ID: 977568789

View in Genome Browser
Species Human (GRCh38)
Location 4:98609350-98609372
Sequence CTCTCCCCCAGCCAGTGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977568789_977568796 -5 Left 977568789 4:98609350-98609372 CCCGACCACTGGCTGGGGGAGAG 0: 1
1: 0
2: 2
3: 31
4: 263
Right 977568796 4:98609368-98609390 GAGAGGGCCAGGGCAGTGCTCGG No data
977568789_977568800 19 Left 977568789 4:98609350-98609372 CCCGACCACTGGCTGGGGGAGAG 0: 1
1: 0
2: 2
3: 31
4: 263
Right 977568800 4:98609392-98609414 ATGCTGGAGGTAAAACCAGATGG 0: 1
1: 0
2: 2
3: 25
4: 246
977568789_977568798 3 Left 977568789 4:98609350-98609372 CCCGACCACTGGCTGGGGGAGAG 0: 1
1: 0
2: 2
3: 31
4: 263
Right 977568798 4:98609376-98609398 CAGGGCAGTGCTCGGAATGCTGG 0: 1
1: 0
2: 1
3: 11
4: 165
977568789_977568799 6 Left 977568789 4:98609350-98609372 CCCGACCACTGGCTGGGGGAGAG 0: 1
1: 0
2: 2
3: 31
4: 263
Right 977568799 4:98609379-98609401 GGCAGTGCTCGGAATGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977568789 Original CRISPR CTCTCCCCCAGCCAGTGGTC GGG (reversed) Intronic
900339653 1:2181975-2181997 GTCTCCTCCACCCAGTGGCCTGG + Intronic
900505622 1:3028718-3028740 CTCCCCTTGAGCCAGTGGTCTGG + Intergenic
901626699 1:10629035-10629057 CTGACCCCCTGCCAGTGGCCAGG + Intronic
902837865 1:19058375-19058397 CTCTTCCCAAGGCAGTGGGCAGG - Intergenic
902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG + Intergenic
903265645 1:22156440-22156462 CTGTCCCCCAGTCAGTGGGGTGG - Intergenic
903955553 1:27022949-27022971 CTCGACCCCAGCCAGTGTCCAGG - Intergenic
904328936 1:29745412-29745434 CTCTCACCCATCCAGGGGTTTGG - Intergenic
905684758 1:39900863-39900885 CTCTGCCCCTGCCTGAGGTCAGG - Intronic
908441609 1:64160823-64160845 CTCTCCCCCGCCCAGAGTTCTGG - Intronic
908985008 1:70007103-70007125 CTCTCCCCTCCCCAGAGGTCAGG + Intronic
911821911 1:102434497-102434519 CTCTCTCTCAGCCCTTGGTCTGG + Intergenic
912732999 1:112126347-112126369 CACTCCCCCAGTCAGTGGGCTGG - Intergenic
913243783 1:116853275-116853297 ATCTCACCCAGCCAGTAGGCAGG - Intergenic
914348117 1:146817188-146817210 CCCTACACCAGCCAGGGGTCTGG - Intergenic
914665499 1:149829222-149829244 CTCTCACCCAGCCTAGGGTCAGG - Intergenic
914670266 1:149864572-149864594 CTCTCACCCAGCCTAGGGTCAGG + Intronic
915525856 1:156475841-156475863 CTCACCCCCAGCCAGGAGTGGGG - Intronic
916667648 1:166981020-166981042 CTCACCCCCAGCAAATGGGCAGG + Intronic
917211249 1:172633994-172634016 CTTTCCCCACGCCAGAGGTCTGG - Intergenic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
919972338 1:202589354-202589376 CTCTCCCCAAGTCAGTGACCAGG - Exonic
920401295 1:205678501-205678523 CCCTCCACCACCCAGTGGCCTGG + Intronic
920431854 1:205923831-205923853 CTCTCCCCTGCCCTGTGGTCTGG - Intronic
922279997 1:224114425-224114447 CTCTCCCCCCGGCCGAGGTCTGG + Intronic
923659480 1:235945906-235945928 CTCTCCCCCAGCCTCTGTGCCGG - Intergenic
1064519540 10:16186858-16186880 CTCTTTCCCAGCCAGAGGTTGGG - Intergenic
1067238728 10:44472780-44472802 CTCTCCCCCAGCCCCTGGTGTGG + Intergenic
1068116126 10:52739615-52739637 CTCCCCACCAGCCAGGGGTAAGG - Intergenic
1070486357 10:76935542-76935564 CTCTCCCTCAGCAGGTTGTCAGG + Intronic
1072622620 10:97090093-97090115 CTCTGCCTAAGCCCGTGGTCCGG - Intronic
1073208338 10:101780290-101780312 TTCTCCCCCAGCCCGTGGTGAGG - Intronic
1075132065 10:119748637-119748659 CCCTCCCGCAGCTGGTGGTCTGG + Intronic
1075317710 10:121465929-121465951 TTCTTCCCCAGCCAGTGGGGTGG - Intergenic
1075723964 10:124602441-124602463 CTCTCCACCAGCCAGTGGGCAGG - Intronic
1076157881 10:128217234-128217256 CTCTACCACATCCTGTGGTCTGG + Intergenic
1076439407 10:130470428-130470450 CTCTCCCCCAGTCAGTGGCTGGG - Intergenic
1077136275 11:1000706-1000728 CTCTCCCCCAGGCAGTAATCTGG - Intronic
1077460871 11:2708746-2708768 CTCTCCCCAGGCCAATGGCCAGG + Intronic
1079818566 11:25094620-25094642 CTGTCCCCCAGCCACAGGGCAGG - Intergenic
1080098533 11:28432509-28432531 CTCTCTTTCAGTCAGTGGTCTGG + Intergenic
1083202315 11:61128000-61128022 TGCTCCCCCAGCCAGTGCTCGGG + Intergenic
1083458995 11:62798694-62798716 CTCCCTCCCAGCCTGTGCTCAGG + Intronic
1084095743 11:66909935-66909957 CTCTGCCGCAGTGAGTGGTCAGG - Intronic
1084268553 11:68017236-68017258 CTTTCCCACAGCCTGTGCTCTGG - Intronic
1088606593 11:111539632-111539654 CTCACCCCCAGCCTGTATTCAGG + Intergenic
1091306540 11:134539867-134539889 CTCTTCCCCAGCCACTGGAAAGG - Intergenic
1094343505 12:29440101-29440123 CTCTCCCCTACCCAGAGGTTGGG + Intronic
1095947965 12:47764582-47764604 CCCTGCCCCAGCCAGTGCTCTGG - Intronic
1097269136 12:57763714-57763736 CCCTCCCCCAGCCAGCGAGCTGG + Exonic
1099854228 12:88142898-88142920 CTCCACCCCCGGCAGTGGTCCGG - Intronic
1100758286 12:97776663-97776685 CTCCACCCCAGCCAGTGTCCAGG + Intergenic
1101381319 12:104216099-104216121 CTCTCTCACAGCCAGCGGGCGGG - Intronic
1101876233 12:108598338-108598360 CGCTCCCCCAGACAGTGAGCTGG + Intergenic
1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG + Intronic
1102310190 12:111838650-111838672 CTCTCGCCCTGCATGTGGTCTGG - Intergenic
1102992757 12:117326900-117326922 CTCTCCCCCAGCCGACAGTCTGG - Intronic
1103579548 12:121904113-121904135 CTATGCCCCTGCTAGTGGTCAGG + Intronic
1104101824 12:125619732-125619754 CTGTCCAGCAGCCTGTGGTCAGG - Intronic
1104374527 12:128252122-128252144 CTCTCCTGCAGCCAGGGTTCTGG - Intergenic
1104406360 12:128520456-128520478 CTGTCTCCCAGCCAGTGGAAGGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1110575106 13:77046900-77046922 CTCTCCCCCACCCACTGGTGGGG - Intronic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1114555298 14:23558820-23558842 CCCTAGCCCAGGCAGTGGTCAGG - Exonic
1114737924 14:25062177-25062199 CTCTCCTCCATCCAGTTGCCAGG - Intergenic
1122108830 14:99481004-99481026 GTCCTCCCCAGCCAGTGGGCTGG + Intergenic
1124621681 15:31277581-31277603 CTCTCCCTCATCCTGTGCTCCGG + Intergenic
1125134754 15:36328626-36328648 CTCTCACCCAGGGAGTGGTGAGG + Intergenic
1125472589 15:40019428-40019450 CTAACCCCCAGGCAGTGGACTGG + Intronic
1125607272 15:40947662-40947684 CTCTCCCCGAGCCTGTGGAGTGG + Intergenic
1127261316 15:57328638-57328660 CTGTCCATCAGCCAGTTGTCAGG + Intergenic
1128544715 15:68559289-68559311 CTCTCTTCCTGCCAGTGGACGGG - Intergenic
1129217260 15:74107476-74107498 ATGTCCCCCAGCCAGAGGGCAGG + Intronic
1129231730 15:74200890-74200912 CTGGCCCCCAGCCAGTGCCCAGG + Intronic
1130606058 15:85318098-85318120 CTCTCCCCCATCTGGTGGCCTGG - Intergenic
1130683678 15:86018577-86018599 CACTCCACCAGCCAGTCCTCTGG - Intergenic
1132908898 16:2298514-2298536 CTTTCCCCCCACCAGTGGACGGG - Exonic
1133466559 16:6032901-6032923 CTCTCTCCCAGCCATTGTTCAGG + Intronic
1133735447 16:8611497-8611519 CTCATCCCCAGGCAGTGCTCTGG + Intergenic
1133865364 16:9637099-9637121 GACTCCCTCAGCCACTGGTCTGG + Intergenic
1134244625 16:12530979-12531001 TTCTCCCCCAGACTGTAGTCTGG + Intronic
1134578448 16:15351495-15351517 CTGTCCCCCAGCCAGGCGGCCGG + Intergenic
1134724141 16:16406049-16406071 CTGTCCCCCAGCCAGGCGGCCGG - Intergenic
1134943288 16:18305820-18305842 CTGTCCCCCAGCCAGGCGGCCGG + Intergenic
1135012315 16:18892925-18892947 TTCTCTCCCAGCCAGTCCTCTGG - Intronic
1135158189 16:20072204-20072226 CTCTCCCCAAGCCAGTGATGAGG - Intronic
1135319177 16:21480168-21480190 TTCTCTCCCAGCCAGTCCTCTGG - Intergenic
1135372073 16:21911961-21911983 TTCTCTCCCAGCCAGTCCTCTGG - Intergenic
1135439713 16:22458743-22458765 TTCTCTCCCAGCCAGTCCTCTGG + Intergenic
1136246544 16:28979390-28979412 CTCTCCCTCCCACAGTGGTCTGG + Exonic
1136329476 16:29562241-29562263 TTCTCTCCCAGCCAGTCCTCTGG - Intergenic
1136444105 16:30301948-30301970 TTCTCTCCCAGCCAGTCCTCTGG - Intergenic
1137530450 16:49275860-49275882 CTTTCCCCCAGCCAGAGGCTAGG - Intergenic
1139985920 16:70898357-70898379 CCCTACACCAGCCAGGGGTCTGG + Intronic
1140479934 16:75256998-75257020 CCCTCCCCCAGGCAGTGCTGAGG - Intronic
1142186656 16:88697974-88697996 CACTCCCTCTGCCAGTCGTCCGG - Intronic
1143282349 17:5764406-5764428 CTCCCCACCAGCCAGAGGGCTGG - Intergenic
1144705994 17:17368198-17368220 CACTCACCCAGTCAGTGGTGTGG - Intergenic
1146680017 17:34800344-34800366 CTCTCCCAGGCCCAGTGGTCAGG + Intergenic
1147316784 17:39624874-39624896 ATCTCCCCCAGCCTGTGGCCAGG - Intergenic
1147598981 17:41734268-41734290 CAGTCCCCCGGCCAGTGGCCCGG + Exonic
1148165084 17:45477926-45477948 CTCTGCCCCAGCCTGTCTTCTGG - Exonic
1148744575 17:49911241-49911263 CTCTCCCCAAGCCACTTCTCCGG - Intergenic
1149456859 17:56795002-56795024 CACTCCCTCAGACAGAGGTCCGG + Intronic
1149661961 17:58338640-58338662 CTCGCCCACAGTCAGTGGCCTGG - Intergenic
1150396316 17:64824651-64824673 CTCTGCCCCAGCCTGTCTTCTGG - Intergenic
1151631357 17:75313232-75313254 CTCTCTCCCGACCAGTTGTCTGG - Intergenic
1151742720 17:75994881-75994903 CTCTGCCCAGGCCAGAGGTCAGG - Intronic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1154980324 18:21498332-21498354 TGCTCCCCCAGCCAGGGGTTAGG + Intronic
1157315029 18:46579777-46579799 CTCTCTGCCTGCCAGTGGCCCGG - Intronic
1160380823 18:78454013-78454035 CACTTCCCCAGCCAGTGGACGGG - Intergenic
1160782241 19:883053-883075 CACACCCCCAGCTAGTGGCCAGG + Intronic
1160861710 19:1239991-1240013 CTCGCCCCCTGCCCGTGTTCAGG - Intergenic
1161104062 19:2434598-2434620 CTCTGCCCCAGTCTGTGGTGAGG - Intronic
1161298665 19:3532406-3532428 CTGTCCCCCAGCTGCTGGTCTGG + Exonic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161578037 19:5065660-5065682 CTCCCCTCCAGCCAGCGGACAGG - Intronic
1162717721 19:12644387-12644409 CTGTGTCCCAGCCAGTGGTAGGG - Intronic
1163747127 19:19055211-19055233 CTCTCCCACAACCAGCGGCCTGG + Intronic
1165143503 19:33717076-33717098 CTCAACCCCAGCCAGTGTCCAGG + Intronic
1165773154 19:38389805-38389827 TTCTCACCCAGCCTGTGGCCTGG + Intronic
1166185639 19:41137158-41137180 CTCTGCCCCAGCCAAGGGGCAGG + Intergenic
1166230890 19:41425431-41425453 GCCTCCCCCAGCCAGGGGCCTGG - Exonic
1166334735 19:42098915-42098937 CTCTGCTCCTGCCAGTGGCCAGG + Intronic
1166872441 19:45879055-45879077 GTCTCCCCCAGCCAGTGTGCTGG + Intergenic
1167334782 19:48878067-48878089 CTCCCCCTCAGCCAGTGTTCAGG + Intergenic
1167621899 19:50565426-50565448 CACTCAGTCAGCCAGTGGTCAGG - Intronic
1167818379 19:51904425-51904447 CTCAACCCCAGCCAGGGGCCTGG + Intronic
1167979651 19:53262820-53262842 CTCTTCCCTTTCCAGTGGTCTGG - Intergenic
1168241406 19:55090977-55090999 CCCTGCCCCAGACAGTGGGCGGG + Exonic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
926274596 2:11393966-11393988 CTCTTCCGCAGCCCGTGGTCAGG - Intergenic
926612258 2:14958259-14958281 CTCTCCCACAGCCAGCTGCCTGG + Intergenic
927200871 2:20577371-20577393 CTCTTCCCCAGCCAATGGTTGGG - Intronic
927484998 2:23482435-23482457 CTGACCCCCAGCCTGTGCTCTGG + Intronic
929437032 2:41936767-41936789 CTCTCCGGCAGCCTGTGGACAGG - Exonic
930281340 2:49373900-49373922 GTCTGCCCCTTCCAGTGGTCAGG + Intergenic
930529666 2:52572974-52572996 GCCACCCCCAGCCCGTGGTCAGG + Intergenic
931560189 2:63553118-63553140 CTCTCCCCCTTACAGTGGTGTGG - Intronic
932074629 2:68651407-68651429 CTCTGCCCCAGCCACAGGTATGG + Intronic
932076023 2:68663648-68663670 CTCGACCCCAGCCAGTGTCCAGG + Intergenic
932232501 2:70094400-70094422 CTCTCCTCCAGCCAGTAGTTTGG + Intergenic
932337488 2:70939236-70939258 CGCTCCACCAGCCAGAAGTCCGG + Intronic
932338954 2:70947742-70947764 CTCTCAACCAGCAAGTGGCCAGG - Intronic
932571951 2:72942832-72942854 CCCTCCCCCTGCCAGAGGCCTGG - Exonic
934555673 2:95285837-95285859 CTCCAGCCCAGCCAGGGGTCAGG - Intronic
935569047 2:104639994-104640016 CCCTCCCCCTGCCATTGGTTGGG - Intergenic
936015230 2:108953756-108953778 CTCTCCACCTGCCAGTTTTCTGG - Intronic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
937989683 2:127655180-127655202 CTCGCCCCCAGCCTGTTCTCCGG - Intronic
938076190 2:128339845-128339867 CTTCCCAACAGCCAGTGGTCAGG - Intergenic
938725275 2:134103334-134103356 AGGTCCTCCAGCCAGTGGTCAGG + Intergenic
940855335 2:158724782-158724804 CTCTCCCTCAGCCAGGTGTCTGG - Intergenic
942304591 2:174593779-174593801 CTTCCCCCCAGCATGTGGTCTGG + Intronic
943707082 2:191046999-191047021 CTCTCCCCTTCCCAGAGGTCAGG - Intronic
946008923 2:216549187-216549209 CTCTCCCCCCGCCATGGGGCTGG + Intronic
947070850 2:226286749-226286771 CCCTCCGCCTGCCAGTGTTCAGG + Intergenic
1169697546 20:8407719-8407741 CACTCCCTCAGCCGGTGATCAGG + Intronic
1170658475 20:18313871-18313893 CTCTCCCCACGCCAGTGCTGAGG - Intronic
1170669214 20:18415267-18415289 CTCTCTCCAGGCCAGTGGTGAGG + Intronic
1171404056 20:24897933-24897955 CTCTCCCCTCCCCAGAGGTCAGG + Intergenic
1172278384 20:33693834-33693856 CCCTCAGCCAGCCAGTGGCCTGG - Intergenic
1172811703 20:37652775-37652797 CTCTCGCCCAGGCTGTGGTGCGG + Intergenic
1173880989 20:46412155-46412177 CAAGCCCCCAGCCAGTGCTCAGG + Intronic
1174402225 20:50282253-50282275 GTGTCCCCCAGCCAGGGGGCGGG + Intergenic
1175271770 20:57739097-57739119 CTCTGCCCCAGGCAGTGCCCAGG + Intergenic
1175479956 20:59303618-59303640 TTCCTCCCCAGCCAGTGCTCCGG - Intronic
1176100955 20:63364320-63364342 CTCTCCCGGAGCCAGGGGCCAGG + Intronic
1176150731 20:63589452-63589474 CCCGCCCCCAGCCGGTGCTCAGG - Exonic
1178617324 21:34145438-34145460 CTTTCCTCCAGCCAGGGGGCAGG - Intergenic
1179125059 21:38583232-38583254 CTCTGCCCCAGTCAGGGGCCTGG - Intronic
1179157598 21:38863555-38863577 TTCTGCCCCAGGCACTGGTCTGG + Intergenic
1179274912 21:39883312-39883334 CTCTCCCCAAACCAGAGGTTGGG - Intronic
1179627908 21:42658948-42658970 GTCGTCCCCAGCCAGGGGTCAGG - Intronic
1179826003 21:43966867-43966889 GTGCCCCCCAGCCAGTTGTCCGG - Intronic
1180815572 22:18787370-18787392 CCCTCCCACAGTGAGTGGTCAGG - Intergenic
1180995009 22:19961243-19961265 CCCTCCCGCAGCCAGAGGGCTGG + Exonic
1181309648 22:21937677-21937699 GTCTCCCCCAGCCCGAGCTCAGG - Intronic
1181724738 22:24804075-24804097 CTCTCCCCAAGCCAATGGGCAGG + Intergenic
1182114621 22:27748959-27748981 CTCTCCCACAGCCCATGGTGGGG + Exonic
1182406338 22:30135378-30135400 CTCTCCCTGAACCAGTGGTCTGG - Intronic
1183220186 22:36507092-36507114 CCCGCCCCCTGCCATTGGTCCGG - Exonic
1183320358 22:37161635-37161657 CACTTTCCCAGCCTGTGGTCTGG - Intronic
1183596971 22:38818716-38818738 CCCTTCCCCACCCAGGGGTCGGG + Exonic
1183672941 22:39283594-39283616 CCCATCACCAGCCAGTGGTCAGG + Intergenic
1183781615 22:40002550-40002572 CCCTCCACCCGCCAGTGGCCTGG - Intronic
1183832148 22:40423999-40424021 CTCTCCAGCAGCCAGAGGTCAGG - Intronic
1184783664 22:46661542-46661564 CCCTCCCCCAGCAGGTGGGCAGG + Intronic
1185416150 22:50711677-50711699 CACTCCCCCAGACAGGGGTCAGG - Intergenic
1203265677 22_KI270734v1_random:13061-13083 CCCTCCCACAGTGAGTGGTCAGG - Intergenic
950634258 3:14303836-14303858 CTCACCCCCACCCTGTGCTCTGG - Intergenic
951825122 3:26859773-26859795 CTCTGACCCTGCCAGTGGACAGG - Intergenic
952754783 3:36856661-36856683 CTTTCCCCCAGCCAGTGCAGTGG - Exonic
953168044 3:40482660-40482682 CTCTCCCCCAGCAAGTGTCCAGG - Exonic
953586171 3:44203020-44203042 CTTTCTCCCATCCAGTGGGCAGG - Intergenic
953605635 3:44411450-44411472 CTCTGCTCCAGCCAGGGGACGGG + Intergenic
954334579 3:49908912-49908934 CTCTTGCCCAGCCAGCGGGCAGG - Exonic
960845411 3:122000294-122000316 CTCTCCCCTCTCCAGAGGTCAGG - Intronic
962374701 3:134850408-134850430 CTCTCACCCAGCCAGAGGTCAGG - Intronic
965331396 3:167379224-167379246 CTCTCTCCCTGCCAGGTGTCAGG + Intronic
966919852 3:184604322-184604344 TTCTCGCCCAGCCAGGGCTCGGG - Intronic
967214999 3:187202228-187202250 CTCACCCCCAGCCTGTGCTCTGG + Intergenic
968092375 3:195907436-195907458 CTCTGCCCCAGCCCGAGGTGTGG - Intronic
968293534 3:197556163-197556185 CTCGCCCCCGCCCAGCGGTCGGG - Intronic
968745146 4:2356133-2356155 CTCTCCCCACCCCAGGGGTCTGG - Intronic
969687156 4:8682086-8682108 CTGTGCCCAAGCCAGTGGGCTGG + Intergenic
970434814 4:16023220-16023242 CTCTCCCCAAGCCAGCTCTCAGG + Intronic
972956250 4:44395765-44395787 CTCACCCCCAGCCAGTGTCTGGG - Intronic
977260241 4:94788525-94788547 TTCACCCACAGCCAGTGCTCTGG - Intronic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
980982394 4:139665761-139665783 CTCTCCCACGGCCAGCGGGCAGG - Exonic
985031488 4:185794872-185794894 TTCTCCCCAGGCCAGAGGTCTGG - Intronic
985292821 4:188404199-188404221 CTCTGCCCCAGCCTGTCATCTGG + Intergenic
985575757 5:672721-672743 CACTCCCACCGCCCGTGGTCCGG + Intronic
986282512 5:6335181-6335203 GTCTTCCTCAGCCAGTGGTGAGG - Intergenic
991663065 5:68969659-68969681 CTGTCTCCCACCCAGTGCTCTGG - Intergenic
996357005 5:122606135-122606157 CTCTCACCCATCCAGAGGTGAGG + Intergenic
997440572 5:133906030-133906052 CTCTCCTCCAGGCAGTGATTTGG - Intergenic
999251578 5:150185517-150185539 CTCTCCTCCTACCAGTGGCCTGG + Intergenic
999392019 5:151200039-151200061 ATCTCCCCCAGCAAGTCGACTGG + Intronic
999449833 5:151669621-151669643 CTCTCCCCAAGACAGGAGTCTGG + Intronic
1000352453 5:160362582-160362604 CTCGACCCCAGCCAGTGTCCAGG - Intronic
1001441720 5:171748951-171748973 CTCTCCTCCAGCCAAAGTTCTGG + Intergenic
1004024659 6:11806841-11806863 CTCCATCCAAGCCAGTGGTCAGG + Intronic
1006104278 6:31707249-31707271 CTCTCCCCCAGCCAGTGAGGGGG - Intronic
1006271602 6:32970304-32970326 CCTTCCCCCAGCCAGGGATCAGG - Intronic
1006369541 6:33635444-33635466 CTCTGCACCAGACAGTGGTTTGG + Intronic
1006950519 6:37818779-37818801 CCCTCCCCCAGCCCCTTGTCTGG - Intergenic
1007551053 6:42729790-42729812 CTCTCCCCAAGCCAGTACTGAGG + Intergenic
1008885183 6:56424673-56424695 CCCTCCACCAGCCAGGAGTCAGG + Intergenic
1009797895 6:68495317-68495339 CTCTCTTCAAGCCAGTGGGCAGG - Intergenic
1017235231 6:152111675-152111697 CTCCCTTCCAGCCTGTGGTCTGG - Intronic
1017324823 6:153131898-153131920 CTCTGCTCCAGCGAGTGGTCCGG - Intergenic
1018389283 6:163330267-163330289 CTCGCCCCCTCCCAGTGTTCTGG + Intergenic
1019335326 7:480074-480096 CCCTCCCCCGGCCAGCGGGCAGG + Intergenic
1019449262 7:1088349-1088371 CGCTCCCCTAGTCAGTGGTATGG - Intronic
1020734336 7:11927944-11927966 CTTTCCACCATCCAGTGGCCTGG - Intergenic
1020907093 7:14076780-14076802 CTCTGGTCCAGCCAATGGTCTGG - Intergenic
1022630251 7:32077934-32077956 CTCTCCTCCAGCTAGTGGCAGGG + Intronic
1029933908 7:104402618-104402640 CTCTCCCTCAGTCTGTGGTTAGG - Intronic
1030297530 7:107943987-107944009 TTGTCTACCAGCCAGTGGTCAGG + Intronic
1032197885 7:129799722-129799744 CTGCCCCCCATCCAGTGGGCAGG - Intergenic
1032291934 7:130596659-130596681 CTCAGCCCCAGCCAGTGTCCAGG - Intronic
1032783532 7:135183293-135183315 CCCTGCCCCAGGCAGGGGTCAGG + Intergenic
1033269235 7:139915794-139915816 GTCTGCTCCAGCCAGTGTTCTGG - Intronic
1035306934 7:157939418-157939440 CTCTCCTGCAGCCAGAGGCCTGG - Intronic
1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG + Intronic
1035433593 7:158840880-158840902 CTCTGCTCCAGCCAGTGGGCTGG - Intergenic
1036122784 8:6036297-6036319 CTCTGCCCTGCCCAGTGGTCAGG - Intergenic
1036528306 8:9556077-9556099 CTCTCCCACGGCCAGCGGCCTGG + Exonic
1036751482 8:11446248-11446270 CTCAGCCCCAGCCTGTGGTGGGG + Intronic
1037450452 8:19011849-19011871 CTCTCCCACATTCAATGGTCAGG + Intronic
1037477769 8:19274262-19274284 CTCACCATCAGCCAGTGGACAGG + Intergenic
1041175727 8:55194058-55194080 CTGTGCCCCAGGCAGTGGTCAGG + Intronic
1041352281 8:56959456-56959478 CTCTCCCCCAGGAACTGTTCTGG + Exonic
1041466528 8:58162962-58162984 CACACCCTCAGCCAGTGGTGAGG - Intronic
1044842081 8:96345130-96345152 CTCTCCATCAGCAAGTGTTCCGG - Intergenic
1047219855 8:122910705-122910727 CCCTTCCCCAGCCAGTGTGCAGG + Intronic
1047779162 8:128097859-128097881 CTGCCCCACAGCCAGTGGACAGG + Intergenic
1048963736 8:139600236-139600258 CTCGCCCCCAGCCAGGGCTGAGG - Intergenic
1049009701 8:139879246-139879268 CTCACCCCCAGCCAGGGCTTTGG - Intronic
1049210905 8:141386036-141386058 CTCCCCACTTGCCAGTGGTCTGG + Intergenic
1049538498 8:143194336-143194358 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538511 8:143194383-143194405 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538525 8:143194430-143194452 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538581 8:143194631-143194653 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1051355944 9:16239900-16239922 CTCACCCCCAGCCAGGGCCCAGG + Intronic
1057961841 9:99464740-99464762 CTCTCCCCCATCCTTTGCTCTGG - Intergenic
1058663027 9:107283449-107283471 CTCTCCCCCAGCCCGTGCCCCGG - Exonic
1060051742 9:120383097-120383119 TTCTGGCCCAGCCAGTGGTGTGG - Intergenic
1060750528 9:126165553-126165575 CCCTCCCCCAGTCAGAGGACAGG + Intergenic
1060793319 9:126499856-126499878 CCCTCCCCCAGCCCGCGGGCCGG + Intronic
1060797302 9:126521692-126521714 CTCACCCCCAGCCAGTGCCAGGG + Intergenic
1061749910 9:132770433-132770455 CCCTACCCCAGCCAGCGTTCTGG - Intronic
1062296195 9:135828465-135828487 CTCTCCTACAGCCAGGGGCCAGG + Intronic
1062471410 9:136707154-136707176 CTCCTCCCCTGCCAGTGGTGTGG - Intergenic
1062535868 9:137020866-137020888 CGGACCCCCAGCCAGTGGTGCGG - Exonic
1062626963 9:137447775-137447797 CTGTCCCCCAGCCACGGGGCAGG + Exonic
1203772421 EBV:56360-56382 ATCTACCCCAGCCTGTTGTCTGG + Intergenic
1186529064 X:10277191-10277213 CTCTTCCCCAACCAGGGGTTGGG - Intergenic
1187546030 X:20253188-20253210 CACTCCCCAACCCAGTGGTGTGG - Intronic
1189446221 X:41084618-41084640 CGCCCCCGCAGCCAGTGGCCCGG + Intergenic
1189707063 X:43769394-43769416 TTCTACGCCAGCCAGTGGACAGG - Exonic
1190050682 X:47146520-47146542 CTGTGACCCAGCCAGAGGTCAGG - Intronic
1190532369 X:51392620-51392642 CTCTCCCCCACCCCATCGTCTGG + Intergenic
1190816774 X:53936568-53936590 CTCTCCCTCAGCAAGTTGTCAGG - Intergenic
1192234931 X:69289724-69289746 CTCTCCCCCAGCCTGGGGGAGGG - Intergenic
1192724097 X:73729353-73729375 TTCTCTGCCAGCCAGTGGCCAGG + Intergenic
1194349547 X:92808963-92808985 CTCTCTCCCAGCCAAGAGTCAGG + Intergenic
1194966658 X:100296441-100296463 GGCTCCCCCAGCCCGTGATCTGG - Exonic
1195095059 X:101493895-101493917 CTCTTCCCCAGCCCCTGATCTGG - Exonic
1199731122 X:150632936-150632958 CTCTCCCCAGGCCAGAGCTCTGG - Intronic
1199853271 X:151740246-151740268 CTCTCCACTAGCCAGAGGTGGGG - Intronic
1200657868 Y:5925564-5925586 CTCTCTCCCAGCCAAAAGTCAGG + Intergenic