic
1152401164 17:80067077-80067099 CTGGACCCTCAGAGAGAACCTGG - Intronic
1152774760 17:82194096-82194118 CTGGAGGCTCTGAAGGAAGCCGG - Exonic
1153320774 18:3771923-3771945 ATGCGAACTCAGAAGGGACCGGG - Intronic
1156529950 18:37805802-37805824 CTGGTAACCCACAAGGATCCTGG - Intergenic
1157211448 18:45746022-45746044 CAGGAAACTCTGACAGAACCTGG + Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158416693 18:57255066-57255088 CTGGAAACTCAGAGTGATTCAGG - Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1159643477 18:70889858-70889880 ATGGAAAGTCAGAAGGAAATTGG - Intergenic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1162142542 19:8593248-8593270 CCAGAAACTCAGAAGGCACCAGG - Intronic
1162976697 19:14210487-14210509 CTGGAAAGTCAGCAGGTGCCAGG + Intergenic
1162991854 19:14308106-14308128 CTGGACAGACAGAAAGAACCTGG + Intergenic
1163669887 19:18621147-18621169 CTGGAAACCCAGGTGGCACCAGG + Intergenic
1164373546 19:27663346-27663368 GTGGAAACTATGAAGGAACATGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165015404 19:32876650-32876672 CTGGAATCTCACAAGCACCCAGG + Intergenic
1165886032 19:39079261-39079283 CTGAAAACTTAGAAAGAGCCAGG - Intergenic
1166010120 19:39935430-39935452 GTGGGGACTGAGAAGGAACCAGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1168190207 19:54732831-54732853 CAGGAAACTAAGGAGGAACAAGG + Intronic
1168205119 19:54844733-54844755 CAGGAAACTAAGGAGGAACAAGG + Intronic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926621557 2:15050749-15050771 GTGGAAACCCAGATGGAACCCGG - Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933271035 2:80233112-80233134 CTGAAAATTCAGTAGGAACCTGG + Intronic
933502179 2:83127185-83127207 CTGTAAATTCAGAATGAAACTGG - Intergenic
934165385 2:89289637-89289659 CTGGAGCCTCTGAAGGAGCCTGG - Intergenic
934201889 2:89892825-89892847 CTGGAGCCTCTGAAGGAGCCTGG + Intergenic
934708159 2:96499222-96499244 CTGGAAACCTAAAAGCAACCTGG - Intronic
936172143 2:110185754-110185776 CTGGAAAGTCAGGAGGGAGCAGG + Intronic
936348601 2:111695000-111695022 CTAGAAGCTCAGAATAAACCTGG - Intergenic
936482062 2:112893239-112893261 GTGGAATCTAAGAAGGAACCTGG + Intergenic
939742036 2:145920011-145920033 TTGCAAACTCAGAAGGAAAAGGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941372397 2:164681658-164681680 CTGGAAACTAAGAATAAACTGGG + Intronic
942604640 2:177677531-177677553 CTGGGGACTCAGGAGGGACCTGG + Intronic
942932376 2:181511014-181511036 CTAGAAAGTCAGAAGGAGCCAGG - Intronic
948516221 2:238505407-238505429 CTGAGAACCGAGAAGGAACCAGG - Intergenic
1169875472 20:10292625-10292647 CTGGACACTCAGAATCAAACAGG + Intronic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173183737 20:40823237-40823259 CTGGAAACATAGAATGAACCAGG - Intergenic
1173408539 20:42788780-42788802 CTGGGCTCTCAGAAGGGACCTGG - Intronic
1174423624 20:50416715-50416737 CTGGAAAGCCAGAAGTGACCAGG - Intergenic
1174531627 20:51219146-51219168 CTGGGGACTCAGAAGTAACCTGG - Intergenic
1177003556 21:15643063-15643085 CTAGAACCTCAGAAGAAAGCAGG - Intergenic
1181142484 22:20816670-20816692 GAGGAAACTCAGAAGGCACAGGG + Intronic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1181764180 22:25079471-25079493 GGGGAAAGACAGAAGGAACCAGG + Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182251804 22:29006556-29006578 CTGGAGACTGATAAGGAACCAGG - Intronic
1182294398 22:29304687-29304709 CTGGAGCCTCAGAGGAAACCAGG - Intergenic
1182345360 22:29660005-29660027 CTGCAAACTGAGAAGGTACTGGG - Intronic
1182794104 22:32977779-32977801 CTGGAAACTGACAAGCAGCCTGG + Intronic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
1184636241 22:45834340-45834362 ATGGAAACCCAGTAGAAACCGGG - Intronic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
949815390 3:8052855-8052877 CTCTAACCTCAGAAGGAATCTGG - Intergenic
950482814 3:13255103-13255125 CTGGTACCCAAGAAGGAACCAGG + Intergenic
952323685 3:32301158-32301180 CTGGAAACTTAGAAACAAACCGG - Intronic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953496105 3:43388207-43388229 TTGCACACTCAGGAGGAACCTGG - Intronic
953654901 3:44842608-44842630 CTTGAAACTTAGAAGAAACTGGG + Intronic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954014008 3:47669871-47669893 CTGGGAACCCAGAGGGCACCAGG + Intronic
956095827 3:65714930-65714952 CCCGAAACTCAGAAGGAGCAGGG + Intronic
958561343 3:95751350-95751372 CTGGATATTGAGAAGGAAACAGG + Intergenic
958922485 3:100122411-100122433 TTGGAAACTAAGAAGTACCCTGG - Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959794890 3:110414313-110414335 CTTGGCACTCAGAAGGAAACAGG - Intergenic
959984473 3:112557338-112557360 CTTAAAACTCACAAGGAGCCGGG + Intronic
961103524 3:124221861-124221883 CTGGAAACTCAGCAGAAATTGGG + Intronic
961639565 3:128356719-128356741 GTGGATACACAGAAGGAATCAGG - Intronic
962345515 3:134616172-134616194 ATAGAAAGTCAGAAGGAAACTGG + Intronic
963740279 3:149072606-149072628 CTAAAAAATCAGAAGTAACCGGG + Intronic
963777551 3:149454317-149454339 CTGGAAACATAGAAGGAAATAGG - Intergenic
963822151 3:149909366-149909388 CTGGAAACTTAGCTTGAACCCGG - Intronic
964604166 3:158541215-158541237 CTGAAGACTTAGAAGGAGCCAGG - Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
966091333 3:176142337-176142359 CAGTAAAATCAGAAGGCACCTGG - Intergenic
966580879 3:181561458-181561480 CTGGGAACTCAGAAGTAATAAGG + Intergenic
967839848 3:193996422-193996444 CTGGAGACTCAGCAGGCACCTGG - Intergenic
969702783 4:8776886-8776908 CTCGGTACTCAGAAGGTACCTGG - Intergenic
970430665 4:15986281-15986303 CTGGAAACTCACAACGAGGCAGG + Intronic
972203817 4:36747641-36747663 CTGCCAACTCAGAAGGAGCGGGG - Intergenic
973790308 4:54372151-54372173 GTGGAAGCTCAGAAGGAATTTGG + Intergenic
975611518 4:76208630-76208652 GTGGAAAGTCAGCAGGAAGCAGG - Intronic
977153691 4:93546421-93546443 CTGGAAACTTTGAAGTCACCTGG - Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
977591471 4:98832163-98832185 CTGGAAACTCTGAAGGCCTCTGG + Intergenic
978114730 4:105005624-105005646 CTGGAATCCCAGAAGGAAAGAGG - Intergenic
980102757 4:128557876-128557898 CTGCAAGCTCAGGAGGCACCTGG + Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
983556514 4:169063919-169063941 GTGGCAGCTCAGAAGGAGCCAGG - Intergenic
983674307 4:170273979-170274001 CTGGAAACTCATATGCATCCTGG + Intergenic
984483443 4:180335713-180335735 CTGCAAACTCAGAGGCAATCTGG - Intergenic
985149866 4:186935837-186935859 TTGGAAACTCTGAAGCAGCCTGG + Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986051895 5:4097967-4097989 CTGGGAAATCAGCAGGCACCAGG - Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
987499284 5:18686502-18686524 CTGCAAAATCAGGAGAAACCTGG - Intergenic
987591867 5:19940662-19940684 ATGAAAACTGAGAAGGAACTAGG - Intronic
988237406 5:28563056-28563078 CTGGATACTAAGAAAGAAACTGG + Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
994754139 5:103774115-103774137 AAAGAAACTGAGAAGGAACCAGG + Intergenic
995318748 5:110806492-110806514 ATGGAAACTGAGAAGGAAAAGGG + Intergenic
997354218 5:133252036-133252058 CTGGACACTCAGAAGCCAGCCGG + Intronic
998038682 5:138937331-138937353 CTGGCAAATGAGAAGGCACCAGG + Intergenic
998498422 5:142611208-142611230 CTTGAAACTCAGAAGGGCTCTGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000699717 5:164433696-164433718 CTGGAAACTCAGAACATACCAGG - Intergenic
1001161277 5:169317352-169317374 CTGGAGACTCGGAAGGGTCCAGG + Intergenic
1003419064 6:5939432-5939454 CTGGTGACTGAGAAGGACCCGGG + Intergenic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1005340488 6:24839273-24839295 CTGTAAAGGCAGAAGGCACCAGG + Intronic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1007165633 6:39827097-39827119 GTAGAAACTCAGGAGAAACCAGG + Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1017117953 6:150996625-150996647 CTGTAGGCTCAGCAGGAACCAGG - Intronic
1017528425 6:155263603-155263625 CTTGGAACTCACAAGGGACCCGG + Intronic
1017538148 6:155370835-155370857 TGGGAAACTTAGAAGGAACAGGG + Intergenic
1019933488 7:4239071-4239093 CTGGAAACACAGTAGTGACCTGG - Intronic
1022093449 7:27123304-27123326 CTGGAAACTGAGAGGGACGCCGG + Intronic
1022244439 7:28544780-28544802 CTGGAAACAGAGAAGGGAGCTGG + Intronic
1022944627 7:35270022-35270044 CAGGTCACTCAGAAGGAGCCAGG - Intergenic
1023379164 7:39588741-39588763 TTTAAAACTCAGAAGGAAGCAGG - Intronic
1023634747 7:42198368-42198390 CTGGAGAGTGAGAAGGATCCAGG + Intronic
1024345165 7:48305883-48305905 CAGGAAAATCAGCAGGAACTTGG + Intronic
1024988340 7:55214555-55214577 CTGAAAACCCAACAGGAACCTGG + Intronic
1026445051 7:70476988-70477010 CAGGAAACTCAGAAAAGACCTGG - Intronic
1026834481 7:73629004-73629026 GTGGGAACTCAGAAATAACCTGG - Intergenic
1026842682 7:73679243-73679265 CCGGAACCTCAGAAGGAAGAGGG + Intergenic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1029259999 7:99295485-99295507 CTGGCAACTCAGTTTGAACCAGG - Intergenic
1030243955 7:107360560-107360582 CTGGAAACTCAAGAGACACCAGG - Intronic
1030392700 7:108946680-108946702 CTGACAACTCAGAAGGAAAGGGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030691059 7:112534215-112534237 CAGGAAACTTAGAAGAAAACAGG - Intergenic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1034328294 7:150258173-150258195 CTGGCAACTGAGCAGGAACTTGG - Intronic
1034760260 7:153665772-153665794 CTGGAGGCTCGGAAGGAGCCGGG + Intergenic
1034764922 7:153711291-153711313 CTGGCAACTGAGCAGGAACTTGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037602741 8:20411768-20411790 CTGTAAACTCATAATGAACACGG - Intergenic
1038515576 8:28184868-28184890 CTCGAAACTCAGAAGTCTCCTGG + Intronic
1043335853 8:79175928-79175950 TTGGAGACTCAGCTGGAACCTGG + Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044906233 8:97006736-97006758 CTGGCAACCCAGGAGGACCCAGG + Intronic
1046769567 8:118104898-118104920 CTGCATATTCAGAATGAACCAGG - Intronic
1047029351 8:120860266-120860288 ATGGAAACACAGAAGAAACCTGG - Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047654900 8:126966500-126966522 CTGCAATCTTGGAAGGAACCTGG + Intergenic
1048361544 8:133701340-133701362 CTGTAAACTCAGAAGTAAAGGGG - Intergenic
1049120058 8:140728411-140728433 CTGAAAATCCAGAAGGGACCTGG - Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1050884524 9:10747152-10747174 CTAGAAACTCTGAATAAACCTGG + Intergenic
1051319837 9:15890654-15890676 GTTGAAAATCAGAAGGCACCTGG + Intronic
1052492468 9:29187816-29187838 TTGGAAAGCCAGAAGGAAACTGG + Intergenic
1053482470 9:38425784-38425806 CTGCAAACTGGGAAGGAACTGGG - Intergenic
1053575866 9:39357310-39357332 ATGGAATCTGAGAAGGACCCGGG - Intronic
1053840382 9:42185247-42185269 ATGGAATCTGAGAAGGACCCGGG - Intronic
1054097435 9:60916001-60916023 ATGGAATCTGAGAAGGACCCGGG - Intergenic
1054118838 9:61191631-61191653 ATGGAATCTGAGAAGGACCCGGG - Intronic
1054588914 9:66990931-66990953 ATGGAATCTGAGAAGGACCCGGG + Intergenic
1055164260 9:73172291-73172313 GTGGGAAATCAGAGGGAACCTGG + Intergenic
1055295380 9:74827811-74827833 AATGAAGCTCAGAAGGAACCTGG - Exonic
1055742312 9:79403405-79403427 CAGGAAACCCAGAAAGCACCTGG - Intergenic
1055986920 9:82062093-82062115 ATGGAATCTGAGAAGGACCCGGG + Intergenic
1057043455 9:91864689-91864711 CTGGCATGTCAGAAGGGACCAGG + Intronic
1057160257 9:92884121-92884143 ATGGAATCTGAGAAGGACCCGGG - Intergenic
1057419361 9:94898252-94898274 CTGGAAACTCATGAGGGGCCAGG + Intronic
1058604028 9:106701807-106701829 CTGGAAACTCAGTAAGTACTTGG - Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1059654164 9:116342105-116342127 CTGCACGCTCAGAAGGTACCTGG - Intronic
1059737755 9:117119339-117119361 CTGCAAACTCAGAAGCAATTGGG - Intronic
1061070092 9:128304322-128304344 AAGGAGACTGAGAAGGAACCAGG + Intergenic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1062441041 9:136569330-136569352 CTGGACAGTCAACAGGAACCTGG - Intergenic
1203444545 Un_GL000219v1:42768-42790 CTGCAATCTCAGAATGCACCAGG - Intergenic
1187042668 X:15613353-15613375 CTGGAAAGGTAGAAGGACCCGGG + Intergenic
1188444782 X:30244924-30244946 CTGGAAACTCATAAGCCACTGGG + Intronic
1188697206 X:33208502-33208524 CTGACAACACAGAACGAACCAGG - Intronic
1190129322 X:47732613-47732635 TAGGAAGCTCAGAAGGAAACTGG - Intergenic
1192174704 X:68878449-68878471 CTGGATACTCAGAGGTATCCAGG + Intergenic
1192367421 X:70485643-70485665 ATGGTAACTAAGAAGGAAACTGG - Intronic
1193065207 X:77252544-77252566 CTGGAAACTCAGAAGTGAAGAGG + Intergenic
1194384690 X:93238071-93238093 CTGGAAAGTCATCAGGAACTGGG - Intergenic
1194557971 X:95385923-95385945 CTGGAAATCCAGAAGAAAACTGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1196475113 X:116074968-116074990 CTGGAAACATAGAATGAACCAGG + Intergenic
1196645608 X:118115000-118115022 CAGCAATCTCAGAAGAAACCAGG - Intronic
1198244815 X:134820041-134820063 GTGGAAAGATAGAAGGAACCTGG - Intronic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic
1201677747 Y:16605960-16605982 CTGGAATCCCAGAAGGAAAGGGG + Intergenic